Build Packages / XDS test (JFJoch plugin) (push) Successful in 11m4s
Build Packages / Unit tests (push) Skipped
Build Packages / build:windows:nocuda (push) Successful in 17m46s
Build Packages / build:windows:cuda (push) Successful in 20m20s
Build Packages / build:viewer-tgz:cpu (push) Successful in 15m56s
Build Packages / build:viewer-tgz:cuda (push) Successful in 17m57s
Build Packages / build:rugnux-tgz (x86_64) (push) Successful in 14m10s
Build Packages / build:rugnux:windows (push) Successful in 11m12s
Build Packages / build:rugnux:aarch64 (cross) (push) Successful in 7m14s
Build Packages / build:rpm (rocky8_nocuda) (push) Successful in 22m13s
Build Packages / build:rpm (rocky9_nocuda) (push) Successful in 19m17s
Build Packages / build:rpm (ubuntu2204_nocuda) (push) Successful in 21m21s
Build Packages / build:rpm (ubuntu2404_nocuda) (push) Successful in 17m26s
Build Packages / build:rpm (rocky8_sls9) (push) Successful in 23m56s
Build Packages / build:rpm (rocky9_sls9) (push) Successful in 20m48s
Build Packages / build:rpm (rocky8) (push) Successful in 23m43s
Build Packages / build:rpm (rocky9) (push) Successful in 20m38s
Build Packages / build:rpm (ubuntu2204) (push) Successful in 24m57s
Build Packages / build:rpm (ubuntu2404) (push) Successful in 20m58s
Build Packages / XDS test (durin plugin) (push) Successful in 10m43s
Build Packages / Generate python client (push) Successful in 47s
Build Packages / Build documentation (push) Successful in 1m5s
Build Packages / Create release (push) Skipped
Build Packages / XDS test (neggia plugin) (push) Successful in 8m57s
Build Packages / DIALS test (push) Successful in 18m40s
* `rugnux --model` reports CC(model, data) - the correlation of the merged intensities with the placed, scaled model - by resolution shell, on the same shells as CC1/2, with the reflection count and a significance for each. * `rugnux --model` fits the model's scale, anisotropic B and bulk-solvent parameters on the working reflections only, so the R-free it reports is measured against a model no free reflection helped scale. * The bulk-solvent parameters of `rugnux --model` are searched over their physically meaningful range instead of being fitted without bounds, so a model is never scaled with a solvent term that has silently switched itself off. * The rigid-body placement of `rugnux --model` uses the same bounded bulk solvent as the reported fit, so a model is no longer placed against a target carrying a solvent term with no physical meaning. * `rugnux --model` puts the model into the data's own description of the lattice before placing it, so a model whose cell is written on other axes - I-centred where the run indexed C-centred, a different unique axis, a permuted orthorhombic cell - is placed rather than scored where it was read; `MODEL_CHANGE_OF_BASIS=` and `MODEL_SETTING_AS_READ=` report it when it happens. * The rugnux results report opens with a summary - `VERDICT=` (`OK`, `WARNINGS`, `UNUSABLE`, `FAILED`), `VERDICT_TEXT=`, `PATHOLOGY_FLAGS=` with one closed-vocabulary code per condition that warned, and the `WARNING:` lines, which used to close the file - and the sections after it are renumbered 1-5 with no gaps. * `rugnux --developer` writes the full results report - the pipeline-internal keys and the long explanations the default report now leaves out - and `--finalist-ledger` adds the evidence for every space group the search considered, not only the one it adopted. * The results report warns when the merged data carry no usable signal and when too little of reciprocal space was measured inside the fitted resolution, and omits `FITTED_RESOLUTION` where the CC1/2 curve it is fitted on never falls off. * rugnux detects translational pseudo-symmetry and reports it under the `PSEUDO_TRANSLATION` flag as `TNCS_DETECTED=` and the `TNCS_*` keys - a translation the merged data are exactly invariant under is reported as `UNDECLARED_LATTICE_TRANSLATION=` under `LATTICE_TRANSLATION` instead - and a detected pseudo-translation can no longer buy a false screw axis in the space-group search or hide a twin from the L-test (`L_TEST_VS_TNCS=`). * The space-group search determines glide planes from zonal systematic absences, so a non-Sohncke space group such as P 2_1/c or Pbca is named where the run previously stopped at its Sohncke subgroup; `SOHNCKE_SPACE_GROUP=` carries the best Sohncke group beside it on every run that searched, and a centre of symmetry is never claimed. * Where the cell metric carries more rotational symmetry than the Bravais class the indexer named, the extra rotations are put to the intensities and the space-group search is asked again on the metric's own cell - adopted only where the intensities confirm the higher symmetry - so a lattice that is nearly but not exactly hexagonal, or whose reduction landed in a sub-cell, still reaches its true point group. * Systematic-absence calls rest on the evidence rather than on counts: a screw axis whose absent class the data show extinct is no longer refused because a handful of reflections in it read as present, and `SPACE_GROUP_ALTERNATIVES=` no longer drops a candidate that differs only on a zone the sweep never measured. * A reference correlation measured on too few reflections is refused instead of scored zero, so a run given a reference MTZ is no longer reindexed on an operator that mapped almost everything outside the reference's coverage. * A frame counts as indexed from 6 spots on its lattice rather than 9, so a weakly diffracting crystal whose frames cannot carry 9 is no longer refused the lattice it fits; `--min-indexed-spots` overrides it. * `-C` accepts a known cell in any equivalent description - conventional or primitive, centred or not - instead of only the reduced primitive form, so a centred cell given the way it is published no longer makes the run report that it found no lattice. * Each reflection is corrected for the sensor's quantum efficiency at the angle it meets the detector (attenuation lengths from the NIST tables, which also fixes the spot-width parallax term on CdTe) and for the attenuation of the flight path between the sample and its pixel; `--flight-path air|helium|vacuum` declares the medium - default air, since no file states it - and the report says what was assumed and what it was worth. The unmerged MTZ records the factors in new `QE` and `FLIGHT` columns beside `LP`, so raw counts are `I / LP * QE * FLIGHT`, and `_process.h5` in new optional `qe` and `flight` datasets. * Rotation geometry post-refinement fits the crystal and the detector at once, against the observed spot positions and the observed rocking angles together, so the refined distance depends far less on how wrong the file's distance was. * A coarsely sliced sweep integrates correctly: partials are joined into one rocking event by angle rather than by frame count, so two crossings of the Ewald sphere are no longer summed into one full, and at 0.5 degrees per image or coarser the per-frame geometry refinement accepts a spot whose miss the exposure's own rotation accounts for. * `rugnux --mode scale` reports the detector tilt and direct beam of the geometry it re-scaled at, instead of zeros that read as a flat detector, and no longer warns that no image was indexed on a run whose lattice came from its input file. * Every rotation run that determined a space group and merged reports what the mounting cost: `SPINDLE_LOST_UNIQUE_FRACTION=` is the fraction (0-1) of unique reflections the mounting made unmeasurable under the measured point group, also written to the master as `/entry/MX/spindleLostUniqueFraction` and what the mounting warning fires on; `SPINDLE_SYMMETRY_AXIS_ANGLE_DEG=` / `SPINDLE_SYMMETRY_AXIS_ORDER=` describe the mounting in the `--developer` report. * Stills and grid scans carry a per-image `spindle_blind_fraction` - how much of a rotation sweep's blind cone this orientation would make unrecoverable, 0.5 and above calling for a second orientation - through the CBOR stream, HDF5 (`/entry/MX/spindleBlindFraction`), the plot and scan-result APIs, and the viewer and frontend plots; an absent value means the frame could not be assessed and is not a 0. * The results report's `REPORT_VERSION` is 7. Reviewed-on: #77 Co-authored-by: Filip Leonarski <filip.leonarski@psi.ch>
304 lines
40 KiB
Markdown
304 lines
40 KiB
Markdown
# External test data
|
||
|
||
Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only
|
||
ever sees its own detectors is not tested. The datasets below were collected by other people,
|
||
on detectors and in file formats we do not produce ourselves, and are used here to check that
|
||
`rugnux` reads foreign files correctly and reduces them to sensible results. Most were collected
|
||
at other facilities; a few come from SLS beamlines, where the data are still written by someone
|
||
else's detector and someone else's acquisition system. Their authors published all of these for
|
||
exactly this kind of reuse, and this page is where we credit them.
|
||
|
||
**None of these data were collected by us.** If you use any of them, cite the dataset DOI in
|
||
the table below; the repositories themselves are cited in
|
||
[ACKNOWLEDGEMENT](ACKNOWLEDGEMENT.md).
|
||
|
||
## Where the values come from
|
||
|
||
- **Source** is the repository we downloaded from and that repository's own citable DOI for
|
||
the archive we took. Every DOI on this page was resolved against DataCite before it was
|
||
written down, and the identity of each dataset was taken from the repository's record for
|
||
the archive - not from our directory names.
|
||
- **Beamline, resolution, space group and cell are the values deposited with the PDB entry**,
|
||
read from the RCSB data API. They describe the published experiment. They are *not* our
|
||
reprocessing results; no quantity measured by Jungfraujoch appears on this page.
|
||
- **Detector is read out of the image files themselves** - the NXmx
|
||
`/entry/instrument/detector/description` or the miniCBF `# Detector:` header - because the
|
||
detector named in a PDB entry is often only approximate. Where the two differ, the
|
||
difference is listed below the table.
|
||
- Anything that could not be established from one of those sources is left blank.
|
||
|
||
## Datasets
|
||
|
||
| PDB | Source | Facility / beamline | d<sub>min</sub> (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title |
|
||
|---|---|---|---|---|---|---|---|
|
||
| [11IF](https://www.rcsb.org/structure/11IF) | IRRMC [10.18430/M311IF](https://doi.org/10.18430/M311IF) | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 |
|
||
| [36GK](https://www.rcsb.org/structure/36GK) | IRRMC [10.18430/M336GK](https://doi.org/10.18430/M336GK) | CLSI 08ID-1 | 2.28 | I 2 2 2 | 120.6 189.5 199.7 90.0 90.0 90.0 | Dectris Eiger 9M | D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain |
|
||
| [5F6M](https://www.rcsb.org/structure/5F6M) | SBGrid [10.15785/sbgrid/201](https://doi.org/10.15785/sbgrid/201) | SSRL BL11-1 | 1.10 | P 21 21 21 | 54.8 58.5 67.4 90.0 90.0 90.0 | PILATUS 6M | Isotropic Trypsin Model for Comparison of Diffuse Scattering |
|
||
| [5REO](https://www.rcsb.org/structure/5REO) | Zenodo [10.5281/zenodo.3730956](https://doi.org/10.5281/zenodo.3730956) | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 |
|
||
| [5SRC](https://www.rcsb.org/structure/5SRC) | IRRMC [10.18430/M35SRC](https://doi.org/10.18430/M35SRC) | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers |
|
||
| [6HV2](https://www.rcsb.org/structure/6HV2) | IRRMC [10.18430/m36hv2](https://doi.org/10.18430/m36hv2) | SLS X06SA | 1.71 | P 61 2 2 | 68.9 68.9 133.6 90.0 90.0 120.0 | Dectris Eiger 16M | MMP-13 in complex with the peptide IMISF |
|
||
| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A |
|
||
| [6O2H](https://www.rcsb.org/structure/6O2H) | SBGrid [10.15785/sbgrid/747](https://doi.org/10.15785/sbgrid/747) | CHESS F1 | 1.21 | P 1 | 27.4 32.1 34.5 88.7 108.5 111.9 | PILATUS3 6M | Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset |
|
||
| [6R72](https://www.rcsb.org/structure/6R72) | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | SOLEIL PROXIMA 2 | 3.95 | P 1 21 1 | 117.8 110.8 155.6 90.0 93.2 90.0 | Dectris Eiger 9M | Crystal structure of BmrA-E504A in an outward-facing conformation |
|
||
| [6RLR](https://www.rcsb.org/structure/6RLR) | Zenodo [10.5281/zenodo.5886687](https://doi.org/10.5281/zenodo.5886687) | Diamond I04 | 2.00 | P 1 | 40.0 40.0 63.6 80.4 76.3 68.2 | Eiger 16M | Crystal structure of CD9 large extracellular loop |
|
||
| [6TTN](https://www.rcsb.org/structure/6TTN) | IRRMC [10.18430/m36ttn](https://doi.org/10.18430/m36ttn) | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine |
|
||
| [6UKF](https://www.rcsb.org/structure/6UKF) | IRRMC [10.18430/m36ukf](https://doi.org/10.18430/m36ukf) | APS 22-ID | 1.00 | P 1 21 1 | 61.0 37.3 69.0 90.0 109.8 90.0 | Dectris Eiger 16M | HhaI endonuclease in Complex with DNA at 1 Angstrom Resolution |
|
||
| [6YQF](https://www.rcsb.org/structure/6YQF) | IRRMC [10.18430/m36yqf](https://doi.org/10.18430/m36yqf) | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly |
|
||
| [6ZE4](https://www.rcsb.org/structure/6ZE4) | SBGrid [10.15785/sbgrid/806](https://doi.org/10.15785/sbgrid/806) | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide |
|
||
| [7ATG](https://www.rcsb.org/structure/7ATG) | IRRMC [10.18430/m37atg](https://doi.org/10.18430/m37atg) | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution |
|
||
| [7D1M](https://www.rcsb.org/structure/7D1M) | IRRMC [10.18430/m37brr](https://doi.org/10.18430/m37brr) | SSRF BL17U1 | 1.35 | P 1 21 1 | 55.5 99.0 59.6 90.0 108.5 90.0 | Dectris Eiger 16M | CRYSTAL STRUCTURE OF THE SARS-CoV-2 MAIN PROTEASE COMPLEXED WITH GC376 |
|
||
| [7DKP](https://www.rcsb.org/structure/7DKP) | IRRMC [10.18430/M37DKP](https://doi.org/10.18430/M37DKP) | ESRF MASSIF-3 | 1.45 | P 1 21 1 | 49.8 169.5 49.8 90.0 93.5 90.0 | Dectris Eiger 4M | Crystal structure of E. coli Grx2 in complex with GSH at 1.45 A resolution |
|
||
| [7K1L](https://www.rcsb.org/structure/7K1L) | IRRMC [10.18430/m37k1l](https://doi.org/10.18430/m37k1l) | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate |
|
||
| [7KCN](https://www.rcsb.org/structure/7KCN) | IRRMC [10.18430/m37kcn](https://doi.org/10.18430/m37kcn) | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins |
|
||
| [7MZT](https://www.rcsb.org/structure/7MZT) | IRRMC [10.18430/m37mzt](https://doi.org/10.18430/m37mzt) | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A |
|
||
| [7ORR](https://www.rcsb.org/structure/7ORR) | IRRMC [10.18430/M37ORR](https://doi.org/10.18430/M37ORR) | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 |
|
||
| [7PH1](https://www.rcsb.org/structure/7PH1) | IRRMC [10.18430/M37PH1](https://doi.org/10.18430/M37PH1) | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid |
|
||
| [7PQ7](https://www.rcsb.org/structure/7PQ7) | IRRMC [10.18430/M3.IRRMC.6072](https://doi.org/10.18430/M3.IRRMC.6072) | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 |
|
||
| [7QIJ](https://www.rcsb.org/structure/7QIJ) | SBGrid [10.15785/sbgrid/907](https://doi.org/10.15785/sbgrid/907) | PETRA III, EMBL c/o DESY P13 (MX1) | 4.10 | P 21 21 21 | 143.5 324.9 369.4 90.0 90.0 90.0 | PILATUS 6M-F | Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY |
|
||
| [7QIS](https://www.rcsb.org/structure/7QIS) | IRRMC [10.18430/M37QIS](https://doi.org/10.18430/M37QIS) | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX |
|
||
| [7RIS](https://www.rcsb.org/structure/7RIS) | IRRMC [10.18430/M37RIS](https://doi.org/10.18430/M37RIS) | APS 21-ID-D | 1.72 | P 32 2 1 | 44.5 44.5 189.9 90.0 90.0 120.0 | Dectris Eiger 9M | Crystal structure of RPA3624, a beta-propeller lactonase from Rhodopseudomonas palustris, with active-site bound phosphate |
|
||
| [7RJI](https://www.rcsb.org/structure/7RJI) | IRRMC [10.18430/M37RJI](https://doi.org/10.18430/M37RJI) | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid |
|
||
| [7TCD](https://www.rcsb.org/structure/7TCD) | IRRMC [10.18430/m37tcd](https://doi.org/10.18430/m37tcd) | SLS X06SA | 1.70 | C 1 2 1 | 138.5 47.9 78.1 90.0 107.6 90.0 | Dectris Eiger 16M | LOV2-DARPIN fusion: D13 |
|
||
| [7YZX](https://www.rcsb.org/structure/7YZX) | IRRMC [10.18430/M37YZX](https://doi.org/10.18430/M37YZX) | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. |
|
||
| [8A1A](https://www.rcsb.org/structure/8A1A) | IRRMC [10.18430/M38A1A](https://doi.org/10.18430/M38A1A) | SLS X06SA | 2.05 | P 65 | 191.9 191.9 122.4 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct |
|
||
| [8AGQ](https://www.rcsb.org/structure/8AGQ) | IRRMC [10.18430/M38AGQ](https://doi.org/10.18430/M38AGQ) | SLS X06DA | 1.09 | C 1 2 1 | 89.9 55.4 54.8 90.0 113.5 90.0 | PILATUS 2MF | Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione |
|
||
| [8DYZ](https://www.rcsb.org/structure/8DYZ) | SBGrid [10.15785/sbgrid/957](https://doi.org/10.15785/sbgrid/957) | CHESS F1 | 1.27 | P 43 21 2 | 79.6 79.6 38.3 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset |
|
||
| [8DZ7](https://www.rcsb.org/structure/8DZ7) | SBGrid [10.15785/sbgrid/958](https://doi.org/10.15785/sbgrid/958) | CHESS F1 | 1.34 | P 21 21 21 | 30.5 56.4 73.9 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset |
|
||
| [8EGN](https://www.rcsb.org/structure/8EGN) | IRRMC [10.18430/M38EGN](https://doi.org/10.18430/M38EGN) | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 |
|
||
| [8IYA](https://www.rcsb.org/structure/8IYA) | IRRMC [10.18430/m38iya](https://doi.org/10.18430/m38iya) | SSRF BL02U1 | 2.43 | C 1 2 1 | 102.7 50.1 109.2 90.0 91.8 90.0 | Dectris EIGER2 Si 9M | Complex of SETDB1-derived peptide bound to UBE2E1 |
|
||
| [8K1G](https://www.rcsb.org/structure/8K1G) | IRRMC [10.18430/M38K1G](https://doi.org/10.18430/M38K1G) | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae |
|
||
| [8OIC](https://www.rcsb.org/structure/8OIC) | IRRMC [10.18430/m38oic](https://doi.org/10.18430/m38oic) | Diamond I04 | 2.80 | P 1 | 73.1 94.7 120.6 105.1 90.0 93.8 | Eiger 16M | Trichomonas vaginalis riboside hydrolase (His-tagged) |
|
||
| [8PQD](https://www.rcsb.org/structure/8PQD) | IRRMC [10.18430/m38pqd](https://doi.org/10.18430/m38pqd) | ESRF MASSIF-3 | 1.50 | P 21 21 21 | 59.4 59.4 192.9 90.0 90.0 90.0 | Dectris Eiger 4M | c-KIT kinase domain in complex with avapritinib derivative 10 |
|
||
| [8QQ7](https://www.rcsb.org/structure/8QQ7) | Zenodo [10.5281/zenodo.14901515](https://doi.org/10.5281/zenodo.14901515) | ESRF MASSIF-1 | 3.62 | P 64 2 2 | 146.0 146.0 153.6 90.0 90.0 120.0 | PILATUS3 2M | Structure of SpNOX: a Bacterial NADPH oxidase |
|
||
| [8R5R](https://www.rcsb.org/structure/8R5R) | IRRMC [10.18430/m38r5r](https://doi.org/10.18430/m38r5r) | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor |
|
||
| [8SA8](https://www.rcsb.org/structure/8SA8) | IRRMC [10.18430/M38SA8](https://doi.org/10.18430/M38SA8) | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) |
|
||
| [8SQQ](https://www.rcsb.org/structure/8SQQ) | IRRMC [10.18430/M38SQQ](https://doi.org/10.18430/M38SQQ) | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) |
|
||
| [8SQT](https://www.rcsb.org/structure/8SQT) | IRRMC [10.18430/M38SQT](https://doi.org/10.18430/M38SQT) | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) |
|
||
| [8T7R](https://www.rcsb.org/structure/8T7R) | IRRMC [10.18430/M38T7R](https://doi.org/10.18430/M38T7R) | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 |
|
||
| [8THA](https://www.rcsb.org/structure/8THA) | IRRMC [10.18430/m38tha](https://doi.org/10.18430/m38tha) | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form |
|
||
| [8U0I](https://www.rcsb.org/structure/8U0I) | IRRMC [10.18430/m38u0i](https://doi.org/10.18430/m38u0i) | ALS 8.2.1 | 1.54 | P 43 21 2 | 50.3 50.3 90.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of PA0012 complexed with cyclic-di-GMP from Pseudomonas aeruginosa |
|
||
| [8V4O](https://www.rcsb.org/structure/8V4O) | IRRMC [10.18430/m38v4o](https://doi.org/10.18430/m38v4o) | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans |
|
||
| [8XBP](https://www.rcsb.org/structure/8XBP) | IRRMC [10.18430/M38XBP](https://doi.org/10.18430/M38XBP) | SOLEIL PROXIMA 1 | 1.99 | C 1 2 1 | 148.3 50.8 60.2 90.0 92.3 90.0 | Dectris Eiger 16M | Crystal structure of AtNATA1 bound to Acetyl CoA |
|
||
| [8XTE](https://www.rcsb.org/structure/8XTE) | SBGrid [10.15785/sbgrid/1101](https://doi.org/10.15785/sbgrid/1101) | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP |
|
||
| [8XTF](https://www.rcsb.org/structure/8XTF) | SBGrid [10.15785/sbgrid/1102](https://doi.org/10.15785/sbgrid/1102) | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C |
|
||
| [8XTG](https://www.rcsb.org/structure/8XTG) | SBGrid [10.15785/sbgrid/1100](https://doi.org/10.15785/sbgrid/1100) | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA |
|
||
| [8YS9](https://www.rcsb.org/structure/8YS9) | IRRMC [10.18430/M38YS9](https://doi.org/10.18430/M38YS9) | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH |
|
||
| [9B22](https://www.rcsb.org/structure/9B22) | IRRMC [10.18430/m39b22](https://doi.org/10.18430/m39b22) | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) |
|
||
| [9BN8](https://www.rcsb.org/structure/9BN8) | IRRMC [10.18430/m39bn8](https://doi.org/10.18430/m39bn8) | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 |
|
||
| [9CRW](https://www.rcsb.org/structure/9CRW) | IRRMC [10.18430/m39crw](https://doi.org/10.18430/m39crw) | CLSI 08ID-1 | 2.49 | P 1 21 1 | 84.0 104.6 118.8 90.0 93.4 90.0 | Dectris Eiger 9M | Crystal structure of the Candida albicans kinesin-8 proximal tail domain |
|
||
| [9GJX](https://www.rcsb.org/structure/9GJX) | IRRMC [10.18430/M39GJX](https://doi.org/10.18430/M39GJX) | Diamond I04 | 2.40 | P 1 21 1 | 76.8 115.8 103.8 90.0 110.3 90.0 | Eiger 16M | Bacillus licheniformis nitroreductase |
|
||
| [9HS7](https://www.rcsb.org/structure/9HS7) | IRRMC [10.18430/M39HS7](https://doi.org/10.18430/M39HS7) | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER |
|
||
| [9I0A](https://www.rcsb.org/structure/9I0A) | IRRMC [10.18430/M39I0A](https://doi.org/10.18430/M39I0A) | SOLEIL PROXIMA 1 | 2.22 | P 21 21 2 | 75.2 98.7 208.6 90.0 90.0 90.0 | Dectris Eiger 16M | CARM1 in complex with arg-aDMA analog |
|
||
| [9IG7](https://www.rcsb.org/structure/9IG7) | IRRMC [10.18430/M39IG7](https://doi.org/10.18430/M39IG7) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.60 | P 21 21 2 | 111.5 153.5 69.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides |
|
||
| [9IH9](https://www.rcsb.org/structure/9IH9) | IRRMC [10.18430/M39IH9](https://doi.org/10.18430/M39IH9) | ESRF MASSIF-3 | 1.70 | C 1 2 1 | 78.8 133.9 82.3 90.0 101.4 90.0 | Dectris EIGER1 Si 4M | KEAP1 complexed to linear peptide 6 |
|
||
| [9JZO](https://www.rcsb.org/structure/9JZO) | IRRMC [10.18430/m39jzo](https://doi.org/10.18430/m39jzo) | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. |
|
||
| [9MH4](https://www.rcsb.org/structure/9MH4) | IRRMC [10.18430/M39MH4](https://doi.org/10.18430/M39MH4) | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes |
|
||
| [9MIN](https://www.rcsb.org/structure/9MIN) | SBGrid [10.15785/sbgrid/1151](https://doi.org/10.15785/sbgrid/1151) | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 |
|
||
| [9O0H](https://www.rcsb.org/structure/9O0H) | IRRMC [10.18430/M39O0H](https://doi.org/10.18430/M39O0H) | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker |
|
||
| [9P7Q](https://www.rcsb.org/structure/9P7Q) | IRRMC [10.18430/M39P7Q](https://doi.org/10.18430/M39P7Q) | SSRL BL12-1 | 2.21 | C 1 2 1 | 97.0 45.0 72.1 90.0 105.1 90.0 | Dectris EIGER2 Si 16M | 273K human S-adenosylmethionine decarboxylase |
|
||
| [9PBB](https://www.rcsb.org/structure/9PBB) | IRRMC [10.18430/M39PBB](https://doi.org/10.18430/M39PBB) | SSRL BL12-1 | 2.17 | C 1 2 1 | 97.4 45.9 72.2 90.0 105.0 90.0 | Dectris EIGER2 Si 16M | 293K human S-adenosylmethionine decarboxylase |
|
||
| [9RP9](https://www.rcsb.org/structure/9RP9) | IRRMC [10.18430/M39RP9](https://doi.org/10.18430/M39RP9) | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex |
|
||
| [9SL0](https://www.rcsb.org/structure/9SL0) | IRRMC [10.18430/M39SL0](https://doi.org/10.18430/M39SL0) | ESRF MASSIF-1 | 1.60 | P 21 21 21 | 60.2 80.2 111.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of HLA-A0201 in complex with peptide LLWNGPMAV |
|
||
| [9VX7](https://www.rcsb.org/structure/9VX7) | IRRMC [10.18430/M39VX7](https://doi.org/10.18430/M39VX7) | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor |
|
||
| [9VYB](https://www.rcsb.org/structure/9VYB) | IRRMC [10.18430/M39VYB](https://doi.org/10.18430/M39VYB) | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd |
|
||
| [9W3Y](https://www.rcsb.org/structure/9W3Y) | IRRMC [10.18430/M39W3Y](https://doi.org/10.18430/M39W3Y) | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) |
|
||
| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA |
|
||
| [9Z44](https://www.rcsb.org/structure/9Z44) | IRRMC [10.18430/M39Z44](https://doi.org/10.18430/M39Z44) | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain |
|
||
| [9ZLO](https://www.rcsb.org/structure/9ZLO) | Zenodo [10.5281/zenodo.18652652](https://doi.org/10.5281/zenodo.18652652) | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE |
|
||
| [9ZM0](https://www.rcsb.org/structure/9ZM0) | IRRMC [10.18430/M39ZM0](https://doi.org/10.18430/M39ZM0) | NSLS-II 17-ID-1 | 2.10 | P 1 21 1 | 50.4 30.1 91.2 90.0 97.1 90.0 | Dectris EIGER1 Si 9M | Crystal structure of monomeric Atg23 |
|
||
| [9ZMU](https://www.rcsb.org/structure/9ZMU) | IRRMC [10.18430/M39ZMU](https://doi.org/10.18430/M39ZMU) | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) |
|
||
| [5JVN](https://www.rcsb.org/structure/5JVN) | IRRMC [10.18430/m35jvn](https://doi.org/10.18430/m35jvn) | ESRF ID29 | 2.90 | P 6 2 2 | 249.4 249.4 84.1 90.0 90.0 120.0 | PILATUS3 6M | C3-type pyruvate phosphate dikinase: intermediate state of the swiveling-domain mechanism |
|
||
| [5M17](https://www.rcsb.org/structure/5M17) | Zenodo [10.5281/zenodo.4300323](https://doi.org/10.5281/zenodo.4300323) | Diamond I02 | 1.03 | I 4 | 108.6 108.6 67.7 90.0 90.0 90.0 | PILATUS 6M-F | Structure of the GH99 endo-alpha-mannanase from Bacteroides xylanisolvens |
|
||
| [6FID](https://www.rcsb.org/structure/6FID) | SBGrid [10.15785/sbgrid/541](https://doi.org/10.15785/sbgrid/541) | ESRF ID30B | 2.20 | P 21 21 21 | 59.9 64.1 69.7 90.0 90.0 90.0 | PILATUS3 6M | Bovine trypsin solved by S-SAD on ID30B |
|
||
| [6FVZ](https://www.rcsb.org/structure/6FVZ) | IRRMC [10.18430/m36fvz](https://doi.org/10.18430/m36fvz) | ESRF ID23-2 | 1.80 | C 2 2 2 | 131.2 222.8 86.5 90.0 90.0 90.0 | PILATUS3 X 2M | Crystal structure of human monoamine oxidase B (MAO B) in complex with an inhibitor |
|
||
| [6HWJ](https://www.rcsb.org/structure/6HWJ) | SBGrid [10.15785/sbgrid/614](https://doi.org/10.15785/sbgrid/614) | ALBA XALOC | 1.98 | P 1 21 1 | 59.8 96.1 80.3 90.0 106.7 90.0 | PILATUS 6M | Glucosamine kinase (crystal form A) |
|
||
| [6IU8](https://www.rcsb.org/structure/6IU8) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.70 | P 31 | 85.5 85.5 98.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with cobalt |
|
||
| [6P8P](https://www.rcsb.org/structure/6P8P) | SBGrid [10.15785/sbgrid/673](https://doi.org/10.15785/sbgrid/673) | APS 24-ID-C | 1.64 | P 4 | 97.5 97.5 60.1 90.0 90.0 90.0 | PILATUS 6M-F | Structure of P. aeruginosa ATCC27853 HORMA1 |
|
||
| [6PB3](https://www.rcsb.org/structure/6PB3) | SBGrid [10.15785/sbgrid/681](https://doi.org/10.15785/sbgrid/681) | APS 24-ID-E | 2.05 | P 6 | 100.4 100.4 48.9 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of Rhizobiales Trip13 |
|
||
| [6WZO](https://www.rcsb.org/structure/6WZO) | SBGrid [10.15785/sbgrid/785](https://doi.org/10.15785/sbgrid/785) | APS 24-ID-E | 1.42 | P 1 | 43.7 50.1 69.3 106.5 90.1 97.1 | Dectris Eiger 16M | Structure of SARS-CoV-2 Nucleocapsid dimerization domain, P1 form |
|
||
| [7ARR](https://www.rcsb.org/structure/7ARR) | MXRDR [10.18150/EM87YL](https://doi.org/10.18150/EM87YL) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.10 | P 1 | 30.9 32.1 43.1 114.2 91.9 109.9 | PILATUS 6M-F | The de novo designed hybrid alpha/beta-miniprotein |
|
||
| [7L84](https://www.rcsb.org/structure/7L84) | SBGrid [10.15785/sbgrid/816](https://doi.org/10.15785/sbgrid/816) | APS 24-ID-C | 1.60 | P 43 21 2 | 79.3 79.3 37.8 90.0 90.0 90.0 | PILATUS 6M-F | Hen Egg White Lysozyme by Native S-SAD at Room Temperature |
|
||
| [7OS3](https://www.rcsb.org/structure/7OS3) | MXRDR [10.18150/74YTYQ](https://doi.org/10.18150/74YTYQ) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.18 | P 21 21 21 | 78.2 91.0 105.8 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Rhizobium etli inducible L-asparaginase |
|
||
| [8TYY](https://www.rcsb.org/structure/8TYY) | SBGrid [10.15785/sbgrid/1040](https://doi.org/10.15785/sbgrid/1040) | APS 24-ID-E | 1.68 | F 4 3 2 | 214.9 214.9 214.9 90.0 90.0 90.0 | Dectris Eiger 16M | Structure of a bacterial Ubl-deubiquitinase complex (form 2) |
|
||
| [9C18](https://www.rcsb.org/structure/9C18) | Zenodo [10.5281/zenodo.11405662](https://doi.org/10.5281/zenodo.11405662) | NSLS-II 17-ID-1 | 1.90 | P 1 | 41.9 42.0 60.2 84.1 87.2 63.7 | Dectris EIGER1 Si 9M | Human biliverdin IX beta reductase in complex with NADP |
|
||
| [9E2T](https://www.rcsb.org/structure/9E2T) | SBGrid [10.15785/sbgrid/1148](https://doi.org/10.15785/sbgrid/1148) | SSRL BL12-1 | 2.28 | P 1 | 75.5 78.1 101.2 94.6 103.4 114.5 | Dectris EIGER2 Si 16M | Structure of a de novo designed interleukin-21 mimetic complex |
|
||
| [9HNC](https://www.rcsb.org/structure/9HNC) | MXRDR [10.60884/0K7B68](https://doi.org/10.60884/0K7B68) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.88 | P 1 2 1 | 123.8 123.6 187.7 90.0 90.1 90.0 | PILATUS 6M-F | Crystal structure of potassium-independent L-asparaginase |
|
||
| [9QW8](https://www.rcsb.org/structure/9QW8) | ESRF [10.15151/ESRF-DC-2127908021](https://doi.org/10.15151/ESRF-DC-2127908021) | ESRF ID23-1 | 1.80 | P 1 | 35.6 35.6 100.9 86.5 84.2 72.5 | Dectris EIGER2 CdTe 16M | FKBP12 in complex with bifunctional ligand 1ad |
|
||
| [9RCI](https://www.rcsb.org/structure/9RCI) | Zenodo [10.5281/zenodo.15615368](https://doi.org/10.5281/zenodo.15615368) | SOLEIL PROXIMA 2 | 1.66 | P 1 | 35.9 39.3 100.9 98.3 90.3 90.1 | Dectris Eiger 9M | Crystal Structure of Flap Endonuclease FEN1 with Compound 28 |
|
||
| [8OWM](https://www.rcsb.org/structure/8OWM) | MXRDR [10.18150/II5MT4](https://doi.org/10.18150/II5MT4) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.70 | P 1 | 95.5 95.6 95.8 90.4 93.6 117.8 | Dectris Eiger 16M | Crystal structure of glutamate dehydrogenase 2 from Arabidopsis thaliana binding Ca, NAD and 2,2-dihydroxyglutarate |
|
||
| — | Zenodo [10.5281/zenodo.1036416](https://doi.org/10.5281/zenodo.1036416) | Diamond Light Source I19-1 | | | | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 |
|
||
| — | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | | | | | Dectris Eiger 9M | Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation |
|
||
| — | Zenodo [10.5281/zenodo.20041091](https://doi.org/10.5281/zenodo.20041091) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
|
||
| — | Zenodo [10.5281/zenodo.20135265](https://doi.org/10.5281/zenodo.20135265) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
|
||
| — | Zenodo [10.5281/zenodo.6347466](https://doi.org/10.5281/zenodo.6347466) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source |
|
||
| — | Zenodo [10.5281/zenodo.33555](https://doi.org/10.5281/zenodo.33555) | Diamond Light Source I19-1 | | | | PILATUS 2M | Example Cytidine data set from I19-1 at Diamond Light Source |
|
||
| — | Zenodo [10.5281/zenodo.11946282](https://doi.org/10.5281/zenodo.11946282) | Diamond Light Source I19 | | | | PILATUS 2M | RODIN X-ray Diffraction Data 2360282 (L-alanine) |
|
||
|
||
Seven rows have no PDB code. Six are small-molecule / chemical-crystallography datasets, kept
|
||
because they exercise short wavelengths, CdTe sensors, fine slicing and non-zero detector
|
||
2θ; the seventh is the second collection in the 6R72 Zenodo record, described below. They have
|
||
no deposited macromolecular values, so those columns are blank, and their titles are the
|
||
repository record titles verbatim.
|
||
|
||
## Archives that are not a single sweep
|
||
|
||
Most rows above are a single continuous rotation. Twenty-one archives are not; their layout is read
|
||
from the image files themselves, from the repository file listings and from the depositors' own
|
||
description of the record. Where an archive held more than one collection, only one is kept -
|
||
the repository's project page is not a reliable guide to this, because it describes the project
|
||
rather than the tarball (7TCD's page lists a 900-frame miniCBF sweep the archive does not
|
||
contain).
|
||
|
||
**6R72 - two collections on one crystal.** The Zenodo record holds two complete 360° sweeps of
|
||
3600 × 0.1° frames taken from the same crystal: a helical collection, which produced the
|
||
deposited structure, and a low-dose collection from a single position, which was not used for a
|
||
deposition and therefore has no PDB entry. Both are in the table, sharing one DOI; the deposited
|
||
values belong to the helical collection only. The record also ships the authors' `XDS.INP`.
|
||
|
||
**The three CHESS depositions - wedges plus a measured background.** Each crystal was rotated in
|
||
50° wedges of 500 × 0.1° frames and translated between wedges to spread the dose. Each crystal
|
||
also has a rotation at 1° per frame taken with the crystal translated out of the beam, which the
|
||
depositors include as a measured background and say can be matched to the diffraction frames by
|
||
the `phi` value in the image header.
|
||
|
||
| PDB | Crystals | Wedges per crystal | Background rotation |
|
||
|---|---|---|---|
|
||
| 8DYZ | 1 | 8 | 360 frames |
|
||
| 8DZ7 | 2 | 4 | 200 frames per crystal |
|
||
| 6O2H | 4 | 1, 3, 2, 5 - 11 in all | 50, 145, 95, 235 frames, one per crystal |
|
||
|
||
**Seven IRRMC archives hold more than one collection.** In six of them one sweep is kept and
|
||
the rest were deleted, so a run over the data directory sees a single collection per dataset.
|
||
7RIS is the exception: its two sweeps are at different wavelengths and both are kept.
|
||
|
||
| PDB | What the archive holds | Kept |
|
||
|---|---|---|
|
||
| 6UKF | two sweeps on one crystal - 960 x 0.25° (240°) and 1440 x 0.25° (360°) | the 360° sweep |
|
||
| 7DKP | two complete 360° sweeps on one crystal, 3° apart in ω | the first |
|
||
| 9PBB | two overlapping 135° wedges of one crystal, 90 x 1.5° each | the first |
|
||
| 8U0I | a 69-frame screening wedge and three 180° sweeps on three crystals | the first 180° sweep |
|
||
| 36GK | two 360° sweeps of 1800 x 0.2° at the same geometry | the one the archive and DOI are named for |
|
||
| 9CRW | a dose pair on one crystal 37 min apart - 0.025 s at 289 mm, 0.010 s at 276 mm | the 0.025 s sweep, whose 2.5 Å target matches the deposited 2.49 Å |
|
||
| 7RIS | two crystals at two wavelengths - 1.53494 Å (Ho derivative) and 1.03329 Å (the deposited native) | **both** |
|
||
|
||
**Ten of the scout archives hold more than one collection.** Their layout was read from the
|
||
image files and repository listings; one sweep is kept for a run over the data directory unless
|
||
noted.
|
||
|
||
| PDB / dataset | What the archive holds | Kept |
|
||
|---|---|---|
|
||
| 5JVN | two 360° sweeps of one crystal, 3600 × 0.1° each (`w1_3`, `w1_4`) | the `w1_3` sweep |
|
||
| 6FID | two 360° sweeps of one crystal, 3600 × 0.1° each | the first |
|
||
| 6IU8 | a two-wavelength MAD pair, 720 × 0.5° each at 1.605 Å (low remote) and 1.740 Å (peak) | **both** - the pair is the point |
|
||
| 7OS3 | four 360° sweeps at λ 2.066 Å, 3600 × 0.1° each, from two crystal positions (`pos2_1/2`, `pos3_1/2`) | all four are kept as separate sweep directories `pos*/` |
|
||
| 7L84 | two ~720° helical sweeps, 1439 × 0.5° each at λ 1.892 Å, room temperature | the `301_helical_1` sweep |
|
||
| 5M17 | seven crystals in one tar (5M03/5M17/5MEL/5MC8/5M5D/5M3W/5LYR), one 1800-frame sweep each | only the 5M17 tar was downloaded |
|
||
| cytidine | six scans, three ω and three φ, at 2θ = 30° (I19-1 commissioning) | the 1800-frame φ scan |
|
||
| lalanine | four runs of the RODIN L-alanine deposition at 2θ = 20° | the 900-frame `pgw240050_01` run |
|
||
| 9E2T | one continuous sweep plus screening images | the 2700-frame sweep |
|
||
| 8OWM | three MXRDR zips covering one 1800-frame sweep, plus a processed-data zip | the three sweep zips (proc zip skipped) |
|
||
|
||
## Datasets published as Raw Data Letters
|
||
|
||
Three of the datasets - 6R72, 8QQ7 and 6RLR - were published as IUCrData Raw Data Letters, a
|
||
format whose purpose is to make raw images citable and re-processable in their own right. The
|
||
letters describe the collections and the difficulties in them, and are the reference for what the
|
||
data are:
|
||
|
||
- V. Zampieri, A. Vermot, M. Thepaut, I. Petit-Hartlein, F. Fieschi, P. Falson and V. Chaptal,
|
||
"X-ray diffraction images for two membrane protein crystals presenting high anisotropy; the
|
||
*B. subtilis* ABC transporter BmrA and the *S. pneumoniae* NADPH oxidase" (2025), IUCrData 10,
|
||
x250591 [doi:10.1107/S2414314625005917](https://doi.org/10.1107/S2414314625005917) - covers
|
||
6R72 and 8QQ7.
|
||
- V. Neviani, M. Lutz, W. Oosterheert, P. Gros and L. Kroon-Batenburg, "Crystal structure of the
|
||
second extracellular domain of human tetraspanin CD9: twinning and diffuse scattering" (2022),
|
||
IUCrData 7, x220852
|
||
[doi:10.1107/S2414314622008525](https://doi.org/10.1107/S2414314622008525) - covers 6RLR.
|
||
|
||
The authors of the second letter also published their own reciprocal-space reconstruction of the
|
||
6RLR data as a separate Zenodo record,
|
||
[10.5281/zenodo.6961763](https://doi.org/10.5281/zenodo.6961763).
|
||
|
||
## Detector: image file vs PDB entry
|
||
|
||
For 94 of the 95 PDB-coded rows both the image file and the PDB entry name a detector. (For
|
||
8XTG neither can be compared - the header reads `PILATUS XXX, S/N XX-XXX`.) The table above uses
|
||
the file value in every case, because the entry's label is often approximate.
|
||
|
||
**Nine of the 94 genuinely conflict** - the two sources name detectors that cannot both be
|
||
right:
|
||
|
||
| PDB | PDB entry says | Image file says | Conflict |
|
||
|---|---|---|---|
|
||
| 6JGJ | DECTRIS PILATUS3 6M | PILATUS3 300K, S/N 3-0226 | model / size |
|
||
| 8R5R | DECTRIS PILATUS 6M | Dectris EIGER2 CdTe 16M | model / size |
|
||
| 9SL0 | DECTRIS PILATUS4 X 4M | Dectris EIGER2 Si 9M | model / size |
|
||
| 9VX7 | DECTRIS EIGER X 9M | PILATUS3 6M, S/N 60-0133 | model / size |
|
||
| 7ATG | DECTRIS PILATUS3 S 6M | PILATUS 6M-F, S/N 60-0117-F | generation |
|
||
| 9O0H | DECTRIS EIGER X 16M | Dectris EIGER2 Si 16M, S/N D021324 | generation |
|
||
| 9Z44 | DECTRIS EIGER X 9M | Dectris EIGER2 Si 9M, S/N E-18-0131 | generation |
|
||
| 9HNC | DECTRIS EIGER X 16M | PILATUS 6M-F, S/N 60-0117-F | model / size |
|
||
| 6P8P | DECTRIS PILATUS3 S 6M | PILATUS 6M-F, S/N 60-0112-F | generation / size |
|
||
|
||
For 9SL0 the file is decisive and the entry is wrong: 3108 x 3262 pixels of 75 um on 450 um
|
||
silicon, written by EIGER2 firmware `release-2022.1.2`, is an EIGER2 9M and not a PILATUS4 4M.
|
||
|
||
A further **29 differ only in how much they state**, which is not a conflict. In 23 the NXmx
|
||
`description` gives the model and size but no generation (`Dectris Eiger 16M`) where the entry
|
||
names one (`DECTRIS EIGER X 16M`); in 6 it is the other way round, the miniCBF header naming a
|
||
generation (`PILATUS3 6M`) that the entry leaves off (`DECTRIS PILATUS 6M`) - 6YQF, 7PH1, 7QIS,
|
||
7YZX, 8XTE and 9YZK.
|
||
|
||
## Deposited models and structure factors
|
||
|
||
95 of the 102 datasets have a released PDB entry, and RCSB reports released structure factors
|
||
(`status_code_sf = REL`) for every one of them. A merged result from this pipeline can therefore be checked
|
||
against the deposited model or against the deposited intensities.
|
||
|
||
## Dataset directories whose name is not the PDB code
|
||
|
||
| Directory | PDB code in the table | Why |
|
||
|---|---|---|
|
||
| `7brr` | 7D1M | The IRRMC archive and its DOI are published under 7BRR, which the PDB obsoleted on 2020-10-28 and replaced with 7D1M. The directory and the DOI keep the archive's own name; the deposited values are 7D1M's. |
|
||
|
||
## An archive that ships placeholder images
|
||
|
||
8AGQ's `data/` directory contains 30 files named `ForBackgroundOnly_000NN.img` alongside the
|
||
1800-frame sweep. They are not images: each is a 64-byte text file holding a path string. A
|
||
reader that globs `*.img` will pick them up, so they are named here rather than silently left.
|
||
|
||
## Datasets with no PDB entry
|
||
|
||
| Dataset | Repository record | Why there is no PDB code |
|
||
|---|---|---|
|
||
| `6r72/ld` | Zenodo record 10.5281/zenodo.14894181, file prefix `V-CK63-8-ld_1_` | a second collection in the 6R72 record - a low-dose sweep on the same crystal, not the one the deposited structure was built from |
|
||
| `cuhf2` | Zenodo record 10.5281/zenodo.6347466 | a small-molecule dataset, not a PDB deposition |
|
||
| `dnba` | Zenodo record 10.5281/zenodo.1036416 | a small-molecule dataset, not a PDB deposition |
|
||
| `metformin` | Zenodo record 10.5281/zenodo.20135265 | a small-molecule dataset, not a PDB deposition |
|
||
| `nidppe` | Zenodo record 10.5281/zenodo.20041091 | a small-molecule dataset, not a PDB deposition |
|
||
| `cytidine` | Zenodo record 10.5281/zenodo.33555 | a small-molecule dataset, not a PDB deposition |
|
||
| `lalanine` | Zenodo record 10.5281/zenodo.11946282 | a small-molecule dataset, not a PDB deposition |
|
||
|
||
Five of the six small-molecule sets have a published structure to check a run against. These are
|
||
reference values from the literature, not results obtained here.
|
||
|
||
| Dataset | Space group | Cell (A, deg) | T | Reference |
|
||
|---|---|---|---|---|
|
||
| `dnba` | `C 1 2/c 1` (15) | 20.2635 8.7575 9.6697 / 90 109.941 90 | 30 K | the Zenodo record's own title and the `xia2.html` the depositors ship inside it, corroborated by COD 4510614/4510615 - Cryst. Growth Des. **13** (2013) 1861-1871 [doi:10.1021/cg300906j](https://doi.org/10.1021/cg300906j) |
|
||
| `metformin` | `P 1 21/c 1` (14) | 7.9104 13.8794 7.9310 / 90 114.606 90 | 100 K | the hydrochloride, form I; COD 2108029 - Acta Cryst. B**73** (2017) 10-22 [doi:10.1107/S2052520616017844](https://doi.org/10.1107/S2052520616017844) |
|
||
| `nidppe` | `P 1 21/c 1` (14) | 11.2779 13.3386 15.8739 / 90 98.7953 90 | 150 K | COD 2012031 - Acta Cryst. C**57** (2001) 690-693 [doi:10.1107/S0108270101003961](https://doi.org/10.1107/S0108270101003961) |
|
||
| `cytidine` | `P 21 21 21` (19) | 13.98 14.788 5.119 / 90 90 90 | 296 K | β-cytidine; COD 2001311 - D. L. Ward, Acta Cryst. C**49** (1993) 1789-1792 [doi:10.1107/S0108270193003464](https://doi.org/10.1107/S0108270193003464) |
|
||
| `lalanine` | `P 21 21 21` (19) | 5.7952 5.933 12.362 / 90 90 90 | ambient | COD 2104782 - N. A. Tumanov et al., Acta Cryst. B**66** (2010) 458-471 [doi:10.1107/S010876811001983X](https://doi.org/10.1107/S010876811001983X) |
|
||
|
||
`cuhf2` has no confirmed cell. Its space group is published as `P 4/n m m` (Phys. Rev. B **81**,
|
||
064422 (2010) [doi:10.1103/PhysRevB.81.064422](https://doi.org/10.1103/PhysRevB.81.064422)) but no
|
||
numeric cell was located, so a run on it can be scored on the space group and not on the cell.
|
||
|
||
## Licences
|
||
|
||
Each dataset carries the licence of its own deposition, stated on the record page linked
|
||
above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's
|
||
own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each
|
||
record states. None of these data are redistributed with Jungfraujoch; this page only records
|
||
where they came from.
|