Files
Jungfraujoch/docs/EXTERNAL_TEST_DATA.md
T

526 lines
71 KiB
Markdown
Raw Blame History

This file contains ambiguous Unicode characters
This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.
# External test data
Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only
ever sees its own detectors is not tested. The datasets below were collected by other people,
on detectors and in file formats we do not produce ourselves, and are used here to check that
`rugnux` reads foreign files correctly and reduces them to sensible results. Most were collected
at other facilities; a few come from SLS beamlines, where the data are still written by someone
else's detector and someone else's acquisition system. Their authors published all of these for
exactly this kind of reuse, and this page is where we credit them.
**None of these data were collected by us.** If you use any of them, cite the dataset DOI in
the table below; the repositories themselves are cited in
[ACKNOWLEDGEMENT](ACKNOWLEDGEMENT.md).
## Where the values come from
- **Source** is the repository we downloaded from and that repository's own citable DOI for
the archive we took. Every DOI on this page was resolved against DataCite - or, for 6NEN,
whose DOI is registered with Crossref, against Crossref - before it was written down, and the identity of each dataset was taken from the repository's record for
the archive - not from our directory names.
- **Beamline, resolution, space group and cell are the values deposited with the PDB entry**,
read from the RCSB data API. They describe the published experiment. They are *not* our
reprocessing results; no quantity measured by Jungfraujoch appears on this page.
- **Detector is read out of the image files themselves** - the NXmx
`/entry/instrument/detector/description`, the miniCBF `# Detector:` header, the marCCD
instrument header or the SMV key block - which is authoritative where the PDB entry names a
different detector.
- Anything that could not be established from one of those sources is left blank.
## Datasets
| PDB | Source | Facility / beamline | d<sub>min</sub> (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title |
|---|---|---|---|---|---|---|---|
| [11IF](https://www.rcsb.org/structure/11IF) | IRRMC [10.18430/M311IF](https://doi.org/10.18430/M311IF) | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 |
| [36GK](https://www.rcsb.org/structure/36GK) | IRRMC [10.18430/M336GK](https://doi.org/10.18430/M336GK) | CLSI 08ID-1 | 2.28 | I 2 2 2 | 120.6 189.5 199.7 90.0 90.0 90.0 | Dectris Eiger 9M | D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain |
| [3INP](https://www.rcsb.org/structure/3INP) | IRRMC [10.18430/m33inp](https://doi.org/10.18430/m33inp) | APS 21-ID-F | 2.05 | F 41 3 2 | 224.1 224.1 224.1 90.0 90.0 90.0 | marCCD, 225 mm plate | 2.05 Angstrom Resolution Crystal Structure of D-ribulose-phosphate 3-epimerase from Francisella tularensis. |
| [3KY7](https://www.rcsb.org/structure/3KY7) | IRRMC [10.18430/m33ky7](https://doi.org/10.18430/m33ky7) | APS 21-ID-G | 2.35 | P 43 3 2 | 125.2 125.2 125.2 90.0 90.0 90.0 | marCCD, 300 mm plate | 2.35 Angstrom resolution crystal structure of a putative tRNA (guanine-7-)-methyltransferase (trmD) from Staphylococcus aureus subsp. aureus MRSA252 |
| [5EBI](https://www.rcsb.org/structure/5EBI) | MXRDR [10.18150/9887707](https://doi.org/10.18150/9887707) | BESSY 14.2 | 1.09 | P 1 21 1 | 35.7 44.1 35.7 90.0 120.0 90.0 | marCCD, 225 mm plate | Crystal structure of a DNA-RNA chimera in complex with Ba2+ ions: a case of unusual multi-domain twinning |
| [5EPE](https://www.rcsb.org/structure/5EPE) | IRRMC [10.18430/m3159c](https://doi.org/10.18430/m3159c) | APS 21-ID-G | 1.90 | F 2 3 | 157.5 157.5 157.5 90.0 90.0 90.0 | Rayonix MX-300 | Crystal structure of SAM-dependent methyltransferase from Thiobacillus denitrificans in complex with S-Adenosyl-L-homocysteine |
| [5F6M](https://www.rcsb.org/structure/5F6M) | SBGrid [10.15785/sbgrid/201](https://doi.org/10.15785/sbgrid/201) | SSRL BL11-1 | 1.10 | P 21 21 21 | 54.8 58.5 67.4 90.0 90.0 90.0 | PILATUS 6M | Isotropic Trypsin Model for Comparison of Diffuse Scattering |
| [5J23](https://www.rcsb.org/structure/5J23) | IRRMC [10.18430/M35J23](https://doi.org/10.18430/M35J23) | APS 21-ID-G | 2.30 | H 3 | 175.8 175.8 136.8 90.0 90.0 120.0 | Rayonix MX-300 | Crystal structure of NADPH-dependent glyoxylate/hydroxypyruvate reductase SMc04462 (SmGhrB) from Sinorhizobium meliloti in complex with 2'-phospho-ADP-ribose |
| [5JVN](https://www.rcsb.org/structure/5JVN) | IRRMC [10.18430/m35jvn](https://doi.org/10.18430/m35jvn) | ESRF ID29 | 2.90 | P 6 2 2 | 249.4 249.4 84.1 90.0 90.0 120.0 | PILATUS3 6M | C3-type pyruvate phosphate dikinase: intermediate state of the swiveling-domain mechanism |
| [5KY6](https://www.rcsb.org/structure/5KY6) | MXRDR [10.18150/repod.1494374](https://doi.org/10.18150/repod.1494374) | BESSY 14.2 | 1.94 | P 1 21 1 | 84.5 57.3 164.0 90.0 102.6 90.0 | marCCD, 225 mm plate | Human muscle fructose-1,6-bisphosphate aldolase |
| [5LZL](https://www.rcsb.org/structure/5LZL) | Zenodo [10.5281/zenodo.54757](https://doi.org/10.5281/zenodo.54757) | Diamond I02 | 3.47 | P 31 2 1 | 205.6 205.6 199.2 90.0 90.0 120.0 | PILATUS 6M-F | Pyrobaculum calidifontis 5-aminolaevulinic acid dehydratase |
| [5M17](https://www.rcsb.org/structure/5M17) | Zenodo [10.5281/zenodo.4300323](https://doi.org/10.5281/zenodo.4300323) | Diamond I02 | 1.03 | I 4 | 108.6 108.6 67.7 90.0 90.0 90.0 | PILATUS 6M-F | Structure of the GH99 endo-alpha-mannanase from Bacteroides xylanisolvens |
| [5MLN](https://www.rcsb.org/structure/5MLN) | IRRMC [10.18430/m35mln](https://doi.org/10.18430/m35mln) | ESRF ID23-2 | 1.60 | P 21 2 21 | 74.2 80.4 80.5 90.0 90.0 90.0 | PILATUS3 2M | The crystal structure of alcohol dehydrogenase 10 from Candida magnoliae |
| [5NW5](https://www.rcsb.org/structure/5NW5) | SBGrid [10.15785/sbgrid/446](https://doi.org/10.15785/sbgrid/446) | SLS X06DA | 6.50 | P 21 21 21 | 92.1 169.8 390.2 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of the Rif1 N-terminal domain (RIF1-NTD) from Saccharomyces cerevisiae in complex with DNA |
| [5REO](https://www.rcsb.org/structure/5REO) | Zenodo [10.5281/zenodo.3730956](https://doi.org/10.5281/zenodo.3730956) | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 |
| [5SRC](https://www.rcsb.org/structure/5SRC) | IRRMC [10.18430/M35SRC](https://doi.org/10.18430/M35SRC) | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers |
| [5T39](https://www.rcsb.org/structure/5T39) | SBGrid [10.15785/sbgrid/356](https://doi.org/10.15785/sbgrid/356) | APS 21-ID-F | 1.10 | P 1 21 1 | 50.2 41.3 58.5 90.0 98.6 90.0 | Rayonix MX-300 | Crystal Structure of the N-terminal domain of EvdMO1 in the presence of SAH and D-fucose |
| [6CDL](https://www.rcsb.org/structure/6CDL) | IRRMC [10.18430/m36cdl](https://doi.org/10.18430/m36cdl) | APS 22-ID | 1.25 | P 21 21 2 | 58.3 85.9 46.1 90.0 90.0 90.0 | marCCD, 300 mm plate | HIV-1 wild type protease with GRL-03214A, 6-5-5-ring fused umbrella-like tetrahydropyranofuran as the P2-ligand, a cyclopropylaminobenzothiazole as the P2'-ligand and 3,5-difluorophenylmethyl as the P1-ligand |
| [6F3P](https://www.rcsb.org/structure/6F3P) | IRRMC [10.18430/M36F3P](https://doi.org/10.18430/M36F3P) | APS 22-ID | 1.35 | C 1 2 1 | 142.9 85.7 112.0 90.0 122.2 90.0 | marCCD, 300 mm plate | Crystal structure of S-adenosyl-L-homocysteine hydrolase from Pseudomonas aeruginosa in complex with 3'-deoxyadenosine and K+ cation |
| [6FID](https://www.rcsb.org/structure/6FID) | SBGrid [10.15785/sbgrid/541](https://doi.org/10.15785/sbgrid/541) | ESRF ID30B | 2.20 | P 21 21 21 | 59.9 64.1 69.7 90.0 90.0 90.0 | PILATUS3 6M | Bovine trypsin solved by S-SAD on ID30B |
| [6FVZ](https://www.rcsb.org/structure/6FVZ) | IRRMC [10.18430/m36fvz](https://doi.org/10.18430/m36fvz) | ESRF ID23-2 | 1.80 | C 2 2 2 | 131.2 222.8 86.5 90.0 90.0 90.0 | PILATUS3 X 2M | Crystal structure of human monoamine oxidase B (MAO B) in complex with an inhibitor |
| [6FWC](https://www.rcsb.org/structure/6FWC) | IRRMC [10.18430/m36fwc](https://doi.org/10.18430/m36fwc) | ESRF MASSIF-3 | 1.70 | C 2 2 2 | 131.7 222.1 86.3 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of human monoamine oxidase B (MAO B) in complex with fluorophenyl-chromone-carboxamide |
| [6G1F](https://www.rcsb.org/structure/6G1F) | Zenodo [10.5281/zenodo.1059413](https://doi.org/10.5281/zenodo.1059413) | Diamond I03 | 2.25 | C 1 2 1 | 329.3 83.9 133.4 90.0 111.6 90.0 | PILATUS3 6M | Crystal structure of D-phenylglycine aninotransferase (D-PhgAT) from Pseudomonas stutzeri with PLP internal aldimine |
| [6H2P](https://www.rcsb.org/structure/6H2P) | IRRMC [10.18430/m36h2p](https://doi.org/10.18430/m36h2p) | BESSY 14.1 | 1.48 | C 2 2 21 | 103.5 107.1 216.5 90.0 90.0 90.0 | PILATUS 6M | Crystal Structure of Arg184Gln mutant of Human Prolidase with Mn ions and Cacodylate ligand |
| [6H5T](https://www.rcsb.org/structure/6H5T) | IRRMC [10.18430/m36h5t](https://doi.org/10.18430/m36h5t) | BESSY 14.3 | 1.69 | I 4 2 2 | 86.8 86.8 141.8 90.0 90.0 90.0 | marCCD, 225 mm plate | Intersectin SH3A short isoform |
| [6HV2](https://www.rcsb.org/structure/6HV2) | IRRMC [10.18430/m36hv2](https://doi.org/10.18430/m36hv2) | SLS X06SA | 1.71 | P 61 2 2 | 68.9 68.9 133.6 90.0 90.0 120.0 | Dectris Eiger 16M | MMP-13 in complex with the peptide IMISF |
| [6HWJ](https://www.rcsb.org/structure/6HWJ) | SBGrid [10.15785/sbgrid/614](https://doi.org/10.15785/sbgrid/614) | ALBA XALOC | 1.98 | P 1 21 1 | 59.8 96.1 80.3 90.0 106.7 90.0 | PILATUS 6M | Glucosamine kinase (crystal form A) |
| [6I3J](https://www.rcsb.org/structure/6I3J) | IRRMC [10.18430/m36i3j](https://doi.org/10.18430/m36i3j) | BESSY 14.1 | 2.59 | F 2 2 2 | 134.4 203.8 226.7 90.0 90.0 90.0 | marCCD, 225 mm plate | Bilirubin oxidase from Myrothecium verrucaria in complex with ferricyanide |
| [6IU5](https://www.rcsb.org/structure/6IU5) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.25 | P 31 | 84.9 84.9 98.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with zinc ions |
| [6IU6](https://www.rcsb.org/structure/6IU6) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.90 | P 31 | 84.7 84.7 97.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with nickel ions |
| [6IU8](https://www.rcsb.org/structure/6IU8) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.70 | P 31 | 85.5 85.5 98.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with cobalt |
| [6IU9](https://www.rcsb.org/structure/6IU9) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 3.00 | P 31 | 85.3 85.3 97.6 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with iron ions |
| [6JGH](https://www.rcsb.org/structure/6JGH) | IRRMC [10.18430/m36jgh](https://doi.org/10.18430/m36jgh) | SPring-8 BL44XU | 0.94 | P 21 21 21 | 50.6 62.5 68.2 90.0 90.0 90.0 | marCCD, 300 mm plate | Crystal structure of the F99S/M153T/V163A/T203I variant of GFP at 0.94 A |
| [6JGI](https://www.rcsb.org/structure/6JGI) | IRRMC [10.18430/m36jgi](https://doi.org/10.18430/m36jgi) | SPring-8 BL44XU | 0.85 | P 21 21 21 | 50.9 62.4 69.2 90.0 90.0 90.0 | marCCD, 300 mm plate | Crystal structure of the S65T/F99S/M153T/V163A variant of GFP at 0.85 A |
| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A |
| [6MOJ](https://www.rcsb.org/structure/6MOJ) | SBGrid [10.15785/sbgrid/620](https://doi.org/10.15785/sbgrid/620) | ALS 5.0.1 | 2.43 | I 41 2 2 | 130.4 130.4 293.5 90.0 90.0 90.0 | PILATUS3 6M | Dimeric DARPin A_angle_R5 complex with EpoR |
| [6NEN](https://www.rcsb.org/structure/6NEN) | UQ eSpace [10.14264/uql.2018.843](https://doi.org/10.14264/uql.2018.843) | Australian Synchrotron MX2 | 2.15 | P 3 1 2 | 105.5 105.5 35.1 90.0 90.0 120.0 | SMV, S/N 928 | Catalytic domain of Proteus mirabilis ScsC |
| [6O2H](https://www.rcsb.org/structure/6O2H) | SBGrid [10.15785/sbgrid/747](https://doi.org/10.15785/sbgrid/747) | CHESS F1 | 1.21 | P 1 | 27.4 32.1 34.5 88.7 108.5 111.9 | PILATUS3 6M | Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset |
| [6OEL](https://www.rcsb.org/structure/6OEL) | SBGrid [10.15785/sbgrid/652](https://doi.org/10.15785/sbgrid/652) | ALS 8.2.1 | 3.10 | F 41 3 2 | 328.1 328.1 328.1 90.0 90.0 90.0 | SMV, S/N 905 | Engineered Fab bound to IL-4 receptor |
| [6P8P](https://www.rcsb.org/structure/6P8P) | SBGrid [10.15785/sbgrid/673](https://doi.org/10.15785/sbgrid/673) | APS 24-ID-C | 1.64 | P 4 | 97.5 97.5 60.1 90.0 90.0 90.0 | PILATUS 6M-F | Structure of P. aeruginosa ATCC27853 HORMA1 |
| [6PB3](https://www.rcsb.org/structure/6PB3) | SBGrid [10.15785/sbgrid/681](https://doi.org/10.15785/sbgrid/681) | APS 24-ID-E | 2.05 | P 6 | 100.4 100.4 48.9 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of Rhizobiales Trip13 |
| [6PXB](https://www.rcsb.org/structure/6PXB) | SBGrid [10.15785/sbgrid/698](https://doi.org/10.15785/sbgrid/698) | APS 24-ID-E | 1.75 | P 32 | 64.0 64.0 119.4 90.0 90.0 120.0 | PILATUS 6M-F | N-Terminal SH2 domain of the p120RasGAP |
| [6PXC](https://www.rcsb.org/structure/6PXC) | SBGrid [10.15785/sbgrid/699](https://doi.org/10.15785/sbgrid/699) | APS 24-ID-E | 1.60 | I 2 2 2 | 44.2 64.8 87.2 90.0 90.0 90.0 | PILATUS 6M-F | N-Terminal SH2 domain of the p120RasGAP bound to a p190RhoGAP phosphotyrosine peptide |
| [6QAJ](https://www.rcsb.org/structure/6QAJ) | SBGrid [10.15785/sbgrid/637](https://doi.org/10.15785/sbgrid/637) | Diamond I03 | 2.90 | C 2 2 21 | 59.8 169.3 374.5 90.0 90.0 90.0 | PILATUS3 6M | Structure of the tripartite motif of KAP1/TRIM28 |
| [6R72](https://www.rcsb.org/structure/6R72) | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | SOLEIL PROXIMA 2 | 3.95 | P 1 21 1 | 117.8 110.8 155.6 90.0 93.2 90.0 | Dectris Eiger 9M | Crystal structure of BmrA-E504A in an outward-facing conformation |
| [6RLR](https://www.rcsb.org/structure/6RLR) | Zenodo [10.5281/zenodo.5886687](https://doi.org/10.5281/zenodo.5886687) | Diamond I04 | 2.00 | P 1 | 40.0 40.0 63.6 80.4 76.3 68.2 | Eiger 16M | Crystal structure of CD9 large extracellular loop |
| [6S1U](https://www.rcsb.org/structure/6S1U) | MXRDR [10.18150/repod.0005795](https://doi.org/10.18150/repod.0005795) | BESSY 14.2 | 1.90 | P 1 21 1 | 51.6 29.4 85.5 90.0 103.8 90.0 | marCCD, 225 mm plate | Crystal structure of dimeric M-PMV protease C7A/D26N/C106A mutant in complex with inhibitor |
| [6TOC](https://www.rcsb.org/structure/6TOC) | Zenodo [10.5281/zenodo.3571040](https://doi.org/10.5281/zenodo.3571040) | SLS X06DA | 1.85 | P 42 | 31.5 31.5 81.6 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of the oligomerisation domain of the transcription factor PHOSPHATE STARVATION RESPONSE 1 from Arabidopsis (crystal form 3). |
| [6TTN](https://www.rcsb.org/structure/6TTN) | IRRMC [10.18430/m36ttn](https://doi.org/10.18430/m36ttn) | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine |
| [6U7G](https://www.rcsb.org/structure/6U7G) | IRRMC [10.18430/m36u7g](https://doi.org/10.18430/m36u7g) | APS 23-ID-B | 2.35 | P 1 21 1 | 99.6 98.7 147.5 90.0 104.6 90.0 | Dectris Eiger 16M | HCoV-229E RBD Class V in complex with human APN |
| [6UKF](https://www.rcsb.org/structure/6UKF) | IRRMC [10.18430/m36ukf](https://doi.org/10.18430/m36ukf) | APS 22-ID | 1.00 | P 1 21 1 | 61.0 37.3 69.0 90.0 109.8 90.0 | Dectris Eiger 16M | HhaI endonuclease in Complex with DNA at 1 Angstrom Resolution |
| [6VWW](https://www.rcsb.org/structure/6VWW) | IRRMC [10.18430/m36vww](https://doi.org/10.18430/m36vww) | APS 19-ID | 2.20 | P 63 | 150.5 150.5 111.3 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2. |
| [6W4H](https://www.rcsb.org/structure/6W4H) | IRRMC [10.18430/m36w4h](https://doi.org/10.18430/m36w4h) | APS 21-ID-F | 1.80 | P 31 2 1 | 167.7 167.7 51.9 90.0 90.0 120.0 | Rayonix MX-300 | 1.80 Angstrom Resolution Crystal Structure of NSP16 - NSP10 Complex from SARS-CoV-2 |
| [6W75](https://www.rcsb.org/structure/6W75) | IRRMC [10.18430/m36w75](https://doi.org/10.18430/m36w75) | APS 21-ID-F | 1.95 | P 32 2 1 | 166.2 166.2 98.3 90.0 90.0 120.0 | Rayonix MX-300 | 1.95 Angstrom Resolution Crystal Structure of NSP10 - NSP16 Complex from SARS-CoV-2 |
| [6WZO](https://www.rcsb.org/structure/6WZO) | SBGrid [10.15785/sbgrid/785](https://doi.org/10.15785/sbgrid/785) | APS 24-ID-E | 1.42 | P 1 | 43.7 50.1 69.3 106.5 90.1 97.1 | Dectris Eiger 16M | Structure of SARS-CoV-2 Nucleocapsid dimerization domain, P1 form |
| [6YQF](https://www.rcsb.org/structure/6YQF) | IRRMC [10.18430/m36yqf](https://doi.org/10.18430/m36yqf) | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly |
| [6Z8O](https://www.rcsb.org/structure/6Z8O) | Zenodo [10.5281/zenodo.3873216](https://doi.org/10.5281/zenodo.3873216) | ESRF ID30B | 2.20 | P 1 21 1 | 63.7 97.0 121.3 90.0 104.7 90.0 | Dectris Eiger 4M | Structure of [NiFeSe] hydrogenase G491A variant from Desulfovibrio vulgaris Hildenborough pressurized with Krypton gas - structure G491A-Kr |
| [6Z9G](https://www.rcsb.org/structure/6Z9G) | Zenodo [10.5281/zenodo.3874714](https://doi.org/10.5281/zenodo.3874714) | ESRF ID30B | 1.76 | P 1 21 1 | 120.3 93.8 127.0 90.0 105.2 90.0 | Dectris Eiger 4M | Structure of [NiFeSe] hydrogenase G491A variant from Desulfovibrio vulgaris Hildenborough pressurized with Oxygen gas - structure G491A-O2 |
| [6ZE4](https://www.rcsb.org/structure/6ZE4) | SBGrid [10.15785/sbgrid/806](https://doi.org/10.15785/sbgrid/806) | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide |
| [6ZQR](https://www.rcsb.org/structure/6ZQR) | Keele University [10.21252/r2nx-0425](https://doi.org/10.21252/r2nx-0425) | Diamond I02 | 1.93 | P 4 | 113.6 113.6 44.1 90.0 90.0 90.0 | SMV, S/N 922 | Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with GlcNAc ligand bound |
| [6ZQY](https://www.rcsb.org/structure/6ZQY) | Keele University [10.21252/hx7e-rd04](https://doi.org/10.21252/hx7e-rd04) | Diamond I04 | 1.85 | P 4 | 119.3 119.3 44.2 90.0 90.0 90.0 | SMV, S/N 921 | Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with Neu5Ac ligand bound |
| [6ZR0](https://www.rcsb.org/structure/6ZR0) | Keele University [10.21252/zcfy-cw20](https://doi.org/10.21252/zcfy-cw20) | Diamond I04 | 1.94 | P 4 | 119.2 119.2 44.2 90.0 90.0 90.0 | PILATUS 6M Prosport+ | Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with N-acetylalanine ligand bound |
| [7ARR](https://www.rcsb.org/structure/7ARR) | MXRDR [10.18150/EM87YL](https://doi.org/10.18150/EM87YL) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.10 | P 1 | 30.9 32.1 43.1 114.2 91.9 109.9 | PILATUS 6M-F | The de novo designed hybrid alpha/beta-miniprotein |
| [7ATG](https://www.rcsb.org/structure/7ATG) | IRRMC [10.18430/m37atg](https://doi.org/10.18430/m37atg) | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution |
| [7BGT](https://www.rcsb.org/structure/7BGT) | MXRDR [10.18150/1HQGWO](https://doi.org/10.18150/1HQGWO) | BESSY 14.2 | 1.93 | P 1 | 29.3 67.6 69.7 76.8 83.9 83.6 | marCCD, 225 mm plate | Mason-Pfizer Monkey Virus Protease mutant C7A/D26N/C106A in complex with peptidomimetic inhibitor |
| [7D1M](https://www.rcsb.org/structure/7D1M) | IRRMC [10.18430/m37brr](https://doi.org/10.18430/m37brr) | SSRF BL17U1 | 1.35 | P 1 21 1 | 55.5 99.0 59.6 90.0 108.5 90.0 | Dectris Eiger 16M | CRYSTAL STRUCTURE OF THE SARS-CoV-2 MAIN PROTEASE COMPLEXED WITH GC376 |
| [7DKP](https://www.rcsb.org/structure/7DKP) | IRRMC [10.18430/M37DKP](https://doi.org/10.18430/M37DKP) | ESRF MASSIF-3 | 1.45 | P 1 21 1 | 49.8 169.5 49.8 90.0 93.5 90.0 | Dectris Eiger 4M | Crystal structure of E. coli Grx2 in complex with GSH at 1.45 A resolution |
| [7K1L](https://www.rcsb.org/structure/7K1L) | IRRMC [10.18430/m37k1l](https://doi.org/10.18430/m37k1l) | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate |
| [7KCN](https://www.rcsb.org/structure/7KCN) | IRRMC [10.18430/m37kcn](https://doi.org/10.18430/m37kcn) | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins |
| [7L6J](https://www.rcsb.org/structure/7L6J) | IRRMC [10.18430/m37l6j](https://doi.org/10.18430/m37l6j) | APS 21-ID-F | 1.78 | I 41 3 2 | 171.7 171.7 171.7 90.0 90.0 90.0 | Rayonix MX-300 | Crystal Structure of the Putative Hydrolase from Stenotrophomonas maltophilia |
| [7L84](https://www.rcsb.org/structure/7L84) | SBGrid [10.15785/sbgrid/816](https://doi.org/10.15785/sbgrid/816) | APS 24-ID-C | 1.60 | P 43 21 2 | 79.3 79.3 37.8 90.0 90.0 90.0 | PILATUS 6M-F | Hen Egg White Lysozyme by Native S-SAD at Room Temperature |
| [7MZT](https://www.rcsb.org/structure/7MZT) | IRRMC [10.18430/m37mzt](https://doi.org/10.18430/m37mzt) | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A |
| [7N0I](https://www.rcsb.org/structure/7N0I) | SBGrid [10.15785/sbgrid/835](https://doi.org/10.15785/sbgrid/835) | ALS 5.0.2 | 2.20 | P 21 21 21 | 75.8 131.6 140.0 90.0 90.0 90.0 | PILATUS3 6M | Structure of the SARS-CoV-2 N protein C-terminal domain bound to single-domain antibody E2 |
| [7N2S](https://www.rcsb.org/structure/7N2S) | SBGrid [10.15785/sbgrid/916](https://doi.org/10.15785/sbgrid/916) | SSRL BL12-1 | 2.37 | P 1 21 1 | 83.2 52.8 106.3 90.0 98.3 90.0 | PILATUS 6M | AS3.1-PRPF3-HLA*B27 |
| [7ORR](https://www.rcsb.org/structure/7ORR) | IRRMC [10.18430/M37ORR](https://doi.org/10.18430/M37ORR) | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 |
| [7OS3](https://www.rcsb.org/structure/7OS3) | MXRDR [10.18150/74YTYQ](https://doi.org/10.18150/74YTYQ) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.18 | P 21 21 21 | 78.2 91.0 105.8 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Rhizobium etli inducible L-asparaginase |
| [7OU1](https://www.rcsb.org/structure/7OU1) | MXRDR [10.18150/VQQIHQ](https://doi.org/10.18150/VQQIHQ) | BESSY 14.3 | 1.65 | P 1 21 1 | 77.9 91.3 114.2 90.0 97.1 90.0 | marCCD, 225 mm plate | Crystal structure of Rhizobium etli inducible L-asparaginase ReAV (monoclinic form MP2) |
| [7PH1](https://www.rcsb.org/structure/7PH1) | IRRMC [10.18430/M37PH1](https://doi.org/10.18430/M37PH1) | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid |
| [7PQ7](https://www.rcsb.org/structure/7PQ7) | IRRMC [10.18430/M3.IRRMC.6072](https://doi.org/10.18430/M3.IRRMC.6072) | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 |
| [7QIJ](https://www.rcsb.org/structure/7QIJ) | SBGrid [10.15785/sbgrid/907](https://doi.org/10.15785/sbgrid/907) | PETRA III, EMBL c/o DESY P13 (MX1) | 4.10 | P 21 21 21 | 143.5 324.9 369.4 90.0 90.0 90.0 | PILATUS 6M-F | Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY |
| [7QIS](https://www.rcsb.org/structure/7QIS) | IRRMC [10.18430/M37QIS](https://doi.org/10.18430/M37QIS) | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX |
| [7RAA](https://www.rcsb.org/structure/7RAA) | SBGrid [10.15785/sbgrid/881](https://doi.org/10.15785/sbgrid/881) | SSRL BL12-2 | 2.69 | P 43 21 2 | 66.4 66.4 298.3 90.0 90.0 90.0 | PILATUS 6M | Designed StabIL-2 seq15 |
| [7RIS](https://www.rcsb.org/structure/7RIS) | IRRMC [10.18430/M37RIS](https://doi.org/10.18430/M37RIS) | APS 21-ID-D | 1.72 | P 32 2 1 | 44.5 44.5 189.9 90.0 90.0 120.0 | Dectris Eiger 9M | Crystal structure of RPA3624, a beta-propeller lactonase from Rhodopseudomonas palustris, with active-site bound phosphate |
| [7RJI](https://www.rcsb.org/structure/7RJI) | IRRMC [10.18430/M37RJI](https://doi.org/10.18430/M37RJI) | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid |
| [7T5T](https://www.rcsb.org/structure/7T5T) | SBGrid [10.15785/sbgrid/864](https://doi.org/10.15785/sbgrid/864) | SSRL BL9-2 | 1.35 | P 42 21 2 | 95.3 95.3 104.9 90.0 90.0 90.0 | PILATUS 6M | Structure of Thauera sp. K11 CapP |
| [7TCD](https://www.rcsb.org/structure/7TCD) | IRRMC [10.18430/m37tcd](https://doi.org/10.18430/m37tcd) | SLS X06SA | 1.70 | C 1 2 1 | 138.5 47.9 78.1 90.0 107.6 90.0 | Dectris Eiger 16M | LOV2-DARPIN fusion: D13 |
| [7YZX](https://www.rcsb.org/structure/7YZX) | IRRMC [10.18430/M37YZX](https://doi.org/10.18430/M37YZX) | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. |
| [8A1A](https://www.rcsb.org/structure/8A1A) | IRRMC [10.18430/M38A1A](https://doi.org/10.18430/M38A1A) | SLS X06SA | 2.05 | P 65 | 191.9 191.9 122.4 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct |
| [8AGQ](https://www.rcsb.org/structure/8AGQ) | IRRMC [10.18430/M38AGQ](https://doi.org/10.18430/M38AGQ) | SLS X06DA | 1.09 | C 1 2 1 | 89.9 55.4 54.8 90.0 113.5 90.0 | PILATUS 2MF | Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione |
| [8DQB](https://www.rcsb.org/structure/8DQB) | IRRMC [10.18430/m38dqb](https://doi.org/10.18430/m38dqb) | NSLS-II 19-ID | 2.50 | I 2 3 | 164.1 164.1 164.1 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of 3-dehydroquinate dehydratase I from Klebsiella oxytoca (I23 Form) |
| [8DYZ](https://www.rcsb.org/structure/8DYZ) | SBGrid [10.15785/sbgrid/957](https://doi.org/10.15785/sbgrid/957) | CHESS F1 | 1.27 | P 43 21 2 | 79.6 79.6 38.3 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset |
| [8DZ7](https://www.rcsb.org/structure/8DZ7) | SBGrid [10.15785/sbgrid/958](https://doi.org/10.15785/sbgrid/958) | CHESS F1 | 1.34 | P 21 21 21 | 30.5 56.4 73.9 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset |
| [8EGN](https://www.rcsb.org/structure/8EGN) | IRRMC [10.18430/M38EGN](https://doi.org/10.18430/M38EGN) | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 |
| [8IYA](https://www.rcsb.org/structure/8IYA) | IRRMC [10.18430/m38iya](https://doi.org/10.18430/m38iya) | SSRF BL02U1 | 2.43 | C 1 2 1 | 102.7 50.1 109.2 90.0 91.8 90.0 | Dectris EIGER2 Si 9M | Complex of SETDB1-derived peptide bound to UBE2E1 |
| [8K1G](https://www.rcsb.org/structure/8K1G) | IRRMC [10.18430/M38K1G](https://doi.org/10.18430/M38K1G) | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae |
| [8OIC](https://www.rcsb.org/structure/8OIC) | IRRMC [10.18430/m38oic](https://doi.org/10.18430/m38oic) | Diamond I04 | 2.80 | P 1 | 73.1 94.7 120.6 105.1 90.0 93.8 | Eiger 16M | Trichomonas vaginalis riboside hydrolase (His-tagged) |
| [8OWM](https://www.rcsb.org/structure/8OWM) | MXRDR [10.18150/II5MT4](https://doi.org/10.18150/II5MT4) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.70 | P 1 | 95.5 95.6 95.8 90.4 93.6 117.8 | Dectris Eiger 16M | Crystal structure of glutamate dehydrogenase 2 from Arabidopsis thaliana binding Ca, NAD and 2,2-dihydroxyglutarate |
| [8PQD](https://www.rcsb.org/structure/8PQD) | IRRMC [10.18430/m38pqd](https://doi.org/10.18430/m38pqd) | ESRF MASSIF-3 | 1.50 | P 21 21 21 | 59.4 59.4 192.9 90.0 90.0 90.0 | Dectris Eiger 4M | c-KIT kinase domain in complex with avapritinib derivative 10 |
| [8QAW](https://www.rcsb.org/structure/8QAW) | MXRDR [10.18150/INUP4Q](https://doi.org/10.18150/INUP4Q) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.55 | H 3 | 137.7 137.7 265.9 90.0 90.0 120.0 | Dectris Eiger 16M | Medicago truncatula HISN5 (IGPD) in complex with MN, IMD, EDO, FMT, GOL and TRS |
| [8QJ5](https://www.rcsb.org/structure/8QJ5) | IRRMC [10.18430/m38qj5](https://doi.org/10.18430/m38qj5) | ELETTRA 11.2C | 1.63 | P 1 21 1 | 57.6 100.6 77.9 90.0 96.1 90.0 | PILATUS 6M | Crystal structure of the Levansucrase beta from Pseudomonas syringae pv. actinidiae |
| [8QQ7](https://www.rcsb.org/structure/8QQ7) | Zenodo [10.5281/zenodo.14901515](https://doi.org/10.5281/zenodo.14901515) | ESRF MASSIF-1 | 3.62 | P 64 2 2 | 146.0 146.0 153.6 90.0 90.0 120.0 | PILATUS3 2M | Structure of SpNOX: a Bacterial NADPH oxidase |
| [8R5R](https://www.rcsb.org/structure/8R5R) | IRRMC [10.18430/m38r5r](https://doi.org/10.18430/m38r5r) | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor |
| [8RUD](https://www.rcsb.org/structure/8RUD) | MXRDR [10.18150/RBG2F9](https://doi.org/10.18150/RBG2F9) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.10 | P 1 21 1 | 78.1 91.4 114.5 90.0 96.9 90.0 | Dectris Eiger 16M | Crystal structure of Rhizobium etli L-asparaginase ReAV K138A mutant |
| [8S38](https://www.rcsb.org/structure/8S38) | MXRDR [10.18150/CGLBVH](https://doi.org/10.18150/CGLBVH) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.89 | I 21 21 21 | 95.4 163.1 219.0 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Medicago truncatula glutamate dehydrogenase 2 in complex with citrate and NAD |
| [8SA8](https://www.rcsb.org/structure/8SA8) | IRRMC [10.18430/M38SA8](https://doi.org/10.18430/M38SA8) | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) |
| [8SQO](https://www.rcsb.org/structure/8SQO) | IRRMC [10.18430/m38sqo](https://doi.org/10.18430/m38sqo) | NSLS-II 19-ID | 1.55 | P 4 3 2 | 112.9 112.9 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (magnesium bound, F16L mutant) |
| [8SQQ](https://www.rcsb.org/structure/8SQQ) | IRRMC [10.18430/M38SQQ](https://doi.org/10.18430/M38SQQ) | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) |
| [8SQT](https://www.rcsb.org/structure/8SQT) | IRRMC [10.18430/M38SQT](https://doi.org/10.18430/M38SQT) | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) |
| [8T7R](https://www.rcsb.org/structure/8T7R) | IRRMC [10.18430/M38T7R](https://doi.org/10.18430/M38T7R) | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 |
| [8THA](https://www.rcsb.org/structure/8THA) | IRRMC [10.18430/m38tha](https://doi.org/10.18430/m38tha) | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form |
| [8TYY](https://www.rcsb.org/structure/8TYY) | SBGrid [10.15785/sbgrid/1040](https://doi.org/10.15785/sbgrid/1040) | APS 24-ID-E | 1.68 | F 4 3 2 | 214.9 214.9 214.9 90.0 90.0 90.0 | Dectris Eiger 16M | Structure of a bacterial Ubl-deubiquitinase complex (form 2) |
| [8U0I](https://www.rcsb.org/structure/8U0I) | IRRMC [10.18430/m38u0i](https://doi.org/10.18430/m38u0i) | ALS 8.2.1 | 1.54 | P 43 21 2 | 50.3 50.3 90.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of PA0012 complexed with cyclic-di-GMP from Pseudomonas aeruginosa |
| [8V4O](https://www.rcsb.org/structure/8V4O) | IRRMC [10.18430/m38v4o](https://doi.org/10.18430/m38v4o) | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans |
| [8XBP](https://www.rcsb.org/structure/8XBP) | IRRMC [10.18430/M38XBP](https://doi.org/10.18430/M38XBP) | SOLEIL PROXIMA 1 | 1.99 | C 1 2 1 | 148.3 50.8 60.2 90.0 92.3 90.0 | Dectris Eiger 16M | Crystal structure of AtNATA1 bound to Acetyl CoA |
| [8XTE](https://www.rcsb.org/structure/8XTE) | SBGrid [10.15785/sbgrid/1101](https://doi.org/10.15785/sbgrid/1101) | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP |
| [8XTF](https://www.rcsb.org/structure/8XTF) | SBGrid [10.15785/sbgrid/1102](https://doi.org/10.15785/sbgrid/1102) | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C |
| [8XTG](https://www.rcsb.org/structure/8XTG) | SBGrid [10.15785/sbgrid/1100](https://doi.org/10.15785/sbgrid/1100) | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA |
| [8Y74](https://www.rcsb.org/structure/8Y74) | XRDa [10.51093/xrd-00227](https://doi.org/10.51093/xrd-00227) | SSRF BL02U1 | 1.90 | C 1 2 1 | 125.8 76.6 87.1 90.0 92.4 90.0 | Dectris EIGER2 Si 9M | Crystal structure of 9-mer peptide from H9N2 avian influenza virus in complex with BF2*0201 |
| [8YS9](https://www.rcsb.org/structure/8YS9) | IRRMC [10.18430/M38YS9](https://doi.org/10.18430/M38YS9) | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH |
| [9B22](https://www.rcsb.org/structure/9B22) | IRRMC [10.18430/m39b22](https://doi.org/10.18430/m39b22) | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) |
| [9BN8](https://www.rcsb.org/structure/9BN8) | IRRMC [10.18430/m39bn8](https://doi.org/10.18430/m39bn8) | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 |
| [9C18](https://www.rcsb.org/structure/9C18) | Zenodo [10.5281/zenodo.11405662](https://doi.org/10.5281/zenodo.11405662) | NSLS-II 17-ID-1 | 1.90 | P 1 | 41.9 42.0 60.2 84.1 87.2 63.7 | Dectris EIGER1 Si 9M | Human biliverdin IX beta reductase in complex with NADP |
| [9CHW](https://www.rcsb.org/structure/9CHW) | SBGrid [10.15785/sbgrid/1124](https://doi.org/10.15785/sbgrid/1124) | APS 21-ID-F | 2.16 | P 61 | 98.7 98.7 82.1 90.0 90.0 120.0 | Rayonix MX-300 | Crystal structure of human polymerase eta with incoming dAMPnPP nucleotide opposite threofuranosyl thymidine in DNA template |
| [9CRW](https://www.rcsb.org/structure/9CRW) | IRRMC [10.18430/m39crw](https://doi.org/10.18430/m39crw) | CLSI 08ID-1 | 2.49 | P 1 21 1 | 84.0 104.6 118.8 90.0 93.4 90.0 | Dectris Eiger 9M | Crystal structure of the Candida albicans kinesin-8 proximal tail domain |
| [9E2T](https://www.rcsb.org/structure/9E2T) | SBGrid [10.15785/sbgrid/1148](https://doi.org/10.15785/sbgrid/1148) | SSRL BL12-1 | 2.28 | P 1 | 75.5 78.1 101.2 94.6 103.4 114.5 | Dectris EIGER2 Si 16M | Structure of a de novo designed interleukin-21 mimetic complex |
| [9EA5](https://www.rcsb.org/structure/9EA5) | SBGrid [10.15785/sbgrid/1142](https://doi.org/10.15785/sbgrid/1142) | SSRL BL9-2 | 2.00 | P 1 21 1 | 65.9 73.1 98.4 90.0 108.7 90.0 | PILATUS 6M | Structure of Citrobacter BubCD D104A mutant |
| [9FCF](https://www.rcsb.org/structure/9FCF) | MXRDR [10.18150/DGZKW3](https://doi.org/10.18150/DGZKW3) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.36 | P 4 | 91.3 91.3 35.8 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with ProFAR |
| [9FCG](https://www.rcsb.org/structure/9FCG) | MXRDR [10.18150/LDLSBT](https://doi.org/10.18150/LDLSBT) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.54 | P 4 | 87.8 87.8 35.6 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with PrFAR |
| [9FHC](https://www.rcsb.org/structure/9FHC) | Zenodo [10.5281/zenodo.11472085](https://doi.org/10.5281/zenodo.11472085) | SLS X06SA | 2.20 | I 2 3 | 227.5 227.5 227.5 90.0 90.0 90.0 | marCCD, 225 mm plate | Crystallographic structure of AcrB V612F with bound minocycline |
| [9GDJ](https://www.rcsb.org/structure/9GDJ) | ESRF [10.15151/ESRF-DC-1848199439](https://doi.org/10.15151/ESRF-DC-1848199439) | ESRF ID23-1 | 1.47 | P 41 21 2 | 123.9 123.9 126.4 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | C-Methyltransferase SgMT from Streptomyces griseoviridis |
| [9GJX](https://www.rcsb.org/structure/9GJX) | IRRMC [10.18430/M39GJX](https://doi.org/10.18430/M39GJX) | Diamond I04 | 2.40 | P 1 21 1 | 76.8 115.8 103.8 90.0 110.3 90.0 | Eiger 16M | Bacillus licheniformis nitroreductase |
| [9GQG](https://www.rcsb.org/structure/9GQG) | ESRF [10.15151/ESRF-DC-1900353437](https://doi.org/10.15151/ESRF-DC-1900353437) | ESRF ID30B | 2.00 | P 32 2 1 | 48.2 48.2 188.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | The FK1 domain of FKBP51 in complex with the macrocyclic SAFit analog m5(10,7)-(E)-OH |
| [9H0Q](https://www.rcsb.org/structure/9H0Q) | Zenodo [10.5281/zenodo.13912326](https://doi.org/10.5281/zenodo.13912326) | SOLEIL PROXIMA 2 | 2.55 | H 3 2 | 169.5 169.5 344.0 90.0 90.0 120.0 | Dectris EIGER1 Si 9M | N terminal domain of BC2L-C lectin in complex with N-(beta-L-Fucopyranosyl)-biphenyl-3-carboxamide |
| [9HNC](https://www.rcsb.org/structure/9HNC) | MXRDR [10.60884/0K7B68](https://doi.org/10.60884/0K7B68) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.88 | P 1 2 1 | 123.8 123.6 187.7 90.0 90.1 90.0 | PILATUS 6M-F | Crystal structure of potassium-independent L-asparaginase |
| [9HS7](https://www.rcsb.org/structure/9HS7) | IRRMC [10.18430/M39HS7](https://doi.org/10.18430/M39HS7) | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER |
| [9I0A](https://www.rcsb.org/structure/9I0A) | IRRMC [10.18430/M39I0A](https://doi.org/10.18430/M39I0A) | SOLEIL PROXIMA 1 | 2.22 | P 21 21 2 | 75.2 98.7 208.6 90.0 90.0 90.0 | Dectris Eiger 16M | CARM1 in complex with arg-aDMA analog |
| [9I80](https://www.rcsb.org/structure/9I80) | Zenodo [10.5281/zenodo.14844040](https://doi.org/10.5281/zenodo.14844040) | SOLEIL PROXIMA 1 | 1.95 | P 41 | 81.2 81.2 165.0 90.0 90.0 90.0 | Dectris Eiger 16M | LecA in complex with a tolcapone derivative glycomimetic |
| [9IG7](https://www.rcsb.org/structure/9IG7) | IRRMC [10.18430/M39IG7](https://doi.org/10.18430/M39IG7) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.60 | P 21 21 2 | 111.5 153.5 69.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides |
| [9IH9](https://www.rcsb.org/structure/9IH9) | IRRMC [10.18430/M39IH9](https://doi.org/10.18430/M39IH9) | ESRF MASSIF-3 | 1.70 | C 1 2 1 | 78.8 133.9 82.3 90.0 101.4 90.0 | Dectris EIGER1 Si 4M | KEAP1 complexed to linear peptide 6 |
| [9JZO](https://www.rcsb.org/structure/9JZO) | IRRMC [10.18430/m39jzo](https://doi.org/10.18430/m39jzo) | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. |
| [9KHR](https://www.rcsb.org/structure/9KHR) | Zenodo [10.5281/zenodo.14070468](https://doi.org/10.5281/zenodo.14070468) | RRCAT INDUS-2 PX-BL21 | 2.00 | P 21 21 21 | 48.7 50.3 78.0 90.0 90.0 90.0 | marCCD, 225 mm plate | Crystal structure of Plasmoredoxin, a disulfide oxidoreductase from Plasmodium falciparum crystallized in the presence of Dithiothreitol (DTT) |
| [9MH4](https://www.rcsb.org/structure/9MH4) | IRRMC [10.18430/M39MH4](https://doi.org/10.18430/M39MH4) | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes |
| [9MIN](https://www.rcsb.org/structure/9MIN) | SBGrid [10.15785/sbgrid/1151](https://doi.org/10.15785/sbgrid/1151) | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 |
| [9O0H](https://www.rcsb.org/structure/9O0H) | IRRMC [10.18430/M39O0H](https://doi.org/10.18430/M39O0H) | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker |
| [9P7Q](https://www.rcsb.org/structure/9P7Q) | IRRMC [10.18430/M39P7Q](https://doi.org/10.18430/M39P7Q) | SSRL BL12-1 | 2.21 | C 1 2 1 | 97.0 45.0 72.1 90.0 105.1 90.0 | Dectris EIGER2 Si 16M | 273K human S-adenosylmethionine decarboxylase |
| [9PBB](https://www.rcsb.org/structure/9PBB) | IRRMC [10.18430/M39PBB](https://doi.org/10.18430/M39PBB) | SSRL BL12-1 | 2.17 | C 1 2 1 | 97.4 45.9 72.2 90.0 105.0 90.0 | Dectris EIGER2 Si 16M | 293K human S-adenosylmethionine decarboxylase |
| [9Q41](https://www.rcsb.org/structure/9Q41) | SBGrid [10.15785/sbgrid/1194](https://doi.org/10.15785/sbgrid/1194) | CHESS 7B2 | 1.95 | C 2 2 21 | 118.6 133.7 82.4 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | Crystal Structure of Human Apo Spermidine Synthase |
| [9Q66](https://www.rcsb.org/structure/9Q66) | SBGrid [10.15785/sbgrid/1208](https://doi.org/10.15785/sbgrid/1208) | NSLS-II 17-ID-1 | 2.01 | P 1 21 1 | 105.9 67.3 158.0 90.0 99.1 90.0 | Dectris EIGER1 Si 9M | Human prolyl endopeptidase (PREP) - complex with JP-4-1-7 |
| [9QW8](https://www.rcsb.org/structure/9QW8) | ESRF [10.15151/ESRF-DC-2127908021](https://doi.org/10.15151/ESRF-DC-2127908021) | ESRF ID23-1 | 1.80 | P 1 | 35.6 35.6 100.9 86.5 84.2 72.5 | Dectris EIGER2 CdTe 16M | FKBP12 in complex with bifunctional ligand 1ad |
| [9RCI](https://www.rcsb.org/structure/9RCI) | Zenodo [10.5281/zenodo.15615368](https://doi.org/10.5281/zenodo.15615368) | SOLEIL PROXIMA 2 | 1.66 | P 1 | 35.9 39.3 100.9 98.3 90.3 90.1 | Dectris Eiger 9M | Crystal Structure of Flap Endonuclease FEN1 with Compound 28 |
| [9RCS](https://www.rcsb.org/structure/9RCS) | XRDa [10.51093/xrd-00383](https://doi.org/10.51093/xrd-00383) | Diamond I24 | 3.01 | P 1 21 1 | 70.0 78.8 82.3 90.0 88.6 90.0 | Eiger 9M | Cardioderma bat coronavirus KY43 receptor binding domain in complex with human CEACAM6 |
| [9RP9](https://www.rcsb.org/structure/9RP9) | IRRMC [10.18430/M39RP9](https://doi.org/10.18430/M39RP9) | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex |
| [9SL0](https://www.rcsb.org/structure/9SL0) | IRRMC [10.18430/M39SL0](https://doi.org/10.18430/M39SL0) | ESRF MASSIF-1 | 1.60 | P 21 21 21 | 60.2 80.2 111.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of HLA-A0201 in complex with peptide LLWNGPMAV |
| [9T6S](https://www.rcsb.org/structure/9T6S) | SBGrid [10.15785/sbgrid/1260](https://doi.org/10.15785/sbgrid/1260) | ESRF ID30B | 2.00 | P 21 21 21 | 63.0 64.6 102.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of the Listeria monocytogenes CadC with Cadmium |
| [9UPT](https://www.rcsb.org/structure/9UPT) | XRDa [10.51093/xrd-00191](https://doi.org/10.51093/xrd-00191) | NSRRC TPS 05A | 2.37 | P 6 | 158.3 158.3 54.0 90.0 90.0 120.0 | SMV, S/N 930 | Structure of AtBgl1A, a GH1 beta-Glucosidase from Acetivibrio thermocellus |
| [9VX7](https://www.rcsb.org/structure/9VX7) | IRRMC [10.18430/M39VX7](https://doi.org/10.18430/M39VX7) | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor |
| [9VYB](https://www.rcsb.org/structure/9VYB) | IRRMC [10.18430/M39VYB](https://doi.org/10.18430/M39VYB) | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd |
| [9W3Y](https://www.rcsb.org/structure/9W3Y) | IRRMC [10.18430/M39W3Y](https://doi.org/10.18430/M39W3Y) | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) |
| [9YL4](https://www.rcsb.org/structure/9YL4) | Zenodo [10.5281/zenodo.17298261](https://doi.org/10.5281/zenodo.17298261) | APS 17-ID | 3.70 | P 21 21 21 | 95.8 111.3 403.0 90.0 90.0 90.0 | PILATUS 6M | Crystal structure of PprA S-F filament from Deinococcus radiodurans |
| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA |
| [9Z44](https://www.rcsb.org/structure/9Z44) | IRRMC [10.18430/M39Z44](https://doi.org/10.18430/M39Z44) | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain |
| [9Z72](https://www.rcsb.org/structure/9Z72) | SBGrid [10.15785/sbgrid/1239](https://doi.org/10.15785/sbgrid/1239) | SSRL BL9-2 | 2.38 | P 31 2 1 | 59.2 59.2 426.2 90.0 90.0 120.0 | Dectris EIGER2 Si 16M | Structure of V. cholerae CapS (form 1) |
| [9ZLO](https://www.rcsb.org/structure/9ZLO) | Zenodo [10.5281/zenodo.18652652](https://doi.org/10.5281/zenodo.18652652) | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE |
| [9ZM0](https://www.rcsb.org/structure/9ZM0) | IRRMC [10.18430/M39ZM0](https://doi.org/10.18430/M39ZM0) | NSLS-II 17-ID-1 | 2.10 | P 1 21 1 | 50.4 30.1 91.2 90.0 97.1 90.0 | Dectris EIGER1 Si 9M | Crystal structure of monomeric Atg23 |
| [9ZMU](https://www.rcsb.org/structure/9ZMU) | IRRMC [10.18430/M39ZMU](https://doi.org/10.18430/M39ZMU) | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) |
| — | Zenodo [10.5281/zenodo.1036416](https://doi.org/10.5281/zenodo.1036416) | Diamond Light Source I19-1 | | | | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 |
| — | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | | | | | Dectris Eiger 9M | Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation |
| — | Zenodo [10.5281/zenodo.20041091](https://doi.org/10.5281/zenodo.20041091) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
| — | Zenodo [10.5281/zenodo.20135265](https://doi.org/10.5281/zenodo.20135265) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
| — | Zenodo [10.5281/zenodo.6347466](https://doi.org/10.5281/zenodo.6347466) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source |
| — | Zenodo [10.5281/zenodo.33555](https://doi.org/10.5281/zenodo.33555) | Diamond Light Source I19-1 | | | | PILATUS 2M | Example Cytidine data set from I19-1 at Diamond Light Source |
| — | Zenodo [10.5281/zenodo.11946282](https://doi.org/10.5281/zenodo.11946282) | Diamond Light Source I19 | | | | PILATUS 2M | RODIN X-ray Diffraction Data 2360282 (L-alanine) |
Seven rows have no PDB code. Six are small-molecule / chemical-crystallography datasets, kept
because they exercise short wavelengths, CdTe sensors, fine slicing and non-zero detector
2θ; the seventh is the second collection in the 6R72 Zenodo record, described below. They have
no deposited macromolecular values, so those columns are blank, and their titles are the
repository record titles verbatim.
Five datasets are in primitive space groups with no screw axis - 6ZQR, 6ZQY,
6ZR0 and 9FCF in P 4, and 6NEN in P 3 1 2. They are in the battery as negative controls for
screw-axis detection: the correct answer for each has no systematic absences.
6Z9G is the collection's only index-4 superstructure: its deposited cell is four times the
sublattice a/2, b, c/2, and the four copies of each of its two entities are related by the
XOR-closed trio of near-pure translations (1/2,0,0), (0,0,1/2) and (1/2,0,1/2). Every other
pseudo-translation in the collection is index 2 or a setting artefact, so it is the one set that
exercises a supercell of index greater than two.
## Archives that are not a single sweep
Most rows above are a single continuous rotation. The archives described in this section are
not, or needed special handling to obtain the images; their layout is read from the image files
themselves, from the repository file listings and from the depositors' own description of the
record. Not every archive in the table has had its layout audited to this depth. Where an archive
held more than one collection, only one is kept -
the repository's project page is not a reliable guide to this, because it describes the project
rather than the tarball (7TCD's page lists a 900-frame miniCBF sweep the archive does not
contain).
**6R72 - two collections on one crystal.** The Zenodo record holds two complete 360° sweeps of
3600 × 0.1° frames taken from the same crystal: a helical collection, which produced the
deposited structure, and a low-dose collection from a single position, which was not used for a
deposition and therefore has no PDB entry. Both are in the table, sharing one DOI; the deposited
values belong to the helical collection only. The record also ships the authors' `XDS.INP`.
**The three CHESS depositions - wedges plus a measured background.** Each crystal was rotated in
50° wedges of 500 × 0.1° frames and translated between wedges to spread the dose. Each crystal
also has a rotation at 1° per frame taken with the crystal translated out of the beam, which the
depositors include as a measured background and say can be matched to the diffraction frames by
the `phi` value in the image header.
| PDB | Crystals | Wedges per crystal | Background rotation |
|---|---|---|---|
| 8DYZ | 1 | 8 | 360 frames |
| 8DZ7 | 2 | 4 | 200 frames per crystal |
| 6O2H | 4 | 1, 3, 2, 5 - 11 in all | 50, 145, 95, 235 frames, one per crystal |
**Seven IRRMC archives hold more than one collection.** In six of them one sweep is kept and
the rest were deleted, so a run over the data directory sees a single collection per dataset.
7RIS is the exception: its two sweeps are at different wavelengths and both are kept.
| PDB | What the archive holds | Kept |
|---|---|---|
| 6UKF | two sweeps on one crystal - 960 x 0.25° (240°) and 1440 x 0.25° (360°) | the 360° sweep |
| 7DKP | two complete 360° sweeps on one crystal, 3° apart in ω | the first |
| 9PBB | two overlapping 135° wedges of one crystal, 90 x 1.5° each | the first |
| 8U0I | a 69-frame screening wedge and three 180° sweeps on three crystals | the first 180° sweep |
| 36GK | two 360° sweeps of 1800 x 0.2° at the same geometry | the one the archive and DOI are named for |
| 9CRW | a dose pair on one crystal 37 min apart - 0.025 s at 289 mm, 0.010 s at 276 mm | the 0.025 s sweep, whose 2.5 Å target matches the deposited 2.49 Å |
| 7RIS | two crystals at two wavelengths - 1.53494 Å (Ho derivative) and 1.03329 Å (the deposited native) | **both** |
**Ten further archives hold more than one collection.** Their layout was read from the
image files and repository listings; one sweep is kept for a run over the data directory unless
noted.
| PDB / dataset | What the archive holds | Kept |
|---|---|---|
| 5JVN | two 360° sweeps of one crystal, 3600 × 0.1° each (`w1_3`, `w1_4`) | the `w1_3` sweep |
| 6FID | two 360° sweeps of one crystal, 3600 × 0.1° each | the first |
| 6IU8 | a two-wavelength MAD pair, 720 × 0.5° each at 1.605 Å (low remote) and 1.740 Å (peak) | **both** - the pair is the point |
| 7OS3 | four 360° sweeps at λ 2.066 Å, 3600 × 0.1° each, from two crystal positions (`pos2_1/2`, `pos3_1/2`) | all four are kept as separate sweep directories `pos*/` |
| 7L84 | two ~720° helical sweeps, 1439 × 0.5° each at λ 1.892 Å, room temperature | the `301_helical_1` sweep |
| 5M17 | seven crystals in one tar (5M03/5M17/5MEL/5MC8/5M5D/5M3W/5LYR), one 1800-frame sweep each | only the 5M17 tar was downloaded |
| cytidine | six scans, three ω and three φ, at 2θ = 30° (I19-1 commissioning) | the 1800-frame φ scan |
| lalanine | four runs of the RODIN L-alanine deposition at 2θ = 20° | the 900-frame `pgw240050_01` run |
| 9E2T | one continuous sweep plus screening images | the 2700-frame sweep |
| 8OWM | three MXRDR zips covering one 1800-frame sweep, plus a processed-data zip | the three sweep zips (proc zip skipped) |
**Three archives needed special handling to obtain the images.**
- **5KY6** is served by MXRDR as 11 separate RAR archives, one folder of frames per archive, 50
frames per archive except the last, 564 frames in all. Reading them needs a RAR reader with
RAR3 filter support: the official 7-Zip `7zz` reads them, while the unrar-free and p7zip builds
of Enterprise Linux 8 cannot.
- **6ZR0**'s zip, as the Keele University repository serves it, is damaged: it has no central
directory. Frames 1-1059 of the 1060 were recovered from the zip's local file headers; the last
frame is lost.
- **6NEN**'s University of Queensland eSpace record blocks scripted download, so its archive was
downloaded by hand in a browser.
## Datasets published as Raw Data Letters
Three of the datasets - 6R72, 8QQ7 and 6RLR - were published as IUCrData Raw Data Letters, a
format whose purpose is to make raw images citable and re-processable in their own right. The
letters describe the collections and the difficulties in them, and are the reference for what the
data are:
- V. Zampieri, A. Vermot, M. Thepaut, I. Petit-Hartlein, F. Fieschi, P. Falson and V. Chaptal,
"X-ray diffraction images for two membrane protein crystals presenting high anisotropy; the
*B. subtilis* ABC transporter BmrA and the *S. pneumoniae* NADPH oxidase" (2025), IUCrData 10,
x250591 [doi:10.1107/S2414314625005917](https://doi.org/10.1107/S2414314625005917) - covers
6R72 and 8QQ7.
- V. Neviani, M. Lutz, W. Oosterheert, P. Gros and L. Kroon-Batenburg, "Crystal structure of the
second extracellular domain of human tetraspanin CD9: twinning and diffuse scattering" (2022),
IUCrData 7, x220852
[doi:10.1107/S2414314622008525](https://doi.org/10.1107/S2414314622008525) - covers 6RLR.
The authors of the second letter also published their own reciprocal-space reconstruction of the
6RLR data as a separate Zenodo record,
[10.5281/zenodo.6961763](https://doi.org/10.5281/zenodo.6961763).
## Detector column for marCCD and SMV files
marCCD and SMV files name the detector differently - or not at all. A marCCD file names no model:
its instrument header states the image dimensions and the pixel size, from which the plate size
follows (3072 x 73.242 um = 225 mm, 4096 x 73.242 um = 300 mm), and its comment block a serial
number; the LS-CAT beamlines additionally write `detector='Rayonix MX-300 s/n 023'` into the
dataset comment. An SMV header names only a serial (`DETECTOR_SN=930`). For those rows the
Detector column carries what the file itself establishes: the plate size (`marCCD, 225 mm
plate`), the comment's name where one is present (`Rayonix MX-300`), or the serial (`SMV, S/N
930`).
## Deposited models and structure factors
164 of the 171 datasets have a released PDB entry, and RCSB
reports released structure factors (`status_code_sf = REL`) for every one of them. A merged
result from this pipeline can therefore be checked against the deposited model or against the
deposited intensities.
## Rows where our reduction and the deposition disagree
Six of the 171 rows are ones where `rugnux` does not reproduce the deposited space group or
cell, and where we have looked at the disagreement closely enough to change how the row is
scored. They are collected here because a scoring row that silently disagrees with a published
entry is not something a reader should have to discover from the code.
**These are open questions, not errors we are attributing to the PDB.** A deposited entry was
arrived at by someone who had something we do not: a model that had to refine, and usually more
knowledge of the crystal than the images carry. Where we describe evidence below, it is evidence
about *what these images support*, which is a narrower thing than what the crystal is. In every
one of the symmetry rows the possibility that the crystal really has the lower symmetry, with a
pseudo-symmetry too exact for any test available to us to see, remains live - see the limit at
the end of this section.
How the manifest records it, in `tools/battery/open.json`:
- `ref` always keeps the deposited values verbatim, so the deposition is never lost.
- `ref_alternatives` lists the *other* answers the row accepts. Each one replaces the reference
fields it names - a space group, a cell, or both - and the row passes if our answer matches any
of the references, the deposited one included. Each must carry `why`; an alternative with no
stated reason is a schema error, not a silent pass, so the mechanism cannot become a way to
turn a failure into a pass quietly. This is how the five knife-edge rows below are recorded:
we are not asserting that our answer is right, only that both descriptions are defensible and
that picking either one is acceptable. The report counts these rows separately from ordinary
passes and prints the reason, so a reader can see how many there are and judge each.
- `ref_override` replaces the fields the battery scores against, with `ref_override_why`. It
*asserts* a corrected reference, so it is for a reference we can show to be wrong about these
images - 8XBP below - and not for a disagreement that is open.
- `unscored` drops the row from scoring entirely. It is a last resort: it also loses a test that
still works, which is why an open question is now recorded as accepted alternatives instead.
### 8XBP is a question about provenance, not about symmetry
8XBP is different in kind from the other five and should not be read alongside them. Nothing
here concerns the deposited model or its space group. The question is whether the raw images
uploaded with the entry are the same crystal the deposited cell describes: the master file
records `data_collection_date` 2023-06-21 where the entry records a collection date of
2023-06-23, and the deposited *b* = 50.78 A is 2.0% away from the *b* these images give. Two
independent signals, one of them nothing to do with our processing. The override replaces the
cell with the one DIALS 3.29 indexes de novo on this master and keeps the deposited space group
and resolution.
### Four trigonal and tetragonal rows where we read a higher point group
| PDB | Deposited | `rugnux` reads | Where it stands |
|---|---|---|---|
| 6TOC | P 4<sub>2</sub> | P 4<sub>2</sub> 2 2 | both acceptable; the refinement test is not unanimous |
| 8XTE | P 3<sub>2</sub> | P 3<sub>1</sub> 2 1 / P 3<sub>2</sub> 2 1 | both acceptable; ours is the better supported |
| 8XTG | P 3<sub>2</sub> | P 3<sub>1</sub> 2 1 / P 3<sub>2</sub> 2 1 | both acceptable; the **deposition** is the better supported |
| 6PXB | P 3<sub>2</sub> | P 3<sub>1</sub> 1 2 / P 3<sub>2</sub> 1 2 | both acceptable; unresolved in either direction |
All four accept either answer: the deposited group and the one we read both pass. None of them
is a claim that the deposited assignment is wrong - each is a question we cannot close, and 8XTE
and 8XTG do not lean the same way, so they should not be read in one voice. The two 8XT* rows
were for a time scored against our own answer by editing the reference itself, with no reason
recorded; the deposition is back in `ref` verbatim and the disagreement is stated here.
**6TOC.** The deposited asymmetric unit holds two chains, and they are related by the very
two-fold the higher group adds, to 0.16 A C-alpha RMSD over 43 residues - coordinate error at
the deposited 1.85 A. Merging in P 4<sub>2</sub> 2 2 costs 0.0006 in R<sub>meas</sub> for 1.75
times the multiplicity, and correlates better with the deposited model than the P 4<sub>2</sub>
merge does. POINTLESS, run independently on our own P1 merge, reads the same point group. The
refinement test - refine in each candidate group and compare R-free, which is the one comparison
not biased toward the group the deposited model was refined in - does **not** come out
unanimous: ZANUDA 1.097 makes P 4<sub>2</sub> 2 2 the better group at half the parameters and
reports the deposited assignment incorrect, while an independent Refmac 5.8.0431 comparison on a
symmetry-consistent free set makes P 4<sub>2</sub> the better one, by less than the spread
between refinement protocols - the spread of the test exceeds the effect it is being asked to
measure. Both answers are therefore accepted, with the refinement evidence recorded as split.
**8XTE.** The distinguishing test is the twin-immune centric zone: reflections that the higher
group makes centric but the subgroup does not are their own twin mates, so a merohedral twin law
cannot make them read centric. They read `<|E^2-1|>` = 0.946 +/- 0.012 against a centric
expectation of 0.968 and an acentric one of 0.736. Re-refinement on a shared free set, with the
twin law removed from both sides, favours the higher group. The deposited entry's published R
values are themselves reproducible only with a twin law the entry does not declare, at a twin
fraction of 0.50 - and a 0.50-twinned target already has the symmetry in question. Of the four
rows this is the one where the evidence most clearly favours what we read; it still cannot be
closed, because the centric zone is the only test that speaks to it (see the limit below), so
both answers are accepted.
**8XTG.** This row is genuinely open and is flagged as such in the manifest. Every
correlation-based instrument we have - our own operator correlations, and POINTLESS on our P1
merge - reads the higher point group, but the centric-zone test, the only one of them that can
separate real symmetry from pseudo-symmetry, reads `<|E^2-1|>` = 0.869 at -44.9 nats: between
the two expectations, and on the wrong side. The L-test indicates a twin fraction near 0.20-0.26.
Whether this crystal is partially twinned or purely pseudo-symmetric has not been established.
Here the better-supported answer is the deposited one, which is the opposite of 8XTE: the two
rows look alike in the table and are not alike in the evidence. Both answers are accepted.
**6PXB.** Unscored rather than overridden, because the evidence does not settle either way. Our
merge and POINTLESS both read a 312 point group, the added two-folds correlate at or above the
level of the three-folds nobody disputes, and merging in the higher group *lowers*
R<sub>meas</sub> at twice the multiplicity. Against that, the deposited asymmetric unit's six
chains pair under the added two-fold at 0.3-0.7 A, which is more than coordinate error at 1.75 A,
and ZANUDA settles on a different trigonal supergroup - 321 rather than 312 - whose operators
these data do not support. Neither answer is established in either direction, so both are
accepted and the row still tests everything else about the set.
### 9RCI: two defensible descriptions of one lattice
The sixth row is not about symmetry but about which cell describes the crystal. The Patterson
has an off-origin peak at 62.5% of the origin, so a genuine translational NCS relates the two
halves of the cell `rugnux` reports, and the deposited cell is that supercell's
(0, 1/2, 1/2)-centred sublattice to 0.17%. Both are correct descriptions of the same diffraction:
one leaves the near-translation in the contents of a doubled cell, the other absorbs it into the
lattice and indexes only the strong sublattice. Which one a program should prefer is a choice,
not a measurement, so the row accepts either. The alternative cell recorded in the manifest is
computed from the deposited cell alone (c' = b + 2c, centring removed), not copied from our
output, so it stays a statement about the deposition's lattice.
### The limit that applies to all four symmetry rows
A merohedral twin at a twin fraction of exactly 0.5 and a crystal that genuinely has the higher
symmetry predict **identical** intensities. No amount of data and no refinement R separates them,
and the same holds, approximately, for a pseudo-symmetry that is merely very exact. Every test
described above measures how nearly a symmetry operator holds on these images; none of them can
show that it holds exactly. Where the higher symmetry is right, merging in it gains multiplicity
and completeness; where it is a pseudo-symmetry that close, merging in it costs nothing
measurable either. That is why these rows are described as open questions, and why none of them
should be read as a statement that a deposited model is wrong.
## Dataset directories whose name is not the PDB code
| Directory | PDB code in the table | Why |
|---|---|---|
| `7brr` | 7D1M | The IRRMC archive and its DOI are published under 7BRR, which the PDB obsoleted on 2020-10-28 and replaced with 7D1M. The directory and the DOI keep the archive's own name; the deposited values are 7D1M's. |
## An archive that ships placeholder images
8AGQ's `data/` directory contains 30 files named `ForBackgroundOnly_000NN.img` alongside the
1800-frame sweep. They are not images: each is a 64-byte text file holding a path string. A
reader that globs `*.img` will pick them up, so they are named here rather than silently left.
## Datasets with no PDB entry
| Dataset | Repository record | Why there is no PDB code |
|---|---|---|
| `6r72/ld` | Zenodo record 10.5281/zenodo.14894181, file prefix `V-CK63-8-ld_1_` | a second collection in the 6R72 record - a low-dose sweep on the same crystal, not the one the deposited structure was built from |
| `cuhf2` | Zenodo record 10.5281/zenodo.6347466 | a small-molecule dataset, not a PDB deposition |
| `dnba` | Zenodo record 10.5281/zenodo.1036416 | a small-molecule dataset, not a PDB deposition |
| `metformin` | Zenodo record 10.5281/zenodo.20135265 | a small-molecule dataset, not a PDB deposition |
| `nidppe` | Zenodo record 10.5281/zenodo.20041091 | a small-molecule dataset, not a PDB deposition |
| `cytidine` | Zenodo record 10.5281/zenodo.33555 | a small-molecule dataset, not a PDB deposition |
| `lalanine` | Zenodo record 10.5281/zenodo.11946282 | a small-molecule dataset, not a PDB deposition |
Five of the six small-molecule sets have a published structure to check a run against. These are
reference values from the literature, not results obtained here.
| Dataset | Space group | Cell (A, deg) | T | Reference |
|---|---|---|---|---|
| `dnba` | `C 1 2/c 1` (15) | 20.2635 8.7575 9.6697 / 90 109.941 90 | 30 K | the Zenodo record's own title and the `xia2.html` the depositors ship inside it, corroborated by COD 4510614/4510615 - Cryst. Growth Des. **13** (2013) 1861-1871 [doi:10.1021/cg300906j](https://doi.org/10.1021/cg300906j) |
| `metformin` | `P 1 21/c 1` (14) | 7.9104 13.8794 7.9310 / 90 114.606 90 | 100 K | the hydrochloride, form I; COD 2108029 - Acta Cryst. B**73** (2017) 10-22 [doi:10.1107/S2052520616017844](https://doi.org/10.1107/S2052520616017844) |
| `nidppe` | `P 1 21/c 1` (14) | 11.2779 13.3386 15.8739 / 90 98.7953 90 | 150 K | COD 2012031 - Acta Cryst. C**57** (2001) 690-693 [doi:10.1107/S0108270101003961](https://doi.org/10.1107/S0108270101003961) |
| `cytidine` | `P 21 21 21` (19) | 13.98 14.788 5.119 / 90 90 90 | 296 K | β-cytidine; COD 2001311 - D. L. Ward, Acta Cryst. C**49** (1993) 1789-1792 [doi:10.1107/S0108270193003464](https://doi.org/10.1107/S0108270193003464) |
| `lalanine` | `P 21 21 21` (19) | 5.7952 5.933 12.362 / 90 90 90 | ambient | COD 2104782 - N. A. Tumanov et al., Acta Cryst. B**66** (2010) 458-471 [doi:10.1107/S010876811001983X](https://doi.org/10.1107/S010876811001983X) |
`cuhf2` has no confirmed cell. Its space group is published as `P 4/n m m` (Phys. Rev. B **81**,
064422 (2010) [doi:10.1103/PhysRevB.81.064422](https://doi.org/10.1103/PhysRevB.81.064422)) but no
numeric cell was located, so a run on it can be scored on the space group and not on the cell.
## The collection in numbers
The collection was chosen to widen the spread of file formats, detectors, facilities and
symmetries rather than to be easy to process. The counts below describe where it comes from;
like everything else on this page, they are metadata about the depositions and their files, not
measurements.
- **Repository:** IRRMC 84, SBGrid 35, Zenodo 28, MXRDR 14, ESRF 3, Keele University 3, XRDa 3,
UQ eSpace 1.
- **Facility** - counted from the facility part of the Facility / beamline column, the beamline
ignored so that entries deposited with and without one count the same, over the 170 rows that
name one: APS 26, Diamond 20, ESRF 16, NSLS-II 14, BESSY 12, PETRA III 12, SSRL 11, ALS 8,
SLS 7, SOLEIL 7, SPring-8 7, SSRF 6, PAL/PLS 5, CHESS 4, CLSI 3, ALBA 2, Australian
Synchrotron 2, ELETTRA 2, LNLS 2, and one each from MAX IV, NSRRC, Photon Factory and RRCAT
Indus-2 - 23 facilities.
- **Crystal system, from the deposited space group of the 164 PDB-coded rows:** orthorhombic 42,
monoclinic 40, tetragonal 22, trigonal 19, hexagonal 16, cubic 13, triclinic 12.
- **Long cell axes:** eleven PDB-coded rows have a deposited cell axis longer than 320 Å - 8V4O,
9ZMU, 9Z72, 9YL4, 5NW5, 6QAJ, 7QIJ, 8T7R, 9H0Q, 6G1F and 6OEL.
The marCCD, SMV and gzip-compressed miniCBF datasets are the reason rugnux reads those formats
natively, and accepts the `.img` and numeric-suffix (`.001`) file names they arrive with.
## Licences
Each dataset carries the licence of its own deposition, stated on the record page linked
above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's
own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each
record states. None of these data are redistributed with Jungfraujoch; this page only records
where they came from.