mx/Jungfraujoch
2
1
Fork 0
Code Issues Pull Requests Actions Packages Projects Releases 73 Wiki Activity
Files
97f57a430da3d98aaa646bbaca2ac678c065a14a
Jungfraujoch/docs/NON_SLS_TEST_DATA.md
T
leonarski_fandClaude Opus 5 bec2a10a3a docs: add the eight new public datasets to the non-SLS test list 
Three IUCrData Raw Data Letters (Zenodo, CC-BY-4.0) and five SBGrid Data
Bank depositions (CC0) have been added to the data the pipeline is
exercised on. Same rules as the rest of the page: the source is the
repository and its own citable DOI, every one of which was resolved before
it was written down; beamline, resolution, space group and cell are the
values deposited with the PDB entry; the detector is read out of the image
files. None of the new detectors disagree with their PDB entry.

Two of them do not fit the page's one-row-per-sweep shape, so the shape is
described rather than flattened. The 6R72 Zenodo record holds two complete
360-degree collections on one crystal - a helical one that produced the
deposited structure and a low-dose one that has no PDB entry - and both are
listed, sharing a DOI, with the second in the no-PDB-entry table. The three
CHESS depositions are 4-11 wedges of 50 degrees per crystal plus a rotation
taken with the crystal translated out of the beam, tabulated in a new
section.

One SBGrid deposition is named but not in the table: its images are 1995 CCD
TIFFs, a format the reader does not support, so it is not processed here and
saying so is more useful than leaving it out.

ACKNOWLEDGEMENT gains the new per-repository counts and a pointer to the
Raw Data Letter citations; TESTS points at the page.

Co-Authored-By: Claude Opus 5 (1M context) <noreply@anthropic.com>
Claude-Session: https://claude.ai/code/session_01T3yNBXk4wKdMZy1ak2NY7f
2026-08-29 23:40:10 +02:00

201 lines
24 KiB
Markdown
Raw Blame History

This file contains ambiguous Unicode characters
This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.
# Non-SLS test data
Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only
ever sees one facility's detectors is not tested. The datasets below were collected elsewhere,
on detectors and in file formats we do not produce ourselves, and are used here to check that
`rugnux` reads foreign files correctly and reduces them to sensible results. Their authors
published them for exactly this kind of reuse, and this page is where we credit them.
**None of these data were collected by us.** If you use any of them, cite the dataset DOI in
the table below; the repositories themselves are cited in
[ACKNOWLEDGEMENT](ACKNOWLEDGEMENT.md).
## Where the values come from
- **Source** is the repository we downloaded from and that repository's own citable DOI for
the archive we took. Every DOI on this page was resolved against DataCite before it was
written down, and the identity of each dataset was taken from the repository's record for
the archive - not from our directory names.
- **Beamline, resolution, space group and cell are the values deposited with the PDB entry**,
read from the RCSB data API. They describe the published experiment. They are *not* our
reprocessing results; no quantity measured by Jungfraujoch appears on this page.
- **Detector is read out of the image files themselves** - the NXmx
`/entry/instrument/detector/description` or the miniCBF `# Detector:` header - because the
detector named in a PDB entry is often only approximate. Where the two differ, the
difference is listed below the table.
- Anything that could not be established from one of those sources is left blank.
## Datasets
| PDB | Source | Facility / beamline | d<sub>min</sub> (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title |
|---|---|---|---|---|---|---|---|
| [11IF](https://www.rcsb.org/structure/11IF) | IRRMC [10.18430/M311IF](https://doi.org/10.18430/M311IF) | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 |
| [5F6M](https://www.rcsb.org/structure/5F6M) | SBGrid [10.15785/sbgrid/201](https://doi.org/10.15785/sbgrid/201) | SSRL BL11-1 | 1.10 | P 21 21 21 | 54.8 58.5 67.4 90.0 90.0 90.0 | PILATUS 6M | Isotropic Trypsin Model for Comparison of Diffuse Scattering |
| [5REO](https://www.rcsb.org/structure/5REO) | Zenodo [10.5281/zenodo.3730956](https://doi.org/10.5281/zenodo.3730956) | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 |
| [5SRC](https://www.rcsb.org/structure/5SRC) | IRRMC [10.18430/M35SRC](https://doi.org/10.18430/M35SRC) | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers |
| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A |
| [6LEO](https://www.rcsb.org/structure/6LEO) | Zenodo [10.5281/zenodo.4003042](https://doi.org/10.5281/zenodo.4003042) | SPring-8 BL32XU | 2.52 | C 2 2 21 | 73.5 95.3 101.4 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of thiosulfate transporter YeeE from Spirochaeta thermophila |
| [6O2H](https://www.rcsb.org/structure/6O2H) | SBGrid [10.15785/sbgrid/747](https://doi.org/10.15785/sbgrid/747) | CHESS F1 | 1.21 | P 1 | 27.4 32.1 34.5 88.7 108.5 111.9 | PILATUS3 6M | Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset |
| [6R72](https://www.rcsb.org/structure/6R72) | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | SOLEIL PROXIMA 2 | 3.95 | P 1 21 1 | 117.8 110.8 155.6 90.0 93.2 90.0 | Dectris Eiger 9M | Crystal structure of BmrA-E504A in an outward-facing conformation |
| — | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | | | | | Dectris Eiger 9M | Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation |
| [6RLR](https://www.rcsb.org/structure/6RLR) | Zenodo [10.5281/zenodo.5886687](https://doi.org/10.5281/zenodo.5886687) | Diamond I04 | 2.00 | P 1 | 40.0 40.0 63.6 80.4 76.3 68.2 | Eiger 16M | Crystal structure of CD9 large extracellular loop |
| [6TTN](https://www.rcsb.org/structure/6TTN) | IRRMC [10.18430/m36ttn](https://doi.org/10.18430/m36ttn) | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine |
| [6YQF](https://www.rcsb.org/structure/6YQF) | IRRMC [10.18430/m36yqf](https://doi.org/10.18430/m36yqf) | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly |
| [6ZE4](https://www.rcsb.org/structure/6ZE4) | SBGrid [10.15785/sbgrid/806](https://doi.org/10.15785/sbgrid/806) | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide |
| [7ATG](https://www.rcsb.org/structure/7ATG) | IRRMC [10.18430/m37atg](https://doi.org/10.18430/m37atg) | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution |
| [7K1L](https://www.rcsb.org/structure/7K1L) | IRRMC [10.18430/m37k1l](https://doi.org/10.18430/m37k1l) | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate |
| [7KCN](https://www.rcsb.org/structure/7KCN) | IRRMC [10.18430/m37kcn](https://doi.org/10.18430/m37kcn) | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins |
| [7MZT](https://www.rcsb.org/structure/7MZT) | IRRMC [10.18430/m37mzt](https://doi.org/10.18430/m37mzt) | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A |
| [7ORR](https://www.rcsb.org/structure/7ORR) | IRRMC [10.18430/M37ORR](https://doi.org/10.18430/M37ORR) | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 |
| [7PH1](https://www.rcsb.org/structure/7PH1) | IRRMC [10.18430/M37PH1](https://doi.org/10.18430/M37PH1) | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid |
| [7PQ7](https://www.rcsb.org/structure/7PQ7) | IRRMC [10.18430/M3.IRRMC.6072](https://doi.org/10.18430/M3.IRRMC.6072) | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 |
| [7QIS](https://www.rcsb.org/structure/7QIS) | IRRMC [10.18430/M37QIS](https://doi.org/10.18430/M37QIS) | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX |
| [7RJI](https://www.rcsb.org/structure/7RJI) | IRRMC [10.18430/M37RJI](https://doi.org/10.18430/M37RJI) | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid |
| [7YZX](https://www.rcsb.org/structure/7YZX) | IRRMC [10.18430/M37YZX](https://doi.org/10.18430/M37YZX) | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. |
| [8DYZ](https://www.rcsb.org/structure/8DYZ) | SBGrid [10.15785/sbgrid/957](https://doi.org/10.15785/sbgrid/957) | CHESS F1 | 1.27 | P 43 21 2 | 79.6 79.6 38.3 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset |
| [8DZ7](https://www.rcsb.org/structure/8DZ7) | SBGrid [10.15785/sbgrid/958](https://doi.org/10.15785/sbgrid/958) | CHESS F1 | 1.34 | P 21 21 21 | 30.5 56.4 73.9 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset |
| [8EGN](https://www.rcsb.org/structure/8EGN) | IRRMC [10.18430/M38EGN](https://doi.org/10.18430/M38EGN) | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 |
| [8K1G](https://www.rcsb.org/structure/8K1G) | IRRMC [10.18430/M38K1G](https://doi.org/10.18430/M38K1G) | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae |
| [8QQ7](https://www.rcsb.org/structure/8QQ7) | Zenodo [10.5281/zenodo.14901515](https://doi.org/10.5281/zenodo.14901515) | ESRF MASSIF-1 | 3.62 | P 64 2 2 | 146.0 146.0 153.6 90.0 90.0 120.0 | PILATUS3 2M | Structure of SpNOX: a Bacterial NADPH oxidase |
| [8R5R](https://www.rcsb.org/structure/8R5R) | IRRMC [10.18430/m38r5r](https://doi.org/10.18430/m38r5r) | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor |
| [8SA8](https://www.rcsb.org/structure/8SA8) | IRRMC [10.18430/M38SA8](https://doi.org/10.18430/M38SA8) | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) |
| [8SQQ](https://www.rcsb.org/structure/8SQQ) | IRRMC [10.18430/M38SQQ](https://doi.org/10.18430/M38SQQ) | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) |
| [8SQT](https://www.rcsb.org/structure/8SQT) | IRRMC [10.18430/M38SQT](https://doi.org/10.18430/M38SQT) | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) |
| [8T7R](https://www.rcsb.org/structure/8T7R) | IRRMC [10.18430/M38T7R](https://doi.org/10.18430/M38T7R) | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 |
| [8THA](https://www.rcsb.org/structure/8THA) | IRRMC [10.18430/m38tha](https://doi.org/10.18430/m38tha) | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form |
| [8V4O](https://www.rcsb.org/structure/8V4O) | IRRMC [10.18430/m38v4o](https://doi.org/10.18430/m38v4o) | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans |
| [8XTE](https://www.rcsb.org/structure/8XTE) | SBGrid [10.15785/sbgrid/1101](https://doi.org/10.15785/sbgrid/1101) | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP |
| [8XTF](https://www.rcsb.org/structure/8XTF) | SBGrid [10.15785/sbgrid/1102](https://doi.org/10.15785/sbgrid/1102) | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C |
| [8XTG](https://www.rcsb.org/structure/8XTG) | SBGrid [10.15785/sbgrid/1100](https://doi.org/10.15785/sbgrid/1100) | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA |
| [8YS9](https://www.rcsb.org/structure/8YS9) | IRRMC [10.18430/M38YS9](https://doi.org/10.18430/M38YS9) | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH |
| [9B22](https://www.rcsb.org/structure/9B22) | IRRMC [10.18430/m39b22](https://doi.org/10.18430/m39b22) | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) |
| [9BN8](https://www.rcsb.org/structure/9BN8) | IRRMC [10.18430/m39bn8](https://doi.org/10.18430/m39bn8) | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 |
| [9HS7](https://www.rcsb.org/structure/9HS7) | IRRMC [10.18430/M39HS7](https://doi.org/10.18430/M39HS7) | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER |
| [9JZO](https://www.rcsb.org/structure/9JZO) | IRRMC [10.18430/m39jzo](https://doi.org/10.18430/m39jzo) | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. |
| [9MH4](https://www.rcsb.org/structure/9MH4) | IRRMC [10.18430/M39MH4](https://doi.org/10.18430/M39MH4) | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes |
| [9MIN](https://www.rcsb.org/structure/9MIN) | SBGrid [10.15785/sbgrid/1151](https://doi.org/10.15785/sbgrid/1151) | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 |
| [9O0H](https://www.rcsb.org/structure/9O0H) | IRRMC [10.18430/M39O0H](https://doi.org/10.18430/M39O0H) | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker |
| [9RP9](https://www.rcsb.org/structure/9RP9) | IRRMC [10.18430/M39RP9](https://doi.org/10.18430/M39RP9) | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex |
| [9VX7](https://www.rcsb.org/structure/9VX7) | IRRMC [10.18430/M39VX7](https://doi.org/10.18430/M39VX7) | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor |
| [9VYB](https://www.rcsb.org/structure/9VYB) | IRRMC [10.18430/M39VYB](https://doi.org/10.18430/M39VYB) | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd |
| [9W3Y](https://www.rcsb.org/structure/9W3Y) | IRRMC [10.18430/M39W3Y](https://doi.org/10.18430/M39W3Y) | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) |
| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA |
| [9Z44](https://www.rcsb.org/structure/9Z44) | IRRMC [10.18430/M39Z44](https://doi.org/10.18430/M39Z44) | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain |
| [9ZLO](https://www.rcsb.org/structure/9ZLO) | Zenodo [10.5281/zenodo.18652652](https://doi.org/10.5281/zenodo.18652652) | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE |
| [9ZMU](https://www.rcsb.org/structure/9ZMU) | IRRMC [10.18430/M39ZMU](https://doi.org/10.18430/M39ZMU) | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) |
| — | IRRMC [10.18430/M3.IRRMC.6753](https://doi.org/10.18430/M3.IRRMC.6753) | | | | | PILATUS 6MF | C-phycocyanin as a highly attractive model system in protein crystallography: unique crystallization properties and packing-diversity screening |
| — | Zenodo [10.5281/zenodo.6347466](https://doi.org/10.5281/zenodo.6347466) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source |
| — | Zenodo [10.5281/zenodo.1036416](https://doi.org/10.5281/zenodo.1036416) | Diamond Light Source I19-1 | | | | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 |
| — | Zenodo [10.5281/zenodo.20135265](https://doi.org/10.5281/zenodo.20135265) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
| — | Zenodo [10.5281/zenodo.20041091](https://doi.org/10.5281/zenodo.20041091) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
Six rows have no PDB code. Four are small-molecule / chemical-crystallography datasets, kept
because they exercise short wavelengths, CdTe sensors and fine slicing; one is a protein dataset
whose IRRMC record names no PDB entry; and one is the second collection in the 6R72 Zenodo
record, described below. They have no deposited macromolecular values, so those columns are
blank, and their titles are the repository record titles verbatim.
## Archives that are not a single sweep
Most rows above are a single continuous rotation. Four archives are not; their layout is read
from the image files, the repository file listings and the depositors' own description of the
record.
**6R72 - two collections on one crystal.** The Zenodo record holds two complete 360° sweeps of
3600 × 0.1° frames taken from the same crystal: a helical collection, which produced the
deposited structure, and a low-dose collection from a single position, which was not used for a
deposition and therefore has no PDB entry. Both are in the table, sharing one DOI; the deposited
values belong to the helical collection only. The record also ships the authors' `XDS.INP`.
**The three CHESS depositions - wedges plus a measured background.** Each crystal was rotated in
50° wedges of 500 × 0.1° frames and translated between wedges to spread the dose. Each crystal
also has a rotation at 1° per frame taken with the crystal translated out of the beam, which the
depositors include as a measured background and say can be matched to the diffraction frames by
the `phi` value in the image header.
| PDB | Crystals | Wedges per crystal | Background rotation |
|---|---|---|---|
| 8DYZ | 1 | 8 | 360 frames |
| 8DZ7 | 2 | 4 | 200 frames per crystal |
| 6O2H | 4 | 1, 3, 2, 5 - 11 in all | 50, 145, 95, 235 frames, one per crystal |
## Datasets published as Raw Data Letters
Three of the datasets - 6R72, 8QQ7 and 6RLR - were published as IUCrData Raw Data Letters, a
format whose purpose is to make raw images citable and re-processable in their own right. The
letters describe the collections and the difficulties in them, and are the reference for what the
data are:
- V. Zampieri, A. Vermot, M. Thepaut, I. Petit-Hartlein, F. Fieschi, P. Falson and V. Chaptal,
"X-ray diffraction images for two membrane protein crystals presenting high anisotropy; the
*B. subtilis* ABC transporter BmrA and the *S. pneumoniae* NADPH oxidase" (2025), IUCrData 10,
x250591 [doi:10.1107/S2414314625005917](https://doi.org/10.1107/S2414314625005917) - covers
6R72 and 8QQ7.
- V. Neviani, M. Lutz, W. Oosterheert, P. Gros and L. Kroon-Batenburg, "Crystal structure of the
second extracellular domain of human tetraspanin CD9: twinning and diffuse scattering" (2022),
IUCrData 7, x220852
[doi:10.1107/S2414314622008525](https://doi.org/10.1107/S2414314622008525) - covers 6RLR.
The authors of the second letter also published their own reciprocal-space reconstruction of the
6RLR data as a separate Zenodo record,
[10.5281/zenodo.6961763](https://doi.org/10.5281/zenodo.6961763).
## Obtained but not in the table
One further deposition was downloaded and is not listed above: SBGrid
[10.15785/sbgrid/1295](https://doi.org/10.15785/sbgrid/1295), the room-temperature Bragg and
diffuse-scattering data behind [4WOR](https://www.rcsb.org/structure/4WOR), collected at CHESS A1
in 1995. The images are stored as CCD TIFFs written by the detector software of the time, a
format the reader does not support, so the dataset is not processed here and the detector could
not be read from its images. It is named because the data are public and the deposition deserves
the same credit as the rest.
## Detector: image file vs PDB entry
For 52 datasets both the image file and the PDB entry name a detector that can be read as a
(model, generation, size). **12 of those 52 disagree** - 3 on the model or the size, and 9
only because the PDB entry omits the detector generation. The table above uses the file value
in every case.
| PDB | PDB entry says | Image file says | Difference |
|---|---|---|---|
| 6JGJ | DECTRIS PILATUS3 6M | PILATUS3 300K, S/N 3-0226 | model / size |
| 6YQF | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0119 | generation only |
| 7ATG | DECTRIS PILATUS3 S 6M | PILATUS 6M-F, S/N 60-0117-F | generation only |
| 7PH1 | DECTRIS PILATUS 2M | PILATUS3 2M, S/N 24-0124 | generation only |
| 7QIS | DECTRIS PILATUS 2M | PILATUS3 2M, S/N 24-0124 | generation only |
| 7YZX | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0119 | generation only |
| 8R5R | DECTRIS PILATUS 6M | Dectris EIGER2 CdTe 16M | model / size |
| 8XTE | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0124 | generation only |
| 9O0H | DECTRIS EIGER X 16M | Dectris EIGER2 Si 16M, S/N D021324 | generation only |
| 9VX7 | DECTRIS EIGER X 9M | PILATUS3 6M, S/N 60-0133 | model / size |
| 9YZK | DECTRIS PILATUS 2M | PILATUS3 S_2M, SN 24-0173 | generation only |
| 9Z44 | DECTRIS EIGER X 9M | Dectris EIGER2 Si 9M, S/N E-18-0131 | generation only |
The detector could not be read from the file for 8XTG (header reads `PILATUS XXX, S/N XX-XXX`).
## Deposited models and structure factors
53 of the 59 datasets have a released PDB entry, and RCSB reports released structure factors
(`status_code_sf = REL`) for all of them. A merged result from this pipeline can therefore be checked
against the deposited model or against the deposited intensities.
## Datasets with no PDB entry
| Dataset | Repository record | Why there is no PDB code |
|---|---|---|
| `6r72/ld` | Zenodo record 10.5281/zenodo.14894181, file prefix `V-CK63-8-ld_1_` | a second collection in the 6R72 record - a low-dose sweep on the same crystal, not the one the deposited structure was built from |
| `8agq` | IRRMC project page Phyco_JCSG_a3 | IRRMC's own project record for this archive names no PDB entry |
| `cuhf2` | Zenodo record 10.5281/zenodo.6347466 | a small-molecule dataset, not a PDB deposition |
| `dnba` | Zenodo record 10.5281/zenodo.1036416 | a small-molecule dataset, not a PDB deposition |
| `metformin` | Zenodo record 10.5281/zenodo.20135265 | a small-molecule dataset, not a PDB deposition |
| `nidppe` | Zenodo record 10.5281/zenodo.20041091 | a small-molecule dataset, not a PDB deposition |
## Licences
Each dataset carries the licence of its own deposition, stated on the record page linked
above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's
own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each
record states. None of these data are redistributed with Jungfraujoch; this page only records
where they came from.
Reference in New Issue View Git Blame Copy Permalink