leonarski_f
680c36c20d
Build Packages / Unit tests (push) Successful in 1h22m15s
Build Packages / build:windows:nocuda (push) Successful in 18m0s
Build Packages / build:windows:cuda (push) Successful in 20m30s
Build Packages / build:viewer-tgz:cpu (push) Successful in 10m32s
Build Packages / build:viewer-tgz:cuda (push) Successful in 11m39s
Build Packages / build:rugnux-tgz (x86_64) (push) Successful in 8m55s
Build Packages / build:rugnux:windows (push) Successful in 11m25s
Build Packages / build:rpm (rocky8_nocuda) (push) Successful in 20m6s
Build Packages / build:rpm (rocky9_nocuda) (push) Successful in 16m27s
Build Packages / build:rpm (ubuntu2204_nocuda) (push) Successful in 20m19s
Build Packages / build:rpm (ubuntu2404_nocuda) (push) Successful in 15m34s
Build Packages / build:rpm (rocky8_sls9) (push) Successful in 20m25s
Build Packages / build:rpm (rocky9_sls9) (push) Successful in 19m36s
Build Packages / build:rpm (rocky8) (push) Successful in 17m43s
Build Packages / build:rpm (rocky9) (push) Successful in 13m34s
Build Packages / build:rpm (ubuntu2204) (push) Successful in 21m28s
Build Packages / build:rpm (ubuntu2404) (push) Successful in 18m19s
Build Packages / DIALS test (push) Successful in 12m36s
Build Packages / XDS test (durin plugin) (push) Successful in 6m56s
Build Packages / XDS test (JFJoch plugin) (push) Successful in 6m48s
Build Packages / XDS test (neggia plugin) (push) Successful in 6m7s
Build Packages / Generate python client (push) Successful in 11s
Build Packages / Build documentation (push) Successful in 36s
Build Packages / Create release (push) Skipped
Build Packages / build:rugnux:aarch64 (cross) (push) Successful in 5m11s
* `rugnux --mode calibration` writes `<prefix>.json` beside the `.poni`, whose `dataset_settings` member is a `jfjoch_broker` `dataset_settings` body as it stands. * `rugnux` and `jfjoch_viewer` read PILATUS miniCBF sweeps natively, without conversion. * Masters written by other facilities open, including Eiger 1.x and third-party NXmx variants. * `rugnux` measures the beam centre on every run, and indexes with it when the file's value indexes nothing. * A detector swung out on a 2theta arm is placed where the file says it stands, and the calibration can hold the tilt fixed. * `rugnux` writes the unmerged MTZ by default, and a P1 merge beside it, so a wrong space group can be re-merged without reprocessing. * Significant improvements to symmetry handling in `rugnux`: the lattice, the point group, the setting and the systematic absences. * The `rugnux` report gives the resolution the CC1/2 fit reached, beside the range the reflections were written to. * The `rugnux` report gives the twinning statistics measured before the space group was decided, beside the ones measured after. * The `rugnux` report gives the strong-direction diffraction limit, and warns when CC1/2 is not monotone with resolution. * `rugnux` ranks screw axes on the evidence their absences carry, rather than on how many control reflections a candidate happens to have. * Twinning is no longer reported when the L-test contradicts it. * The `rugnux` report gives the detector tilt, the measured tilt and the direct beam beside the beam centre, and a post-refined beam centre is judged against the run's own measurement rather than the file's. * `--no-refine-tilt` holds the detector tilt at the value in the file, instead of zeroing it, when the calibration starts from the spots. * The `jfjoch_viewer` grid scan view draws the cells in the proportion of the scan steps, so the map has the shape of the scanned area. Reviewed-on: #76 Co-authored-by: Filip Leonarski <filip.leonarski@psi.ch>
260 lines
33 KiB
Markdown
260 lines
33 KiB
Markdown
# External test data
|
||
|
||
Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only
|
||
ever sees its own detectors is not tested. The datasets below were collected by other people,
|
||
on detectors and in file formats we do not produce ourselves, and are used here to check that
|
||
`rugnux` reads foreign files correctly and reduces them to sensible results. Most were collected
|
||
at other facilities; a few come from SLS beamlines, where the data are still written by someone
|
||
else's detector and someone else's acquisition system. Their authors published all of these for
|
||
exactly this kind of reuse, and this page is where we credit them.
|
||
|
||
**None of these data were collected by us.** If you use any of them, cite the dataset DOI in
|
||
the table below; the repositories themselves are cited in
|
||
[ACKNOWLEDGEMENT](ACKNOWLEDGEMENT.md).
|
||
|
||
## Where the values come from
|
||
|
||
- **Source** is the repository we downloaded from and that repository's own citable DOI for
|
||
the archive we took. Every DOI on this page was resolved against DataCite before it was
|
||
written down, and the identity of each dataset was taken from the repository's record for
|
||
the archive - not from our directory names.
|
||
- **Beamline, resolution, space group and cell are the values deposited with the PDB entry**,
|
||
read from the RCSB data API. They describe the published experiment. They are *not* our
|
||
reprocessing results; no quantity measured by Jungfraujoch appears on this page.
|
||
- **Detector is read out of the image files themselves** - the NXmx
|
||
`/entry/instrument/detector/description` or the miniCBF `# Detector:` header - because the
|
||
detector named in a PDB entry is often only approximate. Where the two differ, the
|
||
difference is listed below the table.
|
||
- Anything that could not be established from one of those sources is left blank.
|
||
|
||
## Datasets
|
||
|
||
| PDB | Source | Facility / beamline | d<sub>min</sub> (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title |
|
||
|---|---|---|---|---|---|---|---|
|
||
| [11IF](https://www.rcsb.org/structure/11IF) | IRRMC [10.18430/M311IF](https://doi.org/10.18430/M311IF) | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 |
|
||
| [36GK](https://www.rcsb.org/structure/36GK) | IRRMC [10.18430/M336GK](https://doi.org/10.18430/M336GK) | CLSI 08ID-1 | 2.28 | I 2 2 2 | 120.6 189.5 199.7 90.0 90.0 90.0 | Dectris Eiger 9M | D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain |
|
||
| [5F6M](https://www.rcsb.org/structure/5F6M) | SBGrid [10.15785/sbgrid/201](https://doi.org/10.15785/sbgrid/201) | SSRL BL11-1 | 1.10 | P 21 21 21 | 54.8 58.5 67.4 90.0 90.0 90.0 | PILATUS 6M | Isotropic Trypsin Model for Comparison of Diffuse Scattering |
|
||
| [5REO](https://www.rcsb.org/structure/5REO) | Zenodo [10.5281/zenodo.3730956](https://doi.org/10.5281/zenodo.3730956) | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 |
|
||
| [5SRC](https://www.rcsb.org/structure/5SRC) | IRRMC [10.18430/M35SRC](https://doi.org/10.18430/M35SRC) | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers |
|
||
| [6HV2](https://www.rcsb.org/structure/6HV2) | IRRMC [10.18430/m36hv2](https://doi.org/10.18430/m36hv2) | SLS X06SA | 1.71 | P 61 2 2 | 68.9 68.9 133.6 90.0 90.0 120.0 | Dectris Eiger 16M | MMP-13 in complex with the peptide IMISF |
|
||
| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A |
|
||
| [6LEO](https://www.rcsb.org/structure/6LEO) | Zenodo [10.5281/zenodo.4003042](https://doi.org/10.5281/zenodo.4003042) | SPring-8 BL32XU | 2.52 | C 2 2 21 | 73.5 95.3 101.4 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of thiosulfate transporter YeeE from Spirochaeta thermophila |
|
||
| [6O2H](https://www.rcsb.org/structure/6O2H) | SBGrid [10.15785/sbgrid/747](https://doi.org/10.15785/sbgrid/747) | CHESS F1 | 1.21 | P 1 | 27.4 32.1 34.5 88.7 108.5 111.9 | PILATUS3 6M | Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset |
|
||
| [6R72](https://www.rcsb.org/structure/6R72) | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | SOLEIL PROXIMA 2 | 3.95 | P 1 21 1 | 117.8 110.8 155.6 90.0 93.2 90.0 | Dectris Eiger 9M | Crystal structure of BmrA-E504A in an outward-facing conformation |
|
||
| [6RLR](https://www.rcsb.org/structure/6RLR) | Zenodo [10.5281/zenodo.5886687](https://doi.org/10.5281/zenodo.5886687) | Diamond I04 | 2.00 | P 1 | 40.0 40.0 63.6 80.4 76.3 68.2 | Eiger 16M | Crystal structure of CD9 large extracellular loop |
|
||
| [6TTN](https://www.rcsb.org/structure/6TTN) | IRRMC [10.18430/m36ttn](https://doi.org/10.18430/m36ttn) | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine |
|
||
| [6UKF](https://www.rcsb.org/structure/6UKF) | IRRMC [10.18430/m36ukf](https://doi.org/10.18430/m36ukf) | APS 22-ID | 1.00 | P 1 21 1 | 61.0 37.3 69.0 90.0 109.8 90.0 | Dectris Eiger 16M | HhaI endonuclease in Complex with DNA at 1 Angstrom Resolution |
|
||
| [6YQF](https://www.rcsb.org/structure/6YQF) | IRRMC [10.18430/m36yqf](https://doi.org/10.18430/m36yqf) | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly |
|
||
| [6ZE4](https://www.rcsb.org/structure/6ZE4) | SBGrid [10.15785/sbgrid/806](https://doi.org/10.15785/sbgrid/806) | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide |
|
||
| [7ATG](https://www.rcsb.org/structure/7ATG) | IRRMC [10.18430/m37atg](https://doi.org/10.18430/m37atg) | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution |
|
||
| [7D1M](https://www.rcsb.org/structure/7D1M) | IRRMC [10.18430/m37brr](https://doi.org/10.18430/m37brr) | SSRF BL17U1 | 1.35 | P 1 21 1 | 55.5 99.0 59.6 90.0 108.5 90.0 | Dectris Eiger 16M | CRYSTAL STRUCTURE OF THE SARS-CoV-2 MAIN PROTEASE COMPLEXED WITH GC376 |
|
||
| [7DKP](https://www.rcsb.org/structure/7DKP) | IRRMC [10.18430/M37DKP](https://doi.org/10.18430/M37DKP) | ESRF MASSIF-3 | 1.45 | P 1 21 1 | 49.8 169.5 49.8 90.0 93.5 90.0 | Dectris Eiger 4M | Crystal structure of E. coli Grx2 in complex with GSH at 1.45 A resolution |
|
||
| [7K1L](https://www.rcsb.org/structure/7K1L) | IRRMC [10.18430/m37k1l](https://doi.org/10.18430/m37k1l) | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate |
|
||
| [7KCN](https://www.rcsb.org/structure/7KCN) | IRRMC [10.18430/m37kcn](https://doi.org/10.18430/m37kcn) | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins |
|
||
| [7MZT](https://www.rcsb.org/structure/7MZT) | IRRMC [10.18430/m37mzt](https://doi.org/10.18430/m37mzt) | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A |
|
||
| [7ORR](https://www.rcsb.org/structure/7ORR) | IRRMC [10.18430/M37ORR](https://doi.org/10.18430/M37ORR) | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 |
|
||
| [7PH1](https://www.rcsb.org/structure/7PH1) | IRRMC [10.18430/M37PH1](https://doi.org/10.18430/M37PH1) | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid |
|
||
| [7PQ7](https://www.rcsb.org/structure/7PQ7) | IRRMC [10.18430/M3.IRRMC.6072](https://doi.org/10.18430/M3.IRRMC.6072) | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 |
|
||
| [7QIJ](https://www.rcsb.org/structure/7QIJ) | SBGrid [10.15785/sbgrid/907](https://doi.org/10.15785/sbgrid/907) | PETRA III, EMBL c/o DESY P13 (MX1) | 4.10 | P 21 21 21 | 143.5 324.9 369.4 90.0 90.0 90.0 | PILATUS 6M-F | Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY |
|
||
| [7QIS](https://www.rcsb.org/structure/7QIS) | IRRMC [10.18430/M37QIS](https://doi.org/10.18430/M37QIS) | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX |
|
||
| [7RIS](https://www.rcsb.org/structure/7RIS) | IRRMC [10.18430/M37RIS](https://doi.org/10.18430/M37RIS) | APS 21-ID-D | 1.72 | P 32 2 1 | 44.5 44.5 189.9 90.0 90.0 120.0 | Dectris Eiger 9M | Crystal structure of RPA3624, a beta-propeller lactonase from Rhodopseudomonas palustris, with active-site bound phosphate |
|
||
| [7RJI](https://www.rcsb.org/structure/7RJI) | IRRMC [10.18430/M37RJI](https://doi.org/10.18430/M37RJI) | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid |
|
||
| [7TCD](https://www.rcsb.org/structure/7TCD) | IRRMC [10.18430/m37tcd](https://doi.org/10.18430/m37tcd) | SLS X06SA | 1.70 | C 1 2 1 | 138.5 47.9 78.1 90.0 107.6 90.0 | Dectris Eiger 16M | LOV2-DARPIN fusion: D13 |
|
||
| [7YZX](https://www.rcsb.org/structure/7YZX) | IRRMC [10.18430/M37YZX](https://doi.org/10.18430/M37YZX) | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. |
|
||
| [8A1A](https://www.rcsb.org/structure/8A1A) | IRRMC [10.18430/M38A1A](https://doi.org/10.18430/M38A1A) | SLS X06SA | 2.05 | P 65 | 191.9 191.9 122.4 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct |
|
||
| [8AGQ](https://www.rcsb.org/structure/8AGQ) | IRRMC [10.18430/M38AGQ](https://doi.org/10.18430/M38AGQ) | SLS X06DA | 1.09 | C 1 2 1 | 89.9 55.4 54.8 90.0 113.5 90.0 | PILATUS 2MF | Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione |
|
||
| [8DYZ](https://www.rcsb.org/structure/8DYZ) | SBGrid [10.15785/sbgrid/957](https://doi.org/10.15785/sbgrid/957) | CHESS F1 | 1.27 | P 43 21 2 | 79.6 79.6 38.3 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset |
|
||
| [8DZ7](https://www.rcsb.org/structure/8DZ7) | SBGrid [10.15785/sbgrid/958](https://doi.org/10.15785/sbgrid/958) | CHESS F1 | 1.34 | P 21 21 21 | 30.5 56.4 73.9 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset |
|
||
| [8EGN](https://www.rcsb.org/structure/8EGN) | IRRMC [10.18430/M38EGN](https://doi.org/10.18430/M38EGN) | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 |
|
||
| [8IYA](https://www.rcsb.org/structure/8IYA) | IRRMC [10.18430/m38iya](https://doi.org/10.18430/m38iya) | SSRF BL02U1 | 2.43 | C 1 2 1 | 102.7 50.1 109.2 90.0 91.8 90.0 | Dectris EIGER2 Si 9M | Complex of SETDB1-derived peptide bound to UBE2E1 |
|
||
| [8K1G](https://www.rcsb.org/structure/8K1G) | IRRMC [10.18430/M38K1G](https://doi.org/10.18430/M38K1G) | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae |
|
||
| [8OIC](https://www.rcsb.org/structure/8OIC) | IRRMC [10.18430/m38oic](https://doi.org/10.18430/m38oic) | Diamond I04 | 2.80 | P 1 | 73.1 94.7 120.6 105.1 90.0 93.8 | Eiger 16M | Trichomonas vaginalis riboside hydrolase (His-tagged) |
|
||
| [8PQD](https://www.rcsb.org/structure/8PQD) | IRRMC [10.18430/m38pqd](https://doi.org/10.18430/m38pqd) | ESRF MASSIF-3 | 1.50 | P 21 21 21 | 59.4 59.4 192.9 90.0 90.0 90.0 | Dectris Eiger 4M | c-KIT kinase domain in complex with avapritinib derivative 10 |
|
||
| [8QQ7](https://www.rcsb.org/structure/8QQ7) | Zenodo [10.5281/zenodo.14901515](https://doi.org/10.5281/zenodo.14901515) | ESRF MASSIF-1 | 3.62 | P 64 2 2 | 146.0 146.0 153.6 90.0 90.0 120.0 | PILATUS3 2M | Structure of SpNOX: a Bacterial NADPH oxidase |
|
||
| [8R5R](https://www.rcsb.org/structure/8R5R) | IRRMC [10.18430/m38r5r](https://doi.org/10.18430/m38r5r) | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor |
|
||
| [8SA8](https://www.rcsb.org/structure/8SA8) | IRRMC [10.18430/M38SA8](https://doi.org/10.18430/M38SA8) | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) |
|
||
| [8SQQ](https://www.rcsb.org/structure/8SQQ) | IRRMC [10.18430/M38SQQ](https://doi.org/10.18430/M38SQQ) | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) |
|
||
| [8SQT](https://www.rcsb.org/structure/8SQT) | IRRMC [10.18430/M38SQT](https://doi.org/10.18430/M38SQT) | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) |
|
||
| [8T7R](https://www.rcsb.org/structure/8T7R) | IRRMC [10.18430/M38T7R](https://doi.org/10.18430/M38T7R) | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 |
|
||
| [8THA](https://www.rcsb.org/structure/8THA) | IRRMC [10.18430/m38tha](https://doi.org/10.18430/m38tha) | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form |
|
||
| [8U0I](https://www.rcsb.org/structure/8U0I) | IRRMC [10.18430/m38u0i](https://doi.org/10.18430/m38u0i) | ALS 8.2.1 | 1.54 | P 43 21 2 | 50.3 50.3 90.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of PA0012 complexed with cyclic-di-GMP from Pseudomonas aeruginosa |
|
||
| [8V4O](https://www.rcsb.org/structure/8V4O) | IRRMC [10.18430/m38v4o](https://doi.org/10.18430/m38v4o) | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans |
|
||
| [8XBP](https://www.rcsb.org/structure/8XBP) | IRRMC [10.18430/M38XBP](https://doi.org/10.18430/M38XBP) | SOLEIL PROXIMA 1 | 1.99 | C 1 2 1 | 148.3 50.8 60.2 90.0 92.3 90.0 | Dectris Eiger 16M | Crystal structure of AtNATA1 bound to Acetyl CoA |
|
||
| [8XTE](https://www.rcsb.org/structure/8XTE) | SBGrid [10.15785/sbgrid/1101](https://doi.org/10.15785/sbgrid/1101) | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP |
|
||
| [8XTF](https://www.rcsb.org/structure/8XTF) | SBGrid [10.15785/sbgrid/1102](https://doi.org/10.15785/sbgrid/1102) | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C |
|
||
| [8XTG](https://www.rcsb.org/structure/8XTG) | SBGrid [10.15785/sbgrid/1100](https://doi.org/10.15785/sbgrid/1100) | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA |
|
||
| [8YS9](https://www.rcsb.org/structure/8YS9) | IRRMC [10.18430/M38YS9](https://doi.org/10.18430/M38YS9) | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH |
|
||
| [9B22](https://www.rcsb.org/structure/9B22) | IRRMC [10.18430/m39b22](https://doi.org/10.18430/m39b22) | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) |
|
||
| [9BN8](https://www.rcsb.org/structure/9BN8) | IRRMC [10.18430/m39bn8](https://doi.org/10.18430/m39bn8) | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 |
|
||
| [9CRW](https://www.rcsb.org/structure/9CRW) | IRRMC [10.18430/m39crw](https://doi.org/10.18430/m39crw) | CLSI 08ID-1 | 2.49 | P 1 21 1 | 84.0 104.6 118.8 90.0 93.4 90.0 | Dectris Eiger 9M | Crystal structure of the Candida albicans kinesin-8 proximal tail domain |
|
||
| [9GJX](https://www.rcsb.org/structure/9GJX) | IRRMC [10.18430/M39GJX](https://doi.org/10.18430/M39GJX) | Diamond I04 | 2.40 | P 1 21 1 | 76.8 115.8 103.8 90.0 110.3 90.0 | Eiger 16M | Bacillus licheniformis nitroreductase |
|
||
| [9HS7](https://www.rcsb.org/structure/9HS7) | IRRMC [10.18430/M39HS7](https://doi.org/10.18430/M39HS7) | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER |
|
||
| [9I0A](https://www.rcsb.org/structure/9I0A) | IRRMC [10.18430/M39I0A](https://doi.org/10.18430/M39I0A) | SOLEIL PROXIMA 1 | 2.22 | P 21 21 2 | 75.2 98.7 208.6 90.0 90.0 90.0 | Dectris Eiger 16M | CARM1 in complex with arg-aDMA analog |
|
||
| [9IG7](https://www.rcsb.org/structure/9IG7) | IRRMC [10.18430/M39IG7](https://doi.org/10.18430/M39IG7) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.60 | P 21 21 2 | 111.5 153.5 69.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides |
|
||
| [9IH9](https://www.rcsb.org/structure/9IH9) | IRRMC [10.18430/M39IH9](https://doi.org/10.18430/M39IH9) | ESRF MASSIF-3 | 1.70 | C 1 2 1 | 78.8 133.9 82.3 90.0 101.4 90.0 | Dectris EIGER1 Si 4M | KEAP1 complexed to linear peptide 6 |
|
||
| [9JZO](https://www.rcsb.org/structure/9JZO) | IRRMC [10.18430/m39jzo](https://doi.org/10.18430/m39jzo) | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. |
|
||
| [9MH4](https://www.rcsb.org/structure/9MH4) | IRRMC [10.18430/M39MH4](https://doi.org/10.18430/M39MH4) | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes |
|
||
| [9MIN](https://www.rcsb.org/structure/9MIN) | SBGrid [10.15785/sbgrid/1151](https://doi.org/10.15785/sbgrid/1151) | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 |
|
||
| [9O0H](https://www.rcsb.org/structure/9O0H) | IRRMC [10.18430/M39O0H](https://doi.org/10.18430/M39O0H) | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker |
|
||
| [9P7Q](https://www.rcsb.org/structure/9P7Q) | IRRMC [10.18430/M39P7Q](https://doi.org/10.18430/M39P7Q) | SSRL BL12-1 | 2.21 | C 1 2 1 | 97.0 45.0 72.1 90.0 105.1 90.0 | Dectris EIGER2 Si 16M | 273K human S-adenosylmethionine decarboxylase |
|
||
| [9PBB](https://www.rcsb.org/structure/9PBB) | IRRMC [10.18430/M39PBB](https://doi.org/10.18430/M39PBB) | SSRL BL12-1 | 2.17 | C 1 2 1 | 97.4 45.9 72.2 90.0 105.0 90.0 | Dectris EIGER2 Si 16M | 293K human S-adenosylmethionine decarboxylase |
|
||
| [9RP9](https://www.rcsb.org/structure/9RP9) | IRRMC [10.18430/M39RP9](https://doi.org/10.18430/M39RP9) | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex |
|
||
| [9SL0](https://www.rcsb.org/structure/9SL0) | IRRMC [10.18430/M39SL0](https://doi.org/10.18430/M39SL0) | ESRF MASSIF-1 | 1.60 | P 21 21 21 | 60.2 80.2 111.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of HLA-A0201 in complex with peptide LLWNGPMAV |
|
||
| [9VX7](https://www.rcsb.org/structure/9VX7) | IRRMC [10.18430/M39VX7](https://doi.org/10.18430/M39VX7) | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor |
|
||
| [9VYB](https://www.rcsb.org/structure/9VYB) | IRRMC [10.18430/M39VYB](https://doi.org/10.18430/M39VYB) | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd |
|
||
| [9W3Y](https://www.rcsb.org/structure/9W3Y) | IRRMC [10.18430/M39W3Y](https://doi.org/10.18430/M39W3Y) | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) |
|
||
| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA |
|
||
| [9Z44](https://www.rcsb.org/structure/9Z44) | IRRMC [10.18430/M39Z44](https://doi.org/10.18430/M39Z44) | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain |
|
||
| [9ZLO](https://www.rcsb.org/structure/9ZLO) | Zenodo [10.5281/zenodo.18652652](https://doi.org/10.5281/zenodo.18652652) | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE |
|
||
| [9ZM0](https://www.rcsb.org/structure/9ZM0) | IRRMC [10.18430/M39ZM0](https://doi.org/10.18430/M39ZM0) | NSLS-II 17-ID-1 | 2.10 | P 1 21 1 | 50.4 30.1 91.2 90.0 97.1 90.0 | Dectris EIGER1 Si 9M | Crystal structure of monomeric Atg23 |
|
||
| [9ZMU](https://www.rcsb.org/structure/9ZMU) | IRRMC [10.18430/M39ZMU](https://doi.org/10.18430/M39ZMU) | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) |
|
||
| — | Zenodo [10.5281/zenodo.1036416](https://doi.org/10.5281/zenodo.1036416) | Diamond Light Source I19-1 | | | | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 |
|
||
| — | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | | | | | Dectris Eiger 9M | Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation |
|
||
| — | Zenodo [10.5281/zenodo.20041091](https://doi.org/10.5281/zenodo.20041091) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
|
||
| — | Zenodo [10.5281/zenodo.20135265](https://doi.org/10.5281/zenodo.20135265) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
|
||
| — | Zenodo [10.5281/zenodo.6347466](https://doi.org/10.5281/zenodo.6347466) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source |
|
||
|
||
Five rows have no PDB code. Four are small-molecule / chemical-crystallography datasets, kept
|
||
because they exercise short wavelengths, CdTe sensors and fine slicing; the fifth is the second
|
||
collection in the 6R72 Zenodo record, described below. They have no deposited macromolecular
|
||
values, so those columns are blank, and their titles are the repository record titles verbatim.
|
||
|
||
## Archives that are not a single sweep
|
||
|
||
Most rows above are a single continuous rotation. Eleven archives are not; their layout is read
|
||
from the image files themselves, from the repository file listings and from the depositors' own
|
||
description of the record. Where an archive held more than one collection, only one is kept -
|
||
the repository's project page is not a reliable guide to this, because it describes the project
|
||
rather than the tarball (7TCD's page lists a 900-frame miniCBF sweep the archive does not
|
||
contain).
|
||
|
||
**6R72 - two collections on one crystal.** The Zenodo record holds two complete 360° sweeps of
|
||
3600 × 0.1° frames taken from the same crystal: a helical collection, which produced the
|
||
deposited structure, and a low-dose collection from a single position, which was not used for a
|
||
deposition and therefore has no PDB entry. Both are in the table, sharing one DOI; the deposited
|
||
values belong to the helical collection only. The record also ships the authors' `XDS.INP`.
|
||
|
||
**The three CHESS depositions - wedges plus a measured background.** Each crystal was rotated in
|
||
50° wedges of 500 × 0.1° frames and translated between wedges to spread the dose. Each crystal
|
||
also has a rotation at 1° per frame taken with the crystal translated out of the beam, which the
|
||
depositors include as a measured background and say can be matched to the diffraction frames by
|
||
the `phi` value in the image header.
|
||
|
||
| PDB | Crystals | Wedges per crystal | Background rotation |
|
||
|---|---|---|---|
|
||
| 8DYZ | 1 | 8 | 360 frames |
|
||
| 8DZ7 | 2 | 4 | 200 frames per crystal |
|
||
| 6O2H | 4 | 1, 3, 2, 5 - 11 in all | 50, 145, 95, 235 frames, one per crystal |
|
||
|
||
**Seven IRRMC archives hold more than one collection.** In six of them one sweep is kept and
|
||
the rest were deleted, so a run over the data directory sees a single collection per dataset.
|
||
7RIS is the exception: its two sweeps are at different wavelengths and both are kept.
|
||
|
||
| PDB | What the archive holds | Kept |
|
||
|---|---|---|
|
||
| 6UKF | two sweeps on one crystal - 960 x 0.25° (240°) and 1440 x 0.25° (360°) | the 360° sweep |
|
||
| 7DKP | two complete 360° sweeps on one crystal, 3° apart in ω | the first |
|
||
| 9PBB | two overlapping 135° wedges of one crystal, 90 x 1.5° each | the first |
|
||
| 8U0I | a 69-frame screening wedge and three 180° sweeps on three crystals | the first 180° sweep |
|
||
| 36GK | two 360° sweeps of 1800 x 0.2° at the same geometry | the one the archive and DOI are named for |
|
||
| 9CRW | a dose pair on one crystal 37 min apart - 0.025 s at 289 mm, 0.010 s at 276 mm | the 0.025 s sweep, whose 2.5 Å target matches the deposited 2.49 Å |
|
||
| 7RIS | two crystals at two wavelengths - 1.53494 Å (Ho derivative) and 1.03329 Å (the deposited native) | **both** |
|
||
|
||
## Datasets published as Raw Data Letters
|
||
|
||
Three of the datasets - 6R72, 8QQ7 and 6RLR - were published as IUCrData Raw Data Letters, a
|
||
format whose purpose is to make raw images citable and re-processable in their own right. The
|
||
letters describe the collections and the difficulties in them, and are the reference for what the
|
||
data are:
|
||
|
||
- V. Zampieri, A. Vermot, M. Thepaut, I. Petit-Hartlein, F. Fieschi, P. Falson and V. Chaptal,
|
||
"X-ray diffraction images for two membrane protein crystals presenting high anisotropy; the
|
||
*B. subtilis* ABC transporter BmrA and the *S. pneumoniae* NADPH oxidase" (2025), IUCrData 10,
|
||
x250591 [doi:10.1107/S2414314625005917](https://doi.org/10.1107/S2414314625005917) - covers
|
||
6R72 and 8QQ7.
|
||
- V. Neviani, M. Lutz, W. Oosterheert, P. Gros and L. Kroon-Batenburg, "Crystal structure of the
|
||
second extracellular domain of human tetraspanin CD9: twinning and diffuse scattering" (2022),
|
||
IUCrData 7, x220852
|
||
[doi:10.1107/S2414314622008525](https://doi.org/10.1107/S2414314622008525) - covers 6RLR.
|
||
|
||
The authors of the second letter also published their own reciprocal-space reconstruction of the
|
||
6RLR data as a separate Zenodo record,
|
||
[10.5281/zenodo.6961763](https://doi.org/10.5281/zenodo.6961763).
|
||
|
||
## Detector: image file vs PDB entry
|
||
|
||
For 76 of the 77 PDB-coded rows both the image file and the PDB entry name a detector. (For
|
||
8XTG neither can be compared - the header reads `PILATUS XXX, S/N XX-XXX`.) The table above uses
|
||
the file value in every case, because the entry's label is often approximate.
|
||
|
||
**Seven of the 76 genuinely conflict** - the two sources name detectors that cannot both be
|
||
right:
|
||
|
||
| PDB | PDB entry says | Image file says | Conflict |
|
||
|---|---|---|---|
|
||
| 6JGJ | DECTRIS PILATUS3 6M | PILATUS3 300K, S/N 3-0226 | model / size |
|
||
| 8R5R | DECTRIS PILATUS 6M | Dectris EIGER2 CdTe 16M | model / size |
|
||
| 9SL0 | DECTRIS PILATUS4 X 4M | Dectris EIGER2 Si 9M | model / size |
|
||
| 9VX7 | DECTRIS EIGER X 9M | PILATUS3 6M, S/N 60-0133 | model / size |
|
||
| 7ATG | DECTRIS PILATUS3 S 6M | PILATUS 6M-F, S/N 60-0117-F | generation |
|
||
| 9O0H | DECTRIS EIGER X 16M | Dectris EIGER2 Si 16M, S/N D021324 | generation |
|
||
| 9Z44 | DECTRIS EIGER X 9M | Dectris EIGER2 Si 9M, S/N E-18-0131 | generation |
|
||
|
||
For 9SL0 the file is decisive and the entry is wrong: 3108 x 3262 pixels of 75 um on 450 um
|
||
silicon, written by EIGER2 firmware `release-2022.1.2`, is an EIGER2 9M and not a PILATUS4 4M.
|
||
|
||
A further **29 differ only in how much they state**, which is not a conflict. In 23 the NXmx
|
||
`description` gives the model and size but no generation (`Dectris Eiger 16M`) where the entry
|
||
names one (`DECTRIS EIGER X 16M`); in 6 it is the other way round, the miniCBF header naming a
|
||
generation (`PILATUS3 6M`) that the entry leaves off (`DECTRIS PILATUS 6M`) - 6YQF, 7PH1, 7QIS,
|
||
7YZX, 8XTE and 9YZK.
|
||
|
||
## Deposited models and structure factors
|
||
|
||
77 of the 82 datasets have a released PDB entry, and RCSB reports released structure factors
|
||
(`status_code_sf = REL`) for every one of them. A merged result from this pipeline can therefore be checked
|
||
against the deposited model or against the deposited intensities.
|
||
|
||
## Dataset directories whose name is not the PDB code
|
||
|
||
| Directory | PDB code in the table | Why |
|
||
|---|---|---|
|
||
| `7brr` | 7D1M | The IRRMC archive and its DOI are published under 7BRR, which the PDB obsoleted on 2020-10-28 and replaced with 7D1M. The directory and the DOI keep the archive's own name; the deposited values are 7D1M's. |
|
||
|
||
## An archive that ships placeholder images
|
||
|
||
8AGQ's `data/` directory contains 30 files named `ForBackgroundOnly_000NN.img` alongside the
|
||
1800-frame sweep. They are not images: each is a 64-byte text file holding a path string. A
|
||
reader that globs `*.img` will pick them up, so they are named here rather than silently left.
|
||
|
||
## Datasets with no PDB entry
|
||
|
||
| Dataset | Repository record | Why there is no PDB code |
|
||
|---|---|---|
|
||
| `6r72/ld` | Zenodo record 10.5281/zenodo.14894181, file prefix `V-CK63-8-ld_1_` | a second collection in the 6R72 record - a low-dose sweep on the same crystal, not the one the deposited structure was built from |
|
||
| `cuhf2` | Zenodo record 10.5281/zenodo.6347466 | a small-molecule dataset, not a PDB deposition |
|
||
| `dnba` | Zenodo record 10.5281/zenodo.1036416 | a small-molecule dataset, not a PDB deposition |
|
||
| `metformin` | Zenodo record 10.5281/zenodo.20135265 | a small-molecule dataset, not a PDB deposition |
|
||
| `nidppe` | Zenodo record 10.5281/zenodo.20041091 | a small-molecule dataset, not a PDB deposition |
|
||
|
||
Three of the four small-molecule sets have a published structure to check a run against. These are
|
||
reference values from the literature, not results obtained here.
|
||
|
||
| Dataset | Space group | Cell (A, deg) | T | Reference |
|
||
|---|---|---|---|---|
|
||
| `dnba` | `C 1 2/c 1` (15) | 20.2635 8.7575 9.6697 / 90 109.941 90 | 30 K | the Zenodo record's own title and the `xia2.html` the depositors ship inside it, corroborated by COD 4510614/4510615 - Cryst. Growth Des. **13** (2013) 1861-1871 [doi:10.1021/cg300906j](https://doi.org/10.1021/cg300906j) |
|
||
| `metformin` | `P 1 21/c 1` (14) | 7.9104 13.8794 7.9310 / 90 114.606 90 | 100 K | the hydrochloride, form I; COD 2108029 - Acta Cryst. B**73** (2017) 10-22 [doi:10.1107/S2052520616017844](https://doi.org/10.1107/S2052520616017844) |
|
||
| `nidppe` | `P 1 21/c 1` (14) | 11.2779 13.3386 15.8739 / 90 98.7953 90 | 150 K | COD 2012031 - Acta Cryst. C**57** (2001) 690-693 [doi:10.1107/S0108270101003961](https://doi.org/10.1107/S0108270101003961) |
|
||
|
||
`cuhf2` has no confirmed cell. Its space group is published as `P 4/n m m` (Phys. Rev. B **81**,
|
||
064422 (2010) [doi:10.1103/PhysRevB.81.064422](https://doi.org/10.1103/PhysRevB.81.064422)) but no
|
||
numeric cell was located, so a run on it can be scored on the space group and not on the cell.
|
||
|
||
## Licences
|
||
|
||
Each dataset carries the licence of its own deposition, stated on the record page linked
|
||
above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's
|
||
own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each
|
||
record states. None of these data are redistributed with Jungfraujoch; this page only records
|
||
where they came from.
|