Files
Jungfraujoch/docs/EXTERNAL_TEST_DATA.md
T
leonarski_f 680c36c20d
Build Packages / Unit tests (push) Successful in 1h22m15s
Build Packages / build:windows:nocuda (push) Successful in 18m0s
Build Packages / build:windows:cuda (push) Successful in 20m30s
Build Packages / build:viewer-tgz:cpu (push) Successful in 10m32s
Build Packages / build:viewer-tgz:cuda (push) Successful in 11m39s
Build Packages / build:rugnux-tgz (x86_64) (push) Successful in 8m55s
Build Packages / build:rugnux:windows (push) Successful in 11m25s
Build Packages / build:rpm (rocky8_nocuda) (push) Successful in 20m6s
Build Packages / build:rpm (rocky9_nocuda) (push) Successful in 16m27s
Build Packages / build:rpm (ubuntu2204_nocuda) (push) Successful in 20m19s
Build Packages / build:rpm (ubuntu2404_nocuda) (push) Successful in 15m34s
Build Packages / build:rpm (rocky8_sls9) (push) Successful in 20m25s
Build Packages / build:rpm (rocky9_sls9) (push) Successful in 19m36s
Build Packages / build:rpm (rocky8) (push) Successful in 17m43s
Build Packages / build:rpm (rocky9) (push) Successful in 13m34s
Build Packages / build:rpm (ubuntu2204) (push) Successful in 21m28s
Build Packages / build:rpm (ubuntu2404) (push) Successful in 18m19s
Build Packages / DIALS test (push) Successful in 12m36s
Build Packages / XDS test (durin plugin) (push) Successful in 6m56s
Build Packages / XDS test (JFJoch plugin) (push) Successful in 6m48s
Build Packages / XDS test (neggia plugin) (push) Successful in 6m7s
Build Packages / Generate python client (push) Successful in 11s
Build Packages / Build documentation (push) Successful in 36s
Build Packages / Create release (push) Skipped
Build Packages / build:rugnux:aarch64 (cross) (push) Successful in 5m11s
v1.0.0-rc.166 (#76)
* `rugnux --mode calibration` writes `<prefix>.json` beside the `.poni`, whose `dataset_settings` member is a `jfjoch_broker` `dataset_settings` body as it stands.
* `rugnux` and `jfjoch_viewer` read PILATUS miniCBF sweeps natively, without conversion.
* Masters written by other facilities open, including Eiger 1.x and third-party NXmx variants.
* `rugnux` measures the beam centre on every run, and indexes with it when the file's value indexes nothing.
* A detector swung out on a 2theta arm is placed where the file says it stands, and the calibration can hold the tilt fixed.
* `rugnux` writes the unmerged MTZ by default, and a P1 merge beside it, so a wrong space group can be re-merged without reprocessing.
* Significant improvements to symmetry handling in `rugnux`: the lattice, the point group, the setting and the systematic absences.
* The `rugnux` report gives the resolution the CC1/2 fit reached, beside the range the reflections were written to.
* The `rugnux` report gives the twinning statistics measured before the space group was decided, beside the ones measured after.
* The `rugnux` report gives the strong-direction diffraction limit, and warns when CC1/2 is not monotone with resolution.
* `rugnux` ranks screw axes on the evidence their absences carry, rather than on how many control reflections a candidate happens to have.
* Twinning is no longer reported when the L-test contradicts it.
* The `rugnux` report gives the detector tilt, the measured tilt and the direct beam beside the beam centre, and a post-refined beam centre is judged against the run's own measurement rather than the file's.
* `--no-refine-tilt` holds the detector tilt at the value in the file, instead of zeroing it, when the calibration starts from the spots.
* The `jfjoch_viewer` grid scan view draws the cells in the proportion of the scan steps, so the map has the shape of the scanned area.

Reviewed-on: #76
Co-authored-by: Filip Leonarski <filip.leonarski@psi.ch>
2026-09-02 21:17:31 +02:00

33 KiB
Raw Blame History

External test data

Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only ever sees its own detectors is not tested. The datasets below were collected by other people, on detectors and in file formats we do not produce ourselves, and are used here to check that rugnux reads foreign files correctly and reduces them to sensible results. Most were collected at other facilities; a few come from SLS beamlines, where the data are still written by someone else's detector and someone else's acquisition system. Their authors published all of these for exactly this kind of reuse, and this page is where we credit them.

None of these data were collected by us. If you use any of them, cite the dataset DOI in the table below; the repositories themselves are cited in ACKNOWLEDGEMENT.

Where the values come from

  • Source is the repository we downloaded from and that repository's own citable DOI for the archive we took. Every DOI on this page was resolved against DataCite before it was written down, and the identity of each dataset was taken from the repository's record for the archive - not from our directory names.
  • Beamline, resolution, space group and cell are the values deposited with the PDB entry, read from the RCSB data API. They describe the published experiment. They are not our reprocessing results; no quantity measured by Jungfraujoch appears on this page.
  • Detector is read out of the image files themselves - the NXmx /entry/instrument/detector/description or the miniCBF # Detector: header - because the detector named in a PDB entry is often only approximate. Where the two differ, the difference is listed below the table.
  • Anything that could not be established from one of those sources is left blank.

Datasets

PDB Source Facility / beamline dmin (Å) Space group Unit cell a b c α β γ (Å, °) Detector (from file) Title
11IF IRRMC 10.18430/M311IF NSLS-II 19-ID 1.51 P 43 51.1 51.1 71.9 90.0 90.0 90.0 Dectris EIGER2 Si 9M Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2
36GK IRRMC 10.18430/M336GK CLSI 08ID-1 2.28 I 2 2 2 120.6 189.5 199.7 90.0 90.0 90.0 Dectris Eiger 9M D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain
5F6M SBGrid 10.15785/sbgrid/201 SSRL BL11-1 1.10 P 21 21 21 54.8 58.5 67.4 90.0 90.0 90.0 PILATUS 6M Isotropic Trypsin Model for Comparison of Diffuse Scattering
5REO Zenodo 10.5281/zenodo.3730956 Diamond I04-1 1.88 C 1 2 1 112.4 52.6 44.4 90.0 103.0 90.0 PILATUS 6M-F PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578
5SRC IRRMC 10.18430/M35SRC ALS 8.3.1 1.05 P 43 88.7 88.7 39.2 90.0 90.0 90.0 PILATUS3 6M PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers
6HV2 IRRMC 10.18430/m36hv2 SLS X06SA 1.71 P 61 2 2 68.9 68.9 133.6 90.0 90.0 120.0 Dectris Eiger 16M MMP-13 in complex with the peptide IMISF
6JGJ IRRMC 10.18430/m36jgj SPring-8 BL41XU 0.77 P 21 21 21 50.9 62.3 68.8 90.0 90.0 90.0 PILATUS3 300K Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A
6LEO Zenodo 10.5281/zenodo.4003042 SPring-8 BL32XU 2.52 C 2 2 21 73.5 95.3 101.4 90.0 90.0 90.0 Dectris Eiger 9M Crystal structure of thiosulfate transporter YeeE from Spirochaeta thermophila
6O2H SBGrid 10.15785/sbgrid/747 CHESS F1 1.21 P 1 27.4 32.1 34.5 88.7 108.5 111.9 PILATUS3 6M Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset
6R72 Zenodo 10.5281/zenodo.14894181 SOLEIL PROXIMA 2 3.95 P 1 21 1 117.8 110.8 155.6 90.0 93.2 90.0 Dectris Eiger 9M Crystal structure of BmrA-E504A in an outward-facing conformation
6RLR Zenodo 10.5281/zenodo.5886687 Diamond I04 2.00 P 1 40.0 40.0 63.6 80.4 76.3 68.2 Eiger 16M Crystal structure of CD9 large extracellular loop
6TTN IRRMC 10.18430/m36ttn BESSY 14.1 1.12 P 21 21 21 39.9 79.8 104.7 90.0 90.0 90.0 PILATUS 6M N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine
6UKF IRRMC 10.18430/m36ukf APS 22-ID 1.00 P 1 21 1 61.0 37.3 69.0 90.0 109.8 90.0 Dectris Eiger 16M HhaI endonuclease in Complex with DNA at 1 Angstrom Resolution
6YQF IRRMC 10.18430/m36yqf Diamond I24 3.33 P 21 21 2 42.7 59.7 156.5 90.0 90.0 90.0 PILATUS3 6M Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly
6ZE4 SBGrid 10.15785/sbgrid/806 BESSY 14.1 1.60 P 21 21 21 93.6 109.9 116.1 90.0 90.0 90.0 PILATUS 6M FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide
7ATG IRRMC 10.18430/m37atg PETRA III, EMBL c/o DESY P13 (MX1) 0.60 P 21 21 21 18.0 31.0 43.9 90.0 90.0 90.0 PILATUS 6M-F Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution
7D1M IRRMC 10.18430/m37brr SSRF BL17U1 1.35 P 1 21 1 55.5 99.0 59.6 90.0 108.5 90.0 Dectris Eiger 16M CRYSTAL STRUCTURE OF THE SARS-CoV-2 MAIN PROTEASE COMPLEXED WITH GC376
7DKP IRRMC 10.18430/M37DKP ESRF MASSIF-3 1.45 P 1 21 1 49.8 169.5 49.8 90.0 93.5 90.0 Dectris Eiger 4M Crystal structure of E. coli Grx2 in complex with GSH at 1.45 A resolution
7K1L IRRMC 10.18430/m37k1l APS 19-ID 2.25 P 63 150.8 150.8 110.7 90.0 90.0 120.0 PILATUS3 6M Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate
7KCN IRRMC 10.18430/m37kcn LNLS W01B-MX2 1.46 P 41 2 2 67.0 67.0 116.9 90.0 90.0 90.0 PILATUS 2M Reconstructed ancestor of HIUases and Transthyretins
7MZT IRRMC 10.18430/m37mzt APS 22-ID 4.07 P 21 21 2 113.6 97.0 108.3 90.0 90.0 90.0 Dectris Eiger 16M Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A
7ORR IRRMC 10.18430/M37ORR MAX IV BioMAX 1.79 I 21 3 105.9 105.9 105.9 90.0 90.0 90.0 Dectris Eiger 16M Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022
7PH1 IRRMC 10.18430/M37PH1 BESSY 14.2 1.18 I 2 2 2 75.0 81.3 124.2 90.0 90.0 90.0 PILATUS3 2M Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid
7PQ7 IRRMC 10.18430/M3.IRRMC.6072 ELETTRA 11.2C 1.55 C 1 2 1 120.9 51.7 75.5 90.0 125.1 90.0 PILATUS 6M Crystal structure of Campylobacter jejuni DsbA1
7QIJ SBGrid 10.15785/sbgrid/907 PETRA III, EMBL c/o DESY P13 (MX1) 4.10 P 21 21 21 143.5 324.9 369.4 90.0 90.0 90.0 PILATUS 6M-F Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY
7QIS IRRMC 10.18430/M37QIS BESSY 14.2 1.83 P 61 100.3 100.3 206.2 90.0 90.0 120.0 PILATUS3 2M CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX
7RIS IRRMC 10.18430/M37RIS APS 21-ID-D 1.72 P 32 2 1 44.5 44.5 189.9 90.0 90.0 120.0 Dectris Eiger 9M Crystal structure of RPA3624, a beta-propeller lactonase from Rhodopseudomonas palustris, with active-site bound phosphate
7RJI IRRMC 10.18430/M37RJI LNLS W01B-MX2 1.71 H 3 2 83.0 83.0 124.8 90.0 90.0 120.0 PILATUS 2M BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid
7TCD IRRMC 10.18430/m37tcd SLS X06SA 1.70 C 1 2 1 138.5 47.9 78.1 90.0 107.6 90.0 Dectris Eiger 16M LOV2-DARPIN fusion: D13
7YZX IRRMC 10.18430/M37YZX Diamond I24 1.90 P 63 2 2 169.4 169.4 141.8 90.0 90.0 120.0 PILATUS3 6M ScpA from Streptococcus pyogenes, D783A mutant.
8A1A IRRMC 10.18430/M38A1A SLS X06SA 2.05 P 65 191.9 191.9 122.4 90.0 90.0 120.0 Dectris Eiger 16M Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct
8AGQ IRRMC 10.18430/M38AGQ SLS X06DA 1.09 C 1 2 1 89.9 55.4 54.8 90.0 113.5 90.0 PILATUS 2MF Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione
8DYZ SBGrid 10.15785/sbgrid/957 CHESS F1 1.27 P 43 21 2 79.6 79.6 38.3 90.0 90.0 90.0 PILATUS3 6M Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset
8DZ7 SBGrid 10.15785/sbgrid/958 CHESS F1 1.34 P 21 21 21 30.5 56.4 73.9 90.0 90.0 90.0 PILATUS3 6M Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset
8EGN IRRMC 10.18430/M38EGN CLSI 08B1-1 1.95 P 21 21 21 71.7 75.2 109.8 90.0 90.0 90.0 PILATUS3 6M Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701
8IYA IRRMC 10.18430/m38iya SSRF BL02U1 2.43 C 1 2 1 102.7 50.1 109.2 90.0 91.8 90.0 Dectris EIGER2 Si 9M Complex of SETDB1-derived peptide bound to UBE2E1
8K1G IRRMC 10.18430/M38K1G PAL/PLS 11C 2.09 I 4 2 2 182.0 182.0 80.7 90.0 90.0 90.0 PILATUS3 6M Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae
8OIC IRRMC 10.18430/m38oic Diamond I04 2.80 P 1 73.1 94.7 120.6 105.1 90.0 93.8 Eiger 16M Trichomonas vaginalis riboside hydrolase (His-tagged)
8PQD IRRMC 10.18430/m38pqd ESRF MASSIF-3 1.50 P 21 21 21 59.4 59.4 192.9 90.0 90.0 90.0 Dectris Eiger 4M c-KIT kinase domain in complex with avapritinib derivative 10
8QQ7 Zenodo 10.5281/zenodo.14901515 ESRF MASSIF-1 3.62 P 64 2 2 146.0 146.0 153.6 90.0 90.0 120.0 PILATUS3 2M Structure of SpNOX: a Bacterial NADPH oxidase
8R5R IRRMC 10.18430/m38r5r ESRF ID23-1 3.08 P 21 21 21 91.7 132.9 137.5 90.0 90.0 90.0 Dectris EIGER2 CdTe 16M Structure of apo TDO with a bound inhibitor
8SA8 IRRMC 10.18430/M38SA8 NSLS-II 19-ID 1.30 I 1 2 1 87.9 131.5 165.4 90.0 104.5 90.0 Dectris EIGER2 Si 9M Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form)
8SQQ IRRMC 10.18430/M38SQQ NSLS-II 19-ID 2.25 F 4 3 2 171.5 171.5 171.5 90.0 90.0 90.0 Dectris EIGER2 Si 9M Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant)
8SQT IRRMC 10.18430/M38SQT NSLS-II 19-ID 2.20 F 4 3 2 170.7 170.7 170.7 90.0 90.0 90.0 Dectris EIGER2 Si 9M Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant)
8T7R IRRMC 10.18430/M38T7R APS 22-ID 3.84 C 1 2 1 357.1 259.6 255.4 90.0 133.1 90.0 Dectris Eiger 16M Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07
8THA IRRMC 10.18430/m38tha SSRL BL9-2 1.68 P 64 69.2 69.2 29.1 90.0 90.0 120.0 PILATUS 6M 1TEL, non-compressed, double-helical crystal form
8U0I IRRMC 10.18430/m38u0i ALS 8.2.1 1.54 P 43 21 2 50.3 50.3 90.6 90.0 90.0 90.0 Dectris EIGER2 Si 9M Crystal structure of PA0012 complexed with cyclic-di-GMP from Pseudomonas aeruginosa
8V4O IRRMC 10.18430/m38v4o NSLS-II 19-ID 2.70 P 61 2 2 139.5 139.5 545.0 90.0 90.0 120.0 Dectris EIGER2 Si 9M Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans
8XBP IRRMC 10.18430/M38XBP SOLEIL PROXIMA 1 1.99 C 1 2 1 148.3 50.8 60.2 90.0 92.3 90.0 Dectris Eiger 16M Crystal structure of AtNATA1 bound to Acetyl CoA
8XTE SBGrid 10.15785/sbgrid/1101 SSRF BL19U1 1.99 P 32 208.8 208.8 67.2 90.0 90.0 120.0 PILATUS3 6M Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP
8XTF SBGrid 10.15785/sbgrid/1102 SSRF BL02U1 2.13 H 3 2 211.8 211.8 67.4 90.0 90.0 120.0 Dectris EIGER2 Si 9M Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C
8XTG SBGrid 10.15785/sbgrid/1100 SSRF BL19U1 2.00 P 32 199.5 199.5 67.2 90.0 90.0 120.0 Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA
8YS9 IRRMC 10.18430/M38YS9 PAL/PLS 5C (4A) 1.46 P 21 21 21 71.0 77.7 83.2 90.0 90.0 90.0 Dectris Eiger 9M Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH
9B22 IRRMC 10.18430/m39b22 NSLS-II 19-ID 1.30 P 1 21 1 39.8 92.7 57.7 90.0 91.7 90.0 Dectris EIGER2 Si 9M Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound)
9BN8 IRRMC 10.18430/m39bn8 NSLS-II 19-ID 1.35 P 41 65.5 65.5 134.8 90.0 90.0 90.0 Dectris EIGER2 Si 9M Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19
9CRW IRRMC 10.18430/m39crw CLSI 08ID-1 2.49 P 1 21 1 84.0 104.6 118.8 90.0 93.4 90.0 Dectris Eiger 9M Crystal structure of the Candida albicans kinesin-8 proximal tail domain
9GJX IRRMC 10.18430/M39GJX Diamond I04 2.40 P 1 21 1 76.8 115.8 103.8 90.0 110.3 90.0 Eiger 16M Bacillus licheniformis nitroreductase
9HS7 IRRMC 10.18430/M39HS7 ALBA XALOC 1.70 P 65 65.4 65.4 88.8 90.0 90.0 120.0 PILATUS3 X 6M Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER
9I0A IRRMC 10.18430/M39I0A SOLEIL PROXIMA 1 2.22 P 21 21 2 75.2 98.7 208.6 90.0 90.0 90.0 Dectris Eiger 16M CARM1 in complex with arg-aDMA analog
9IG7 IRRMC 10.18430/M39IG7 PETRA III, EMBL c/o DESY P13 (MX1) 2.60 P 21 21 2 111.5 153.5 69.0 90.0 90.0 90.0 Dectris EIGER1 Si 16M KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides
9IH9 IRRMC 10.18430/M39IH9 ESRF MASSIF-3 1.70 C 1 2 1 78.8 133.9 82.3 90.0 101.4 90.0 Dectris EIGER1 Si 4M KEAP1 complexed to linear peptide 6
9JZO IRRMC 10.18430/m39jzo PAL/PLS 11C 1.40 P 1 41.6 43.1 54.2 113.0 90.1 118.2 PILATUS3 6M Crystal structure of PHICD111_20024_EAD.
9MH4 IRRMC 10.18430/M39MH4 NSLS-II 19-ID 3.05 P 21 3 138.7 138.7 138.7 90.0 90.0 90.0 Dectris EIGER2 Si 9M Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes
9MIN SBGrid 10.15785/sbgrid/1151 ALS 8.2.1 2.05 P 21 21 21 95.5 98.5 155.7 90.0 90.0 90.0 Dectris EIGER2 Si 9M Structure of a designed minibinder to NYESO1-A*02:01
9O0H IRRMC 10.18430/M39O0H SSRL BL12-2 2.24 P 21 21 21 55.2 65.5 112.9 90.0 90.0 90.0 Dectris EIGER2 Si 16M The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker
9P7Q IRRMC 10.18430/M39P7Q SSRL BL12-1 2.21 C 1 2 1 97.0 45.0 72.1 90.0 105.1 90.0 Dectris EIGER2 Si 16M 273K human S-adenosylmethionine decarboxylase
9PBB IRRMC 10.18430/M39PBB SSRL BL12-1 2.17 C 1 2 1 97.4 45.9 72.2 90.0 105.0 90.0 Dectris EIGER2 Si 16M 293K human S-adenosylmethionine decarboxylase
9RP9 IRRMC 10.18430/M39RP9 SOLEIL PROXIMA 1 2.10 C 1 2 1 73.5 59.8 91.7 90.0 100.8 90.0 Dectris Eiger 16M Crystal structure of mouse pVHL-ElonginB-ElonginC complex
9SL0 IRRMC 10.18430/M39SL0 ESRF MASSIF-1 1.60 P 21 21 21 60.2 80.2 111.6 90.0 90.0 90.0 Dectris EIGER2 Si 9M Crystal structure of HLA-A0201 in complex with peptide LLWNGPMAV
9VX7 IRRMC 10.18430/M39VX7 PAL/PLS 5C (4A) 4.85 P 64 122.5 122.5 118.9 90.0 90.0 120.0 PILATUS3 6M Transcription factor
9VYB IRRMC 10.18430/M39VYB PAL/PLS 5C (4A) 2.12 P 21 21 21 44.4 47.8 48.4 90.0 90.0 90.0 Dectris Eiger 9M Antitoxin Phd
9W3Y IRRMC 10.18430/M39W3Y Photon Factory BL-1A 1.50 P 21 21 21 60.7 70.0 94.2 90.0 90.0 90.0 Dectris EIGER1 Si 4M X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6)
9YZK IRRMC 10.18430/M39YZK ALS 8.2.2 4.44 I 1 2 1 75.8 163.0 192.3 90.0 98.6 90.0 PILATUS3 S 2M Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
9Z44 IRRMC 10.18430/M39Z44 ALS 8.2.1 7.20 I 1 2 1 73.5 127.7 141.2 90.0 92.0 90.0 Dectris EIGER2 Si 9M Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain
9ZLO Zenodo 10.5281/zenodo.18652652 Australian Synchrotron MX2 2.00 P 21 21 21 38.4 90.0 107.0 90.0 90.0 90.0 Dectris EIGER1 Si 16M Crystal structure of Proteus mirabilis UreE
9ZM0 IRRMC 10.18430/M39ZM0 NSLS-II 17-ID-1 2.10 P 1 21 1 50.4 30.1 91.2 90.0 97.1 90.0 Dectris EIGER1 Si 9M Crystal structure of monomeric Atg23
9ZMU IRRMC 10.18430/M39ZMU NSLS-II 19-ID 1.98 P 65 2 2 47.8 47.8 492.6 90.0 90.0 120.0 Dectris EIGER2 Si 9M Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form)
Zenodo 10.5281/zenodo.1036416 Diamond Light Source I19-1 PILATUS 2M 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1
Zenodo 10.5281/zenodo.14894181 Dectris Eiger 9M Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation
Zenodo 10.5281/zenodo.20041091 Diamond Light Source I19-2 Eiger 2X 4M (CdTe) Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor
Zenodo 10.5281/zenodo.20135265 Diamond Light Source I19-2 Eiger 2X 4M (CdTe) Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor
Zenodo 10.5281/zenodo.6347466 Diamond Light Source I19-2 Eiger 2X 4M (CdTe) Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source

Five rows have no PDB code. Four are small-molecule / chemical-crystallography datasets, kept because they exercise short wavelengths, CdTe sensors and fine slicing; the fifth is the second collection in the 6R72 Zenodo record, described below. They have no deposited macromolecular values, so those columns are blank, and their titles are the repository record titles verbatim.

Archives that are not a single sweep

Most rows above are a single continuous rotation. Eleven archives are not; their layout is read from the image files themselves, from the repository file listings and from the depositors' own description of the record. Where an archive held more than one collection, only one is kept - the repository's project page is not a reliable guide to this, because it describes the project rather than the tarball (7TCD's page lists a 900-frame miniCBF sweep the archive does not contain).

6R72 - two collections on one crystal. The Zenodo record holds two complete 360° sweeps of 3600 × 0.1° frames taken from the same crystal: a helical collection, which produced the deposited structure, and a low-dose collection from a single position, which was not used for a deposition and therefore has no PDB entry. Both are in the table, sharing one DOI; the deposited values belong to the helical collection only. The record also ships the authors' XDS.INP.

The three CHESS depositions - wedges plus a measured background. Each crystal was rotated in 50° wedges of 500 × 0.1° frames and translated between wedges to spread the dose. Each crystal also has a rotation at 1° per frame taken with the crystal translated out of the beam, which the depositors include as a measured background and say can be matched to the diffraction frames by the phi value in the image header.

PDB Crystals Wedges per crystal Background rotation
8DYZ 1 8 360 frames
8DZ7 2 4 200 frames per crystal
6O2H 4 1, 3, 2, 5 - 11 in all 50, 145, 95, 235 frames, one per crystal

Seven IRRMC archives hold more than one collection. In six of them one sweep is kept and the rest were deleted, so a run over the data directory sees a single collection per dataset. 7RIS is the exception: its two sweeps are at different wavelengths and both are kept.

PDB What the archive holds Kept
6UKF two sweeps on one crystal - 960 x 0.25° (240°) and 1440 x 0.25° (360°) the 360° sweep
7DKP two complete 360° sweeps on one crystal, 3° apart in ω the first
9PBB two overlapping 135° wedges of one crystal, 90 x 1.5° each the first
8U0I a 69-frame screening wedge and three 180° sweeps on three crystals the first 180° sweep
36GK two 360° sweeps of 1800 x 0.2° at the same geometry the one the archive and DOI are named for
9CRW a dose pair on one crystal 37 min apart - 0.025 s at 289 mm, 0.010 s at 276 mm the 0.025 s sweep, whose 2.5 Å target matches the deposited 2.49 Å
7RIS two crystals at two wavelengths - 1.53494 Å (Ho derivative) and 1.03329 Å (the deposited native) both

Datasets published as Raw Data Letters

Three of the datasets - 6R72, 8QQ7 and 6RLR - were published as IUCrData Raw Data Letters, a format whose purpose is to make raw images citable and re-processable in their own right. The letters describe the collections and the difficulties in them, and are the reference for what the data are:

  • V. Zampieri, A. Vermot, M. Thepaut, I. Petit-Hartlein, F. Fieschi, P. Falson and V. Chaptal, "X-ray diffraction images for two membrane protein crystals presenting high anisotropy; the B. subtilis ABC transporter BmrA and the S. pneumoniae NADPH oxidase" (2025), IUCrData 10, x250591 doi:10.1107/S2414314625005917 - covers 6R72 and 8QQ7.
  • V. Neviani, M. Lutz, W. Oosterheert, P. Gros and L. Kroon-Batenburg, "Crystal structure of the second extracellular domain of human tetraspanin CD9: twinning and diffuse scattering" (2022), IUCrData 7, x220852 doi:10.1107/S2414314622008525 - covers 6RLR.

The authors of the second letter also published their own reciprocal-space reconstruction of the 6RLR data as a separate Zenodo record, 10.5281/zenodo.6961763.

Detector: image file vs PDB entry

For 76 of the 77 PDB-coded rows both the image file and the PDB entry name a detector. (For 8XTG neither can be compared - the header reads PILATUS XXX, S/N XX-XXX.) The table above uses the file value in every case, because the entry's label is often approximate.

Seven of the 76 genuinely conflict - the two sources name detectors that cannot both be right:

PDB PDB entry says Image file says Conflict
6JGJ DECTRIS PILATUS3 6M PILATUS3 300K, S/N 3-0226 model / size
8R5R DECTRIS PILATUS 6M Dectris EIGER2 CdTe 16M model / size
9SL0 DECTRIS PILATUS4 X 4M Dectris EIGER2 Si 9M model / size
9VX7 DECTRIS EIGER X 9M PILATUS3 6M, S/N 60-0133 model / size
7ATG DECTRIS PILATUS3 S 6M PILATUS 6M-F, S/N 60-0117-F generation
9O0H DECTRIS EIGER X 16M Dectris EIGER2 Si 16M, S/N D021324 generation
9Z44 DECTRIS EIGER X 9M Dectris EIGER2 Si 9M, S/N E-18-0131 generation

For 9SL0 the file is decisive and the entry is wrong: 3108 x 3262 pixels of 75 um on 450 um silicon, written by EIGER2 firmware release-2022.1.2, is an EIGER2 9M and not a PILATUS4 4M.

A further 29 differ only in how much they state, which is not a conflict. In 23 the NXmx description gives the model and size but no generation (Dectris Eiger 16M) where the entry names one (DECTRIS EIGER X 16M); in 6 it is the other way round, the miniCBF header naming a generation (PILATUS3 6M) that the entry leaves off (DECTRIS PILATUS 6M) - 6YQF, 7PH1, 7QIS, 7YZX, 8XTE and 9YZK.

Deposited models and structure factors

77 of the 82 datasets have a released PDB entry, and RCSB reports released structure factors (status_code_sf = REL) for every one of them. A merged result from this pipeline can therefore be checked against the deposited model or against the deposited intensities.

Dataset directories whose name is not the PDB code

Directory PDB code in the table Why
7brr 7D1M The IRRMC archive and its DOI are published under 7BRR, which the PDB obsoleted on 2020-10-28 and replaced with 7D1M. The directory and the DOI keep the archive's own name; the deposited values are 7D1M's.

An archive that ships placeholder images

8AGQ's data/ directory contains 30 files named ForBackgroundOnly_000NN.img alongside the 1800-frame sweep. They are not images: each is a 64-byte text file holding a path string. A reader that globs *.img will pick them up, so they are named here rather than silently left.

Datasets with no PDB entry

Dataset Repository record Why there is no PDB code
6r72/ld Zenodo record 10.5281/zenodo.14894181, file prefix V-CK63-8-ld_1_ a second collection in the 6R72 record - a low-dose sweep on the same crystal, not the one the deposited structure was built from
cuhf2 Zenodo record 10.5281/zenodo.6347466 a small-molecule dataset, not a PDB deposition
dnba Zenodo record 10.5281/zenodo.1036416 a small-molecule dataset, not a PDB deposition
metformin Zenodo record 10.5281/zenodo.20135265 a small-molecule dataset, not a PDB deposition
nidppe Zenodo record 10.5281/zenodo.20041091 a small-molecule dataset, not a PDB deposition

Three of the four small-molecule sets have a published structure to check a run against. These are reference values from the literature, not results obtained here.

Dataset Space group Cell (A, deg) T Reference
dnba C 1 2/c 1 (15) 20.2635 8.7575 9.6697 / 90 109.941 90 30 K the Zenodo record's own title and the xia2.html the depositors ship inside it, corroborated by COD 4510614/4510615 - Cryst. Growth Des. 13 (2013) 1861-1871 doi:10.1021/cg300906j
metformin P 1 21/c 1 (14) 7.9104 13.8794 7.9310 / 90 114.606 90 100 K the hydrochloride, form I; COD 2108029 - Acta Cryst. B73 (2017) 10-22 doi:10.1107/S2052520616017844
nidppe P 1 21/c 1 (14) 11.2779 13.3386 15.8739 / 90 98.7953 90 150 K COD 2012031 - Acta Cryst. C57 (2001) 690-693 doi:10.1107/S0108270101003961

cuhf2 has no confirmed cell. Its space group is published as P 4/n m m (Phys. Rev. B 81, 064422 (2010) doi:10.1103/PhysRevB.81.064422) but no numeric cell was located, so a run on it can be scored on the space group and not on the cell.

Licences

Each dataset carries the licence of its own deposition, stated on the record page linked above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each record states. None of these data are redistributed with Jungfraujoch; this page only records where they came from.