Files
Jungfraujoch/docs/EXTERNAL_TEST_DATA.md
T
leonarski_fandClaude Opus 5 756c3a22bb docs: confirmed cells for three small-molecule sets; drop the unprocessable CCD one
The four Diamond I19 small-molecule datasets had no reference of any kind, so a run
on them could not be scored at all. Three now have one, each from a published
structure with its DOI verified against Crossref; the fourth has a published space
group but no numeric cell anywhere, which is recorded as such.

Also removes the "obtained but not in the table" section. That dataset is stored as
CCD TIFFs the reader does not support, so it is not processed here and adds nothing
to a page about what the test corpus contains.

Co-Authored-By: Claude Opus 5 (1M context) <noreply@anthropic.com>
Claude-Session: https://claude.ai/code/session_01EFEJG6WBQv8th4UJFNe53N
2026-08-31 11:02:38 +02:00

260 lines
33 KiB
Markdown
Raw Blame History

This file contains ambiguous Unicode characters
This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.
# External test data
Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only
ever sees its own detectors is not tested. The datasets below were collected by other people,
on detectors and in file formats we do not produce ourselves, and are used here to check that
`rugnux` reads foreign files correctly and reduces them to sensible results. Most were collected
at other facilities; a few come from SLS beamlines, where the data are still written by someone
else's detector and someone else's acquisition system. Their authors published all of these for
exactly this kind of reuse, and this page is where we credit them.
**None of these data were collected by us.** If you use any of them, cite the dataset DOI in
the table below; the repositories themselves are cited in
[ACKNOWLEDGEMENT](ACKNOWLEDGEMENT.md).
## Where the values come from
- **Source** is the repository we downloaded from and that repository's own citable DOI for
the archive we took. Every DOI on this page was resolved against DataCite before it was
written down, and the identity of each dataset was taken from the repository's record for
the archive - not from our directory names.
- **Beamline, resolution, space group and cell are the values deposited with the PDB entry**,
read from the RCSB data API. They describe the published experiment. They are *not* our
reprocessing results; no quantity measured by Jungfraujoch appears on this page.
- **Detector is read out of the image files themselves** - the NXmx
`/entry/instrument/detector/description` or the miniCBF `# Detector:` header - because the
detector named in a PDB entry is often only approximate. Where the two differ, the
difference is listed below the table.
- Anything that could not be established from one of those sources is left blank.
## Datasets
| PDB | Source | Facility / beamline | d<sub>min</sub> (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title |
|---|---|---|---|---|---|---|---|
| [11IF](https://www.rcsb.org/structure/11IF) | IRRMC [10.18430/M311IF](https://doi.org/10.18430/M311IF) | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 |
| [36GK](https://www.rcsb.org/structure/36GK) | IRRMC [10.18430/M336GK](https://doi.org/10.18430/M336GK) | CLSI 08ID-1 | 2.28 | I 2 2 2 | 120.6 189.5 199.7 90.0 90.0 90.0 | Dectris Eiger 9M | D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain |
| [5F6M](https://www.rcsb.org/structure/5F6M) | SBGrid [10.15785/sbgrid/201](https://doi.org/10.15785/sbgrid/201) | SSRL BL11-1 | 1.10 | P 21 21 21 | 54.8 58.5 67.4 90.0 90.0 90.0 | PILATUS 6M | Isotropic Trypsin Model for Comparison of Diffuse Scattering |
| [5REO](https://www.rcsb.org/structure/5REO) | Zenodo [10.5281/zenodo.3730956](https://doi.org/10.5281/zenodo.3730956) | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 |
| [5SRC](https://www.rcsb.org/structure/5SRC) | IRRMC [10.18430/M35SRC](https://doi.org/10.18430/M35SRC) | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers |
| [6HV2](https://www.rcsb.org/structure/6HV2) | IRRMC [10.18430/m36hv2](https://doi.org/10.18430/m36hv2) | SLS X06SA | 1.71 | P 61 2 2 | 68.9 68.9 133.6 90.0 90.0 120.0 | Dectris Eiger 16M | MMP-13 in complex with the peptide IMISF |
| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A |
| [6LEO](https://www.rcsb.org/structure/6LEO) | Zenodo [10.5281/zenodo.4003042](https://doi.org/10.5281/zenodo.4003042) | SPring-8 BL32XU | 2.52 | C 2 2 21 | 73.5 95.3 101.4 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of thiosulfate transporter YeeE from Spirochaeta thermophila |
| [6O2H](https://www.rcsb.org/structure/6O2H) | SBGrid [10.15785/sbgrid/747](https://doi.org/10.15785/sbgrid/747) | CHESS F1 | 1.21 | P 1 | 27.4 32.1 34.5 88.7 108.5 111.9 | PILATUS3 6M | Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset |
| [6R72](https://www.rcsb.org/structure/6R72) | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | SOLEIL PROXIMA 2 | 3.95 | P 1 21 1 | 117.8 110.8 155.6 90.0 93.2 90.0 | Dectris Eiger 9M | Crystal structure of BmrA-E504A in an outward-facing conformation |
| [6RLR](https://www.rcsb.org/structure/6RLR) | Zenodo [10.5281/zenodo.5886687](https://doi.org/10.5281/zenodo.5886687) | Diamond I04 | 2.00 | P 1 | 40.0 40.0 63.6 80.4 76.3 68.2 | Eiger 16M | Crystal structure of CD9 large extracellular loop |
| [6TTN](https://www.rcsb.org/structure/6TTN) | IRRMC [10.18430/m36ttn](https://doi.org/10.18430/m36ttn) | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine |
| [6UKF](https://www.rcsb.org/structure/6UKF) | IRRMC [10.18430/m36ukf](https://doi.org/10.18430/m36ukf) | APS 22-ID | 1.00 | P 1 21 1 | 61.0 37.3 69.0 90.0 109.8 90.0 | Dectris Eiger 16M | HhaI endonuclease in Complex with DNA at 1 Angstrom Resolution |
| [6YQF](https://www.rcsb.org/structure/6YQF) | IRRMC [10.18430/m36yqf](https://doi.org/10.18430/m36yqf) | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly |
| [6ZE4](https://www.rcsb.org/structure/6ZE4) | SBGrid [10.15785/sbgrid/806](https://doi.org/10.15785/sbgrid/806) | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide |
| [7ATG](https://www.rcsb.org/structure/7ATG) | IRRMC [10.18430/m37atg](https://doi.org/10.18430/m37atg) | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution |
| [7D1M](https://www.rcsb.org/structure/7D1M) | IRRMC [10.18430/m37brr](https://doi.org/10.18430/m37brr) | SSRF BL17U1 | 1.35 | P 1 21 1 | 55.5 99.0 59.6 90.0 108.5 90.0 | Dectris Eiger 16M | CRYSTAL STRUCTURE OF THE SARS-CoV-2 MAIN PROTEASE COMPLEXED WITH GC376 |
| [7DKP](https://www.rcsb.org/structure/7DKP) | IRRMC [10.18430/M37DKP](https://doi.org/10.18430/M37DKP) | ESRF MASSIF-3 | 1.45 | P 1 21 1 | 49.8 169.5 49.8 90.0 93.5 90.0 | Dectris Eiger 4M | Crystal structure of E. coli Grx2 in complex with GSH at 1.45 A resolution |
| [7K1L](https://www.rcsb.org/structure/7K1L) | IRRMC [10.18430/m37k1l](https://doi.org/10.18430/m37k1l) | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate |
| [7KCN](https://www.rcsb.org/structure/7KCN) | IRRMC [10.18430/m37kcn](https://doi.org/10.18430/m37kcn) | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins |
| [7MZT](https://www.rcsb.org/structure/7MZT) | IRRMC [10.18430/m37mzt](https://doi.org/10.18430/m37mzt) | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A |
| [7ORR](https://www.rcsb.org/structure/7ORR) | IRRMC [10.18430/M37ORR](https://doi.org/10.18430/M37ORR) | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 |
| [7PH1](https://www.rcsb.org/structure/7PH1) | IRRMC [10.18430/M37PH1](https://doi.org/10.18430/M37PH1) | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid |
| [7PQ7](https://www.rcsb.org/structure/7PQ7) | IRRMC [10.18430/M3.IRRMC.6072](https://doi.org/10.18430/M3.IRRMC.6072) | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 |
| [7QIJ](https://www.rcsb.org/structure/7QIJ) | SBGrid [10.15785/sbgrid/907](https://doi.org/10.15785/sbgrid/907) | PETRA III, EMBL c/o DESY P13 (MX1) | 4.10 | P 21 21 21 | 143.5 324.9 369.4 90.0 90.0 90.0 | PILATUS 6M-F | Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY |
| [7QIS](https://www.rcsb.org/structure/7QIS) | IRRMC [10.18430/M37QIS](https://doi.org/10.18430/M37QIS) | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX |
| [7RIS](https://www.rcsb.org/structure/7RIS) | IRRMC [10.18430/M37RIS](https://doi.org/10.18430/M37RIS) | APS 21-ID-D | 1.72 | P 32 2 1 | 44.5 44.5 189.9 90.0 90.0 120.0 | Dectris Eiger 9M | Crystal structure of RPA3624, a beta-propeller lactonase from Rhodopseudomonas palustris, with active-site bound phosphate |
| [7RJI](https://www.rcsb.org/structure/7RJI) | IRRMC [10.18430/M37RJI](https://doi.org/10.18430/M37RJI) | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid |
| [7TCD](https://www.rcsb.org/structure/7TCD) | IRRMC [10.18430/m37tcd](https://doi.org/10.18430/m37tcd) | SLS X06SA | 1.70 | C 1 2 1 | 138.5 47.9 78.1 90.0 107.6 90.0 | Dectris Eiger 16M | LOV2-DARPIN fusion: D13 |
| [7YZX](https://www.rcsb.org/structure/7YZX) | IRRMC [10.18430/M37YZX](https://doi.org/10.18430/M37YZX) | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. |
| [8A1A](https://www.rcsb.org/structure/8A1A) | IRRMC [10.18430/M38A1A](https://doi.org/10.18430/M38A1A) | SLS X06SA | 2.05 | P 65 | 191.9 191.9 122.4 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct |
| [8AGQ](https://www.rcsb.org/structure/8AGQ) | IRRMC [10.18430/M38AGQ](https://doi.org/10.18430/M38AGQ) | SLS X06DA | 1.09 | C 1 2 1 | 89.9 55.4 54.8 90.0 113.5 90.0 | PILATUS 2MF | Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione |
| [8DYZ](https://www.rcsb.org/structure/8DYZ) | SBGrid [10.15785/sbgrid/957](https://doi.org/10.15785/sbgrid/957) | CHESS F1 | 1.27 | P 43 21 2 | 79.6 79.6 38.3 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset |
| [8DZ7](https://www.rcsb.org/structure/8DZ7) | SBGrid [10.15785/sbgrid/958](https://doi.org/10.15785/sbgrid/958) | CHESS F1 | 1.34 | P 21 21 21 | 30.5 56.4 73.9 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset |
| [8EGN](https://www.rcsb.org/structure/8EGN) | IRRMC [10.18430/M38EGN](https://doi.org/10.18430/M38EGN) | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 |
| [8IYA](https://www.rcsb.org/structure/8IYA) | IRRMC [10.18430/m38iya](https://doi.org/10.18430/m38iya) | SSRF BL02U1 | 2.43 | C 1 2 1 | 102.7 50.1 109.2 90.0 91.8 90.0 | Dectris EIGER2 Si 9M | Complex of SETDB1-derived peptide bound to UBE2E1 |
| [8K1G](https://www.rcsb.org/structure/8K1G) | IRRMC [10.18430/M38K1G](https://doi.org/10.18430/M38K1G) | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae |
| [8OIC](https://www.rcsb.org/structure/8OIC) | IRRMC [10.18430/m38oic](https://doi.org/10.18430/m38oic) | Diamond I04 | 2.80 | P 1 | 73.1 94.7 120.6 105.1 90.0 93.8 | Eiger 16M | Trichomonas vaginalis riboside hydrolase (His-tagged) |
| [8PQD](https://www.rcsb.org/structure/8PQD) | IRRMC [10.18430/m38pqd](https://doi.org/10.18430/m38pqd) | ESRF MASSIF-3 | 1.50 | P 21 21 21 | 59.4 59.4 192.9 90.0 90.0 90.0 | Dectris Eiger 4M | c-KIT kinase domain in complex with avapritinib derivative 10 |
| [8QQ7](https://www.rcsb.org/structure/8QQ7) | Zenodo [10.5281/zenodo.14901515](https://doi.org/10.5281/zenodo.14901515) | ESRF MASSIF-1 | 3.62 | P 64 2 2 | 146.0 146.0 153.6 90.0 90.0 120.0 | PILATUS3 2M | Structure of SpNOX: a Bacterial NADPH oxidase |
| [8R5R](https://www.rcsb.org/structure/8R5R) | IRRMC [10.18430/m38r5r](https://doi.org/10.18430/m38r5r) | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor |
| [8SA8](https://www.rcsb.org/structure/8SA8) | IRRMC [10.18430/M38SA8](https://doi.org/10.18430/M38SA8) | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) |
| [8SQQ](https://www.rcsb.org/structure/8SQQ) | IRRMC [10.18430/M38SQQ](https://doi.org/10.18430/M38SQQ) | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) |
| [8SQT](https://www.rcsb.org/structure/8SQT) | IRRMC [10.18430/M38SQT](https://doi.org/10.18430/M38SQT) | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) |
| [8T7R](https://www.rcsb.org/structure/8T7R) | IRRMC [10.18430/M38T7R](https://doi.org/10.18430/M38T7R) | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 |
| [8THA](https://www.rcsb.org/structure/8THA) | IRRMC [10.18430/m38tha](https://doi.org/10.18430/m38tha) | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form |
| [8U0I](https://www.rcsb.org/structure/8U0I) | IRRMC [10.18430/m38u0i](https://doi.org/10.18430/m38u0i) | ALS 8.2.1 | 1.54 | P 43 21 2 | 50.3 50.3 90.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of PA0012 complexed with cyclic-di-GMP from Pseudomonas aeruginosa |
| [8V4O](https://www.rcsb.org/structure/8V4O) | IRRMC [10.18430/m38v4o](https://doi.org/10.18430/m38v4o) | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans |
| [8XBP](https://www.rcsb.org/structure/8XBP) | IRRMC [10.18430/M38XBP](https://doi.org/10.18430/M38XBP) | SOLEIL PROXIMA 1 | 1.99 | C 1 2 1 | 148.3 50.8 60.2 90.0 92.3 90.0 | Dectris Eiger 16M | Crystal structure of AtNATA1 bound to Acetyl CoA |
| [8XTE](https://www.rcsb.org/structure/8XTE) | SBGrid [10.15785/sbgrid/1101](https://doi.org/10.15785/sbgrid/1101) | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP |
| [8XTF](https://www.rcsb.org/structure/8XTF) | SBGrid [10.15785/sbgrid/1102](https://doi.org/10.15785/sbgrid/1102) | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C |
| [8XTG](https://www.rcsb.org/structure/8XTG) | SBGrid [10.15785/sbgrid/1100](https://doi.org/10.15785/sbgrid/1100) | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA |
| [8YS9](https://www.rcsb.org/structure/8YS9) | IRRMC [10.18430/M38YS9](https://doi.org/10.18430/M38YS9) | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH |
| [9B22](https://www.rcsb.org/structure/9B22) | IRRMC [10.18430/m39b22](https://doi.org/10.18430/m39b22) | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) |
| [9BN8](https://www.rcsb.org/structure/9BN8) | IRRMC [10.18430/m39bn8](https://doi.org/10.18430/m39bn8) | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 |
| [9CRW](https://www.rcsb.org/structure/9CRW) | IRRMC [10.18430/m39crw](https://doi.org/10.18430/m39crw) | CLSI 08ID-1 | 2.49 | P 1 21 1 | 84.0 104.6 118.8 90.0 93.4 90.0 | Dectris Eiger 9M | Crystal structure of the Candida albicans kinesin-8 proximal tail domain |
| [9GJX](https://www.rcsb.org/structure/9GJX) | IRRMC [10.18430/M39GJX](https://doi.org/10.18430/M39GJX) | Diamond I04 | 2.40 | P 1 21 1 | 76.8 115.8 103.8 90.0 110.3 90.0 | Eiger 16M | Bacillus licheniformis nitroreductase |
| [9HS7](https://www.rcsb.org/structure/9HS7) | IRRMC [10.18430/M39HS7](https://doi.org/10.18430/M39HS7) | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER |
| [9I0A](https://www.rcsb.org/structure/9I0A) | IRRMC [10.18430/M39I0A](https://doi.org/10.18430/M39I0A) | SOLEIL PROXIMA 1 | 2.22 | P 21 21 2 | 75.2 98.7 208.6 90.0 90.0 90.0 | Dectris Eiger 16M | CARM1 in complex with arg-aDMA analog |
| [9IG7](https://www.rcsb.org/structure/9IG7) | IRRMC [10.18430/M39IG7](https://doi.org/10.18430/M39IG7) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.60 | P 21 21 2 | 111.5 153.5 69.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides |
| [9IH9](https://www.rcsb.org/structure/9IH9) | IRRMC [10.18430/M39IH9](https://doi.org/10.18430/M39IH9) | ESRF MASSIF-3 | 1.70 | C 1 2 1 | 78.8 133.9 82.3 90.0 101.4 90.0 | Dectris EIGER1 Si 4M | KEAP1 complexed to linear peptide 6 |
| [9JZO](https://www.rcsb.org/structure/9JZO) | IRRMC [10.18430/m39jzo](https://doi.org/10.18430/m39jzo) | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. |
| [9MH4](https://www.rcsb.org/structure/9MH4) | IRRMC [10.18430/M39MH4](https://doi.org/10.18430/M39MH4) | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes |
| [9MIN](https://www.rcsb.org/structure/9MIN) | SBGrid [10.15785/sbgrid/1151](https://doi.org/10.15785/sbgrid/1151) | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 |
| [9O0H](https://www.rcsb.org/structure/9O0H) | IRRMC [10.18430/M39O0H](https://doi.org/10.18430/M39O0H) | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker |
| [9P7Q](https://www.rcsb.org/structure/9P7Q) | IRRMC [10.18430/M39P7Q](https://doi.org/10.18430/M39P7Q) | SSRL BL12-1 | 2.21 | C 1 2 1 | 97.0 45.0 72.1 90.0 105.1 90.0 | Dectris EIGER2 Si 16M | 273K human S-adenosylmethionine decarboxylase |
| [9PBB](https://www.rcsb.org/structure/9PBB) | IRRMC [10.18430/M39PBB](https://doi.org/10.18430/M39PBB) | SSRL BL12-1 | 2.17 | C 1 2 1 | 97.4 45.9 72.2 90.0 105.0 90.0 | Dectris EIGER2 Si 16M | 293K human S-adenosylmethionine decarboxylase |
| [9RP9](https://www.rcsb.org/structure/9RP9) | IRRMC [10.18430/M39RP9](https://doi.org/10.18430/M39RP9) | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex |
| [9SL0](https://www.rcsb.org/structure/9SL0) | IRRMC [10.18430/M39SL0](https://doi.org/10.18430/M39SL0) | ESRF MASSIF-1 | 1.60 | P 21 21 21 | 60.2 80.2 111.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of HLA-A0201 in complex with peptide LLWNGPMAV |
| [9VX7](https://www.rcsb.org/structure/9VX7) | IRRMC [10.18430/M39VX7](https://doi.org/10.18430/M39VX7) | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor |
| [9VYB](https://www.rcsb.org/structure/9VYB) | IRRMC [10.18430/M39VYB](https://doi.org/10.18430/M39VYB) | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd |
| [9W3Y](https://www.rcsb.org/structure/9W3Y) | IRRMC [10.18430/M39W3Y](https://doi.org/10.18430/M39W3Y) | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) |
| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA |
| [9Z44](https://www.rcsb.org/structure/9Z44) | IRRMC [10.18430/M39Z44](https://doi.org/10.18430/M39Z44) | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain |
| [9ZLO](https://www.rcsb.org/structure/9ZLO) | Zenodo [10.5281/zenodo.18652652](https://doi.org/10.5281/zenodo.18652652) | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE |
| [9ZM0](https://www.rcsb.org/structure/9ZM0) | IRRMC [10.18430/M39ZM0](https://doi.org/10.18430/M39ZM0) | NSLS-II 17-ID-1 | 2.10 | P 1 21 1 | 50.4 30.1 91.2 90.0 97.1 90.0 | Dectris EIGER1 Si 9M | Crystal structure of monomeric Atg23 |
| [9ZMU](https://www.rcsb.org/structure/9ZMU) | IRRMC [10.18430/M39ZMU](https://doi.org/10.18430/M39ZMU) | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) |
| — | Zenodo [10.5281/zenodo.1036416](https://doi.org/10.5281/zenodo.1036416) | Diamond Light Source I19-1 | | | | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 |
| — | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | | | | | Dectris Eiger 9M | Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation |
| — | Zenodo [10.5281/zenodo.20041091](https://doi.org/10.5281/zenodo.20041091) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
| — | Zenodo [10.5281/zenodo.20135265](https://doi.org/10.5281/zenodo.20135265) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
| — | Zenodo [10.5281/zenodo.6347466](https://doi.org/10.5281/zenodo.6347466) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source |
Five rows have no PDB code. Four are small-molecule / chemical-crystallography datasets, kept
because they exercise short wavelengths, CdTe sensors and fine slicing; the fifth is the second
collection in the 6R72 Zenodo record, described below. They have no deposited macromolecular
values, so those columns are blank, and their titles are the repository record titles verbatim.
## Archives that are not a single sweep
Most rows above are a single continuous rotation. Eleven archives are not; their layout is read
from the image files themselves, from the repository file listings and from the depositors' own
description of the record. Where an archive held more than one collection, only one is kept -
the repository's project page is not a reliable guide to this, because it describes the project
rather than the tarball (7TCD's page lists a 900-frame miniCBF sweep the archive does not
contain).
**6R72 - two collections on one crystal.** The Zenodo record holds two complete 360° sweeps of
3600 × 0.1° frames taken from the same crystal: a helical collection, which produced the
deposited structure, and a low-dose collection from a single position, which was not used for a
deposition and therefore has no PDB entry. Both are in the table, sharing one DOI; the deposited
values belong to the helical collection only. The record also ships the authors' `XDS.INP`.
**The three CHESS depositions - wedges plus a measured background.** Each crystal was rotated in
50° wedges of 500 × 0.1° frames and translated between wedges to spread the dose. Each crystal
also has a rotation at 1° per frame taken with the crystal translated out of the beam, which the
depositors include as a measured background and say can be matched to the diffraction frames by
the `phi` value in the image header.
| PDB | Crystals | Wedges per crystal | Background rotation |
|---|---|---|---|
| 8DYZ | 1 | 8 | 360 frames |
| 8DZ7 | 2 | 4 | 200 frames per crystal |
| 6O2H | 4 | 1, 3, 2, 5 - 11 in all | 50, 145, 95, 235 frames, one per crystal |
**Seven IRRMC archives hold more than one collection.** In six of them one sweep is kept and
the rest were deleted, so a run over the data directory sees a single collection per dataset.
7RIS is the exception: its two sweeps are at different wavelengths and both are kept.
| PDB | What the archive holds | Kept |
|---|---|---|
| 6UKF | two sweeps on one crystal - 960 x 0.25° (240°) and 1440 x 0.25° (360°) | the 360° sweep |
| 7DKP | two complete 360° sweeps on one crystal, 3° apart in ω | the first |
| 9PBB | two overlapping 135° wedges of one crystal, 90 x 1.5° each | the first |
| 8U0I | a 69-frame screening wedge and three 180° sweeps on three crystals | the first 180° sweep |
| 36GK | two 360° sweeps of 1800 x 0.2° at the same geometry | the one the archive and DOI are named for |
| 9CRW | a dose pair on one crystal 37 min apart - 0.025 s at 289 mm, 0.010 s at 276 mm | the 0.025 s sweep, whose 2.5 Å target matches the deposited 2.49 Å |
| 7RIS | two crystals at two wavelengths - 1.53494 Å (Ho derivative) and 1.03329 Å (the deposited native) | **both** |
## Datasets published as Raw Data Letters
Three of the datasets - 6R72, 8QQ7 and 6RLR - were published as IUCrData Raw Data Letters, a
format whose purpose is to make raw images citable and re-processable in their own right. The
letters describe the collections and the difficulties in them, and are the reference for what the
data are:
- V. Zampieri, A. Vermot, M. Thepaut, I. Petit-Hartlein, F. Fieschi, P. Falson and V. Chaptal,
"X-ray diffraction images for two membrane protein crystals presenting high anisotropy; the
*B. subtilis* ABC transporter BmrA and the *S. pneumoniae* NADPH oxidase" (2025), IUCrData 10,
x250591 [doi:10.1107/S2414314625005917](https://doi.org/10.1107/S2414314625005917) - covers
6R72 and 8QQ7.
- V. Neviani, M. Lutz, W. Oosterheert, P. Gros and L. Kroon-Batenburg, "Crystal structure of the
second extracellular domain of human tetraspanin CD9: twinning and diffuse scattering" (2022),
IUCrData 7, x220852
[doi:10.1107/S2414314622008525](https://doi.org/10.1107/S2414314622008525) - covers 6RLR.
The authors of the second letter also published their own reciprocal-space reconstruction of the
6RLR data as a separate Zenodo record,
[10.5281/zenodo.6961763](https://doi.org/10.5281/zenodo.6961763).
## Detector: image file vs PDB entry
For 76 of the 77 PDB-coded rows both the image file and the PDB entry name a detector. (For
8XTG neither can be compared - the header reads `PILATUS XXX, S/N XX-XXX`.) The table above uses
the file value in every case, because the entry's label is often approximate.
**Seven of the 76 genuinely conflict** - the two sources name detectors that cannot both be
right:
| PDB | PDB entry says | Image file says | Conflict |
|---|---|---|---|
| 6JGJ | DECTRIS PILATUS3 6M | PILATUS3 300K, S/N 3-0226 | model / size |
| 8R5R | DECTRIS PILATUS 6M | Dectris EIGER2 CdTe 16M | model / size |
| 9SL0 | DECTRIS PILATUS4 X 4M | Dectris EIGER2 Si 9M | model / size |
| 9VX7 | DECTRIS EIGER X 9M | PILATUS3 6M, S/N 60-0133 | model / size |
| 7ATG | DECTRIS PILATUS3 S 6M | PILATUS 6M-F, S/N 60-0117-F | generation |
| 9O0H | DECTRIS EIGER X 16M | Dectris EIGER2 Si 16M, S/N D021324 | generation |
| 9Z44 | DECTRIS EIGER X 9M | Dectris EIGER2 Si 9M, S/N E-18-0131 | generation |
For 9SL0 the file is decisive and the entry is wrong: 3108 x 3262 pixels of 75 um on 450 um
silicon, written by EIGER2 firmware `release-2022.1.2`, is an EIGER2 9M and not a PILATUS4 4M.
A further **29 differ only in how much they state**, which is not a conflict. In 23 the NXmx
`description` gives the model and size but no generation (`Dectris Eiger 16M`) where the entry
names one (`DECTRIS EIGER X 16M`); in 6 it is the other way round, the miniCBF header naming a
generation (`PILATUS3 6M`) that the entry leaves off (`DECTRIS PILATUS 6M`) - 6YQF, 7PH1, 7QIS,
7YZX, 8XTE and 9YZK.
## Deposited models and structure factors
77 of the 82 datasets have a released PDB entry, and RCSB reports released structure factors
(`status_code_sf = REL`) for every one of them. A merged result from this pipeline can therefore be checked
against the deposited model or against the deposited intensities.
## Dataset directories whose name is not the PDB code
| Directory | PDB code in the table | Why |
|---|---|---|
| `7brr` | 7D1M | The IRRMC archive and its DOI are published under 7BRR, which the PDB obsoleted on 2020-10-28 and replaced with 7D1M. The directory and the DOI keep the archive's own name; the deposited values are 7D1M's. |
## An archive that ships placeholder images
8AGQ's `data/` directory contains 30 files named `ForBackgroundOnly_000NN.img` alongside the
1800-frame sweep. They are not images: each is a 64-byte text file holding a path string. A
reader that globs `*.img` will pick them up, so they are named here rather than silently left.
## Datasets with no PDB entry
| Dataset | Repository record | Why there is no PDB code |
|---|---|---|
| `6r72/ld` | Zenodo record 10.5281/zenodo.14894181, file prefix `V-CK63-8-ld_1_` | a second collection in the 6R72 record - a low-dose sweep on the same crystal, not the one the deposited structure was built from |
| `cuhf2` | Zenodo record 10.5281/zenodo.6347466 | a small-molecule dataset, not a PDB deposition |
| `dnba` | Zenodo record 10.5281/zenodo.1036416 | a small-molecule dataset, not a PDB deposition |
| `metformin` | Zenodo record 10.5281/zenodo.20135265 | a small-molecule dataset, not a PDB deposition |
| `nidppe` | Zenodo record 10.5281/zenodo.20041091 | a small-molecule dataset, not a PDB deposition |
Three of the four small-molecule sets have a published structure to check a run against. These are
reference values from the literature, not results obtained here.
| Dataset | Space group | Cell (A, deg) | T | Reference |
|---|---|---|---|---|
| `dnba` | `C 1 2/c 1` (15) | 20.2635 8.7575 9.6697 / 90 109.941 90 | 30 K | the Zenodo record's own title and the `xia2.html` the depositors ship inside it, corroborated by COD 4510614/4510615 - Cryst. Growth Des. **13** (2013) 1861-1871 [doi:10.1021/cg300906j](https://doi.org/10.1021/cg300906j) |
| `metformin` | `P 1 21/c 1` (14) | 7.9104 13.8794 7.9310 / 90 114.606 90 | 100 K | the hydrochloride, form I; COD 2108029 - Acta Cryst. B**73** (2017) 10-22 [doi:10.1107/S2052520616017844](https://doi.org/10.1107/S2052520616017844) |
| `nidppe` | `P 1 21/c 1` (14) | 11.2779 13.3386 15.8739 / 90 98.7953 90 | 150 K | COD 2012031 - Acta Cryst. C**57** (2001) 690-693 [doi:10.1107/S0108270101003961](https://doi.org/10.1107/S0108270101003961) |
`cuhf2` has no confirmed cell. Its space group is published as `P 4/n m m` (Phys. Rev. B **81**,
064422 (2010) [doi:10.1103/PhysRevB.81.064422](https://doi.org/10.1103/PhysRevB.81.064422)) but no
numeric cell was located, so a run on it can be scored on the space group and not on the cell.
## Licences
Each dataset carries the licence of its own deposition, stated on the record page linked
above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's
own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each
record states. None of these data are redistributed with Jungfraujoch; this page only records
where they came from.