Merge docs-extdata: every battery dataset documented, manifests and data pages checked against each other (doc_check.py)
Co-Authored-By: Claude Opus 5.5 <noreply@anthropic.com> Claude-Session: https://claude.ai/code/session_015CeEGgpKdfkCTJb3YNMJcu
This commit is contained in:
leonarski_fandClaude Opus 5.5 committed
commit
60f2ee5462
5 files changed
+313
-63
No files matched your search
+164
-60
@@ -4,7 +4,7 @@ Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeli
|
||||
ever sees its own detectors is not tested. The datasets below were collected by other people,
|
||||
on detectors and in file formats we do not produce ourselves, and are used here to check that
|
||||
`rugnux` reads foreign files correctly and reduces them to sensible results. Most were collected
|
||||
at other facilities, ten on laboratory X-ray sources; a few come from SLS beamlines, where the data are still written by someone
|
||||
at other facilities, eleven on laboratory X-ray sources; a few come from SLS beamlines, where the data are still written by someone
|
||||
else's detector and someone else's acquisition system. Their authors published all of these for
|
||||
exactly this kind of reuse, and this page is where we credit them.
|
||||
|
||||
@@ -18,23 +18,35 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
## Where the values come from
|
||||
|
||||
- **Source** is the repository we downloaded from and that repository's own citable DOI for
|
||||
the archive we took. Every DOI on this page was resolved against DataCite - or, for 6NEN,
|
||||
whose DOI is registered with Crossref, against Crossref - before it was written down, and the identity of each dataset was taken from the repository's record for
|
||||
the archive - not from our directory names.
|
||||
- **Beamline, resolution, space group and cell are the values deposited with the PDB entry**,
|
||||
read from the RCSB data API. They describe the published experiment. They are *not* our
|
||||
reprocessing results; no quantity measured by Jungfraujoch appears on this page.
|
||||
the archive we took. Every DOI on this page was resolved before it was written down - against
|
||||
DataCite, which registers most of them; 6NEN's DOI is registered with Crossref and the five XRDa
|
||||
DOIs with JaLC, and those were resolved through doi.org - and the identity of each dataset was
|
||||
taken from the repository's record for the archive - not from our directory names.
|
||||
- **Beamline, resolution, space group, cell and title are the values deposited with the PDB
|
||||
entry**, read from the RCSB data API; the resolution is the entry's refinement resolution
|
||||
(`resolution_combined`). They describe the published experiment. They are *not* our
|
||||
reprocessing results; no quantity measured by Jungfraujoch appears in the table.
|
||||
- **Detector is read out of the image files themselves** - the NXmx
|
||||
`/entry/instrument/detector/description`, the miniCBF `# Detector:` header, the marCCD
|
||||
instrument header or the SMV key block - which is authoritative where the PDB entry names a
|
||||
different detector.
|
||||
- Anything that could not be established from one of those sources is left blank.
|
||||
- **Every row of the table is a row of the battery's open arm** (`tools/battery/open.json`)
|
||||
unless it is listed under
|
||||
[Datasets in the table that are not in the battery](#datasets-in-the-table-that-are-not-in-the-battery),
|
||||
and every row of the open arm is in the table or under
|
||||
[Datasets with no PDB entry](#datasets-with-no-pdb-entry). The manifest keeps the deposited
|
||||
values at full precision; `tools/battery/doc_check.py` checks that the two agree.
|
||||
|
||||
## Datasets
|
||||
|
||||
| PDB | Source | Facility / beamline | d<sub>min</sub> (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title |
|
||||
|---|---|---|---|---|---|---|---|
|
||||
| [11IF](https://www.rcsb.org/structure/11IF) | IRRMC [10.18430/M311IF](https://doi.org/10.18430/M311IF) | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 |
|
||||
| [2WNN](https://www.rcsb.org/structure/2WNN) | Zenodo [10.5281/zenodo.54568](https://doi.org/10.5281/zenodo.54568) | Diamond I03 | 1.65 | P 1 21 1 | 54.7 142.5 83.6 90.0 109.2 90.0 | SMV, S/N 920 | Structure of wild type E. coli N-acetylneuraminic acid lyase in complex with pyruvate in space group P21 |
|
||||
| [2WNQ](https://www.rcsb.org/structure/2WNQ) | Zenodo [10.5281/zenodo.54568](https://doi.org/10.5281/zenodo.54568) | Diamond I04 | 1.80 | P 1 21 1 | 54.6 142.8 84.5 90.0 109.0 90.0 | SMV, S/N 921 | Structure of the E192N mutant of E. coli N-acetylneuraminic acid lyase in space group P21 |
|
||||
| [2WNZ](https://www.rcsb.org/structure/2WNZ) | Zenodo [10.5281/zenodo.54568](https://doi.org/10.5281/zenodo.54568) | Diamond I02 | 1.85 | P 1 21 1 | 56.9 143.0 83.9 90.0 109.8 90.0 | SMV, S/N 922 | Structure of the E192N mutant of E. coli N-acetylneuraminic acid lyase in complex with pyruvate in space group P21 crystal form I |
|
||||
| [2XFW](https://www.rcsb.org/structure/2XFW) | Zenodo [10.5281/zenodo.54568](https://doi.org/10.5281/zenodo.54568) | Diamond I02 | 1.65 | P 1 21 1 | 78.1 116.5 83.7 90.0 118.0 90.0 | SMV, S/N 922 | Structure of the E192N mutant of E. coli N-acetylneuraminic acid lyase in complex with pyruvate in crystal form III |
|
||||
| [36GK](https://www.rcsb.org/structure/36GK) | IRRMC [10.18430/M336GK](https://doi.org/10.18430/M336GK) | CLSI 08ID-1 | 2.28 | I 2 2 2 | 120.6 189.5 199.7 90.0 90.0 90.0 | Dectris Eiger 9M | D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain |
|
||||
| [3INP](https://www.rcsb.org/structure/3INP) | IRRMC [10.18430/m33inp](https://doi.org/10.18430/m33inp) | APS 21-ID-F | 2.05 | F 41 3 2 | 224.1 224.1 224.1 90.0 90.0 90.0 | marCCD, 225 mm plate | 2.05 Angstrom Resolution Crystal Structure of D-ribulose-phosphate 3-epimerase from Francisella tularensis. |
|
||||
| [3KY7](https://www.rcsb.org/structure/3KY7) | IRRMC [10.18430/m33ky7](https://doi.org/10.18430/m33ky7) | APS 21-ID-G | 2.35 | P 43 3 2 | 125.2 125.2 125.2 90.0 90.0 90.0 | marCCD, 300 mm plate | 2.35 Angstrom resolution crystal structure of a putative tRNA (guanine-7-)-methyltransferase (trmD) from Staphylococcus aureus subsp. aureus MRSA252 |
|
||||
@@ -42,6 +54,7 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
| [3MEB](https://www.rcsb.org/structure/3MEB) | IRRMC [10.18430/M33MEB](https://doi.org/10.18430/M33MEB) | Home source, Rigaku MicroMax-007 HF | 1.90 | P 1 21 1 | 58.6 101.2 81.5 90.0 90.6 90.0 | Rigaku Saturn 944 | Structure of cytoplasmic aspartate aminotransferase from giardia lamblia |
|
||||
| [3P85](https://www.rcsb.org/structure/3P85) | IRRMC [10.18430/M33P85](https://doi.org/10.18430/M33P85) | Home source, Rigaku FR-E+ SuperBright | 1.90 | P 63 2 2 | 127.3 127.3 72.9 90.0 90.0 120.0 | Rigaku Saturn 944+ | Crystal structure enoyl-coa hydratase from mycobacterium avium |
|
||||
| [3R6O](https://www.rcsb.org/structure/3R6O) | IRRMC [10.18430/M33R6O](https://doi.org/10.18430/M33R6O) | Home source, Rigaku FR-E+ SuperBright | 1.95 | I 41 | 90.7 90.7 76.1 90.0 90.0 90.0 | Rigaku Saturn 944+ | Crystal structure of a probable 2-hydroxyhepta-2,4-diene-1, 7-dioateisomerase from Mycobacterium abscessus |
|
||||
| [4BWL](https://www.rcsb.org/structure/4BWL) | Zenodo [10.5281/zenodo.54568](https://doi.org/10.5281/zenodo.54568) | Diamond I02 | 2.00 | P 1 21 1 | 56.0 143.2 83.4 90.0 109.5 90.0 | SMV, S/N 922 | Structure of the Y137A mutant of E. coli N-acetylneuraminic acid lyase in complex with pyruvate, N-acetyl-D-mannosamine and N- acetylneuraminic acid |
|
||||
| [4MTK](https://www.rcsb.org/structure/4MTK) | SBGrid [10.15785/sbgrid/235](https://doi.org/10.15785/sbgrid/235) | SLS X06SA | 3.32 | P 61 | 168.3 168.3 652.8 90.0 90.0 120.0 | PILATUS 6M | Crystal structure of PA0091 VgrG1, the central spike of the Type VI Secretion System |
|
||||
| [4NWV](https://www.rcsb.org/structure/4NWV) | SBGrid [10.15785/sbgrid/9](https://doi.org/10.15785/sbgrid/9) | APS 21-ID-D | 3.25 | I 2 2 2 | 402.2 369.9 410.5 90.0 90.0 90.0 | Rayonix MX-300 | Crystal structure of Orsay virus-like particle |
|
||||
| [4P8R](https://www.rcsb.org/structure/4P8R) | IRRMC [10.18430/m34p8r](https://doi.org/10.18430/m34p8r) | APS 21-ID-F | 2.20 | P 65 2 2 | 86.7 86.7 701.4 90.0 90.0 120.0 | Rayonix MX-225 | Structure of a glycosomal glyceraldehyde 3-phosphate dehydrogenase from Trypanosoma brucei |
|
||||
@@ -51,12 +64,13 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
| [5F6M](https://www.rcsb.org/structure/5F6M) | SBGrid [10.15785/sbgrid/201](https://doi.org/10.15785/sbgrid/201) | SSRL BL11-1 | 1.10 | P 21 21 21 | 54.8 58.5 67.4 90.0 90.0 90.0 | PILATUS 6M | Isotropic Trypsin Model for Comparison of Diffuse Scattering |
|
||||
| [5J23](https://www.rcsb.org/structure/5J23) | IRRMC [10.18430/M35J23](https://doi.org/10.18430/M35J23) | APS 21-ID-G | 2.30 | H 3 | 175.8 175.8 136.8 90.0 90.0 120.0 | Rayonix MX-300 | Crystal structure of NADPH-dependent glyoxylate/hydroxypyruvate reductase SMc04462 (SmGhrB) from Sinorhizobium meliloti in complex with 2'-phospho-ADP-ribose |
|
||||
| [5JK4](https://www.rcsb.org/structure/5JK4) | Zenodo [10.5281/zenodo.49859](https://doi.org/10.5281/zenodo.49859) | ESRF ID14-2 | 1.10 | P 1 21 1 | 37.7 77.9 56.3 90.0 102.1 90.0 | ADSC Quantum 4 | Phosphate-Binding Protein from Stenotrophomonas maltophilia. |
|
||||
| [5JVN](https://www.rcsb.org/structure/5JVN) | IRRMC [10.18430/m35jvn](https://doi.org/10.18430/m35jvn) | ESRF ID29 | 2.90 | P 6 2 2 | 249.4 249.4 84.1 90.0 90.0 120.0 | PILATUS3 6M | C3-type pyruvate phosphate dikinase: intermediate state of the swiveling-domain mechanism |
|
||||
| [5JVN](https://www.rcsb.org/structure/5JVN) | IRRMC [10.18430/m35jvn](https://doi.org/10.18430/m35jvn) | ESRF ID29 | 2.90 | P 6 2 2 | 249.4 249.4 84.1 90.0 90.0 120.0 | PILATUS3 6M | C3-type pyruvate phosphate dikinase: intermediate state of the central domain in the swiveling mechanism |
|
||||
| [5KY6](https://www.rcsb.org/structure/5KY6) | MXRDR [10.18150/repod.1494374](https://doi.org/10.18150/repod.1494374) | BESSY 14.2 | 1.94 | P 1 21 1 | 84.5 57.3 164.0 90.0 102.6 90.0 | marCCD, 225 mm plate | Human muscle fructose-1,6-bisphosphate aldolase |
|
||||
| [5LZL](https://www.rcsb.org/structure/5LZL) | Zenodo [10.5281/zenodo.54757](https://doi.org/10.5281/zenodo.54757) | Diamond I02 | 3.47 | P 31 2 1 | 205.6 205.6 199.2 90.0 90.0 120.0 | PILATUS 6M-F | Pyrobaculum calidifontis 5-aminolaevulinic acid dehydratase |
|
||||
| [5M17](https://www.rcsb.org/structure/5M17) | Zenodo [10.5281/zenodo.4300323](https://doi.org/10.5281/zenodo.4300323) | Diamond I02 | 1.03 | I 4 | 108.6 108.6 67.7 90.0 90.0 90.0 | PILATUS 6M-F | Structure of the GH99 endo-alpha-mannanase from Bacteroides xylanisolvens |
|
||||
| [5M17](https://www.rcsb.org/structure/5M17) | Zenodo [10.5281/zenodo.4300323](https://doi.org/10.5281/zenodo.4300323) | Diamond I02 | 1.03 | I 4 | 108.6 108.6 67.7 90.0 90.0 90.0 | PILATUS 6M-F | Structure of the GH99 endo-alpha-mannanase from Bacteroides xylanisolvens in complex with mannose-alpha-1,3-1,2-dideoxymannose |
|
||||
| [5MLN](https://www.rcsb.org/structure/5MLN) | IRRMC [10.18430/m35mln](https://doi.org/10.18430/m35mln) | ESRF ID23-2 | 1.60 | P 21 2 21 | 74.2 80.4 80.5 90.0 90.0 90.0 | PILATUS3 2M | The crystal structure of alcohol dehydrogenase 10 from Candida magnoliae |
|
||||
| [5NW5](https://www.rcsb.org/structure/5NW5) | SBGrid [10.15785/sbgrid/446](https://doi.org/10.15785/sbgrid/446) | SLS X06DA | 6.50 | P 21 21 21 | 92.1 169.8 390.2 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of the Rif1 N-terminal domain (RIF1-NTD) from Saccharomyces cerevisiae in complex with DNA |
|
||||
| [5OJV](https://www.rcsb.org/structure/5OJV) | SBGrid [10.15785/sbgrid/475](https://doi.org/10.15785/sbgrid/475) | ESRF ID30B | 2.06 | P 21 21 2 | 87.8 158.2 87.6 90.0 90.0 90.0 | PILATUS 6M | Crystal structure of Mycolicibacterium hassiacum glucosylglycerate hydrolase (MhGgH) E419A variant in complex with mannosylglycerate |
|
||||
| [5REO](https://www.rcsb.org/structure/5REO) | Zenodo [10.5281/zenodo.3730956](https://doi.org/10.5281/zenodo.3730956) | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 |
|
||||
| [5SRC](https://www.rcsb.org/structure/5SRC) | IRRMC [10.18430/M35SRC](https://doi.org/10.18430/M35SRC) | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers |
|
||||
| [5T39](https://www.rcsb.org/structure/5T39) | SBGrid [10.15785/sbgrid/356](https://doi.org/10.15785/sbgrid/356) | APS 21-ID-F | 1.10 | P 1 21 1 | 50.2 41.3 58.5 90.0 98.6 90.0 | Rayonix MX-300 | Crystal Structure of the N-terminal domain of EvdMO1 in the presence of SAH and D-fucose |
|
||||
@@ -67,7 +81,7 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
| [6CS9](https://www.rcsb.org/structure/6CS9) | SBGrid [10.15785/SBGRID/568](https://doi.org/10.15785/SBGRID/568) | Australian Synchrotron MX2 | 1.85 | P 1 21 1 | 32.9 25.5 40.2 90.0 98.6 90.0 | ADSC Quantum 210r | Crystal structure of human beta-defensin 2 in complex with PIP2 |
|
||||
| [6F3P](https://www.rcsb.org/structure/6F3P) | IRRMC [10.18430/M36F3P](https://doi.org/10.18430/M36F3P) | APS 22-ID | 1.35 | C 1 2 1 | 142.9 85.7 112.0 90.0 122.2 90.0 | marCCD, 300 mm plate | Crystal structure of S-adenosyl-L-homocysteine hydrolase from Pseudomonas aeruginosa in complex with 3'-deoxyadenosine and K+ cation |
|
||||
| [6FID](https://www.rcsb.org/structure/6FID) | SBGrid [10.15785/sbgrid/541](https://doi.org/10.15785/sbgrid/541) | ESRF ID30B | 2.20 | P 21 21 21 | 59.9 64.1 69.7 90.0 90.0 90.0 | PILATUS3 6M | Bovine trypsin solved by S-SAD on ID30B |
|
||||
| [6FVZ](https://www.rcsb.org/structure/6FVZ) | IRRMC [10.18430/m36fvz](https://doi.org/10.18430/m36fvz) | ESRF ID23-2 | 1.80 | C 2 2 2 | 131.2 222.8 86.5 90.0 90.0 90.0 | PILATUS3 X 2M | Crystal structure of human monoamine oxidase B (MAO B) in complex with an inhibitor |
|
||||
| [6FVZ](https://www.rcsb.org/structure/6FVZ) | IRRMC [10.18430/m36fvz](https://doi.org/10.18430/m36fvz) | ESRF ID23-2 | 1.80 | C 2 2 2 | 131.2 222.8 86.5 90.0 90.0 90.0 | PILATUS3 X 2M | Crystal structure of human monoamine oxidase B (MAO B) in complex with dimethylphenyl-chromone-carboxamide |
|
||||
| [6FWC](https://www.rcsb.org/structure/6FWC) | IRRMC [10.18430/m36fwc](https://doi.org/10.18430/m36fwc) | ESRF MASSIF-3 | 1.70 | C 2 2 2 | 131.7 222.1 86.3 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of human monoamine oxidase B (MAO B) in complex with fluorophenyl-chromone-carboxamide |
|
||||
| [6G1F](https://www.rcsb.org/structure/6G1F) | Zenodo [10.5281/zenodo.1059413](https://doi.org/10.5281/zenodo.1059413) | Diamond I03 | 2.25 | C 1 2 1 | 329.3 83.9 133.4 90.0 111.6 90.0 | PILATUS3 6M | Crystal structure of D-phenylglycine aninotransferase (D-PhgAT) from Pseudomonas stutzeri with PLP internal aldimine |
|
||||
| [6GVK](https://www.rcsb.org/structure/6GVK) | Zenodo [10.5281/zenodo.1286854](https://doi.org/10.5281/zenodo.1286854) | ALBA XALOC | 1.55 | C 1 2 1 | 105.6 59.5 42.4 90.0 113.5 90.0 | PILATUS 6M | Second pair of Fibronectin type III domains of integrin beta4 (T1663R mutant) bound to the bullous pemphigoid antigen BP230 (BPAG1e) |
|
||||
@@ -78,15 +92,17 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
| [6I3J](https://www.rcsb.org/structure/6I3J) | IRRMC [10.18430/m36i3j](https://doi.org/10.18430/m36i3j) | BESSY 14.1 | 2.59 | F 2 2 2 | 134.4 203.8 226.7 90.0 90.0 90.0 | marCCD, 225 mm plate | Bilirubin oxidase from Myrothecium verrucaria in complex with ferricyanide |
|
||||
| [6IU5](https://www.rcsb.org/structure/6IU5) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.25 | P 31 | 84.9 84.9 98.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with zinc ions |
|
||||
| [6IU6](https://www.rcsb.org/structure/6IU6) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.90 | P 31 | 84.7 84.7 97.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with nickel ions |
|
||||
| [6IU8](https://www.rcsb.org/structure/6IU8) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.70 | P 31 | 85.5 85.5 98.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with cobalt |
|
||||
| [6IU8](https://www.rcsb.org/structure/6IU8) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.70 | P 31 | 85.5 85.5 98.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with cobalt ions |
|
||||
| [6IU9](https://www.rcsb.org/structure/6IU9) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 3.00 | P 31 | 85.3 85.3 97.6 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with iron ions |
|
||||
| [6JGH](https://www.rcsb.org/structure/6JGH) | IRRMC [10.18430/m36jgh](https://doi.org/10.18430/m36jgh) | SPring-8 BL44XU | 0.94 | P 21 21 21 | 50.6 62.5 68.2 90.0 90.0 90.0 | marCCD, 300 mm plate | Crystal structure of the F99S/M153T/V163A/T203I variant of GFP at 0.94 A |
|
||||
| [6JGI](https://www.rcsb.org/structure/6JGI) | IRRMC [10.18430/m36jgi](https://doi.org/10.18430/m36jgi) | SPring-8 BL44XU | 0.85 | P 21 21 21 | 50.9 62.4 69.2 90.0 90.0 90.0 | marCCD, 300 mm plate | Crystal structure of the S65T/F99S/M153T/V163A variant of GFP at 0.85 A |
|
||||
| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A |
|
||||
| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.78 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A |
|
||||
| [6MOJ](https://www.rcsb.org/structure/6MOJ) | SBGrid [10.15785/sbgrid/620](https://doi.org/10.15785/sbgrid/620) | ALS 5.0.1 | 2.43 | I 41 2 2 | 130.4 130.4 293.5 90.0 90.0 90.0 | PILATUS3 6M | Dimeric DARPin A_angle_R5 complex with EpoR |
|
||||
| [6NEN](https://www.rcsb.org/structure/6NEN) | UQ eSpace [10.14264/uql.2018.843](https://doi.org/10.14264/uql.2018.843) | Australian Synchrotron MX2 | 2.15 | P 3 1 2 | 105.5 105.5 35.1 90.0 90.0 120.0 | SMV, S/N 928 | Catalytic domain of Proteus mirabilis ScsC |
|
||||
| [6O2H](https://www.rcsb.org/structure/6O2H) | SBGrid [10.15785/sbgrid/747](https://doi.org/10.15785/sbgrid/747) | CHESS F1 | 1.21 | P 1 | 27.4 32.1 34.5 88.7 108.5 111.9 | PILATUS3 6M | Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset |
|
||||
| [6OEL](https://www.rcsb.org/structure/6OEL) | SBGrid [10.15785/sbgrid/652](https://doi.org/10.15785/sbgrid/652) | ALS 8.2.1 | 3.10 | F 41 3 2 | 328.1 328.1 328.1 90.0 90.0 90.0 | SMV, S/N 905 | Engineered Fab bound to IL-4 receptor |
|
||||
| [6OWW](https://www.rcsb.org/structure/6OWW) | Zenodo [10.5281/zenodo.2943248](https://doi.org/10.5281/zenodo.2943248) | ALS 8.3.1 | 3.84 | P 1 21 1 | 85.8 86.0 214.3 90.0 89.9 90.0 | PILATUS3 6M | Crystal structure of a Human Cardiac Calsequestrin Filament Complexed with Ytterbium |
|
||||
| [6P8J](https://www.rcsb.org/structure/6P8J) | SBGrid [10.15785/sbgrid/671](https://doi.org/10.15785/sbgrid/671) | APS 24-ID-E | 1.47 | P 1 21 1 | 46.5 152.2 88.3 90.0 90.1 90.0 | Dectris Eiger 16M | Structure of P. aeruginosa ATCC27853 CdnD D62N/D64N mutant bound to ATP |
|
||||
| [6P8P](https://www.rcsb.org/structure/6P8P) | SBGrid [10.15785/sbgrid/673](https://doi.org/10.15785/sbgrid/673) | APS 24-ID-C | 1.64 | P 4 | 97.5 97.5 60.1 90.0 90.0 90.0 | PILATUS 6M-F | Structure of P. aeruginosa ATCC27853 HORMA1 |
|
||||
| [6PB3](https://www.rcsb.org/structure/6PB3) | SBGrid [10.15785/sbgrid/681](https://doi.org/10.15785/sbgrid/681) | APS 24-ID-E | 2.05 | P 6 | 100.4 100.4 48.9 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of Rhizobiales Trip13 |
|
||||
| [6PXB](https://www.rcsb.org/structure/6PXB) | SBGrid [10.15785/sbgrid/698](https://doi.org/10.15785/sbgrid/698) | APS 24-ID-E | 1.75 | P 32 | 64.0 64.0 119.4 90.0 90.0 120.0 | PILATUS 6M-F | N-Terminal SH2 domain of the p120RasGAP |
|
||||
@@ -122,15 +138,16 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
| [7K1L](https://www.rcsb.org/structure/7K1L) | IRRMC [10.18430/m37k1l](https://doi.org/10.18430/m37k1l) | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate |
|
||||
| [7KCN](https://www.rcsb.org/structure/7KCN) | IRRMC [10.18430/m37kcn](https://doi.org/10.18430/m37kcn) | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins |
|
||||
| [7L6J](https://www.rcsb.org/structure/7L6J) | IRRMC [10.18430/m37l6j](https://doi.org/10.18430/m37l6j) | APS 21-ID-F | 1.78 | I 41 3 2 | 171.7 171.7 171.7 90.0 90.0 90.0 | Rayonix MX-300 | Crystal Structure of the Putative Hydrolase from Stenotrophomonas maltophilia |
|
||||
| [7L84](https://www.rcsb.org/structure/7L84) | SBGrid [10.15785/sbgrid/816](https://doi.org/10.15785/sbgrid/816) | APS 24-ID-C | 1.60 | P 43 21 2 | 79.3 79.3 37.8 90.0 90.0 90.0 | PILATUS 6M-F | Hen Egg White Lysozyme by Native S-SAD at Room Temperature |
|
||||
| [7L84](https://www.rcsb.org/structure/7L84) | SBGrid [10.15785/sbgrid/816](https://doi.org/10.15785/sbgrid/816) | APS 24-ID-C | 1.70 | P 43 21 2 | 79.3 79.3 37.8 90.0 90.0 90.0 | PILATUS 6M-F | Hen Egg White Lysozyme by Native S-SAD at Room Temperature |
|
||||
| [7MZT](https://www.rcsb.org/structure/7MZT) | IRRMC [10.18430/m37mzt](https://doi.org/10.18430/m37mzt) | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A |
|
||||
| [7N0I](https://www.rcsb.org/structure/7N0I) | SBGrid [10.15785/sbgrid/835](https://doi.org/10.15785/sbgrid/835) | ALS 5.0.2 | 2.20 | P 21 21 21 | 75.8 131.6 140.0 90.0 90.0 90.0 | PILATUS3 6M | Structure of the SARS-CoV-2 N protein C-terminal domain bound to single-domain antibody E2 |
|
||||
| [7N2S](https://www.rcsb.org/structure/7N2S) | SBGrid [10.15785/sbgrid/916](https://doi.org/10.15785/sbgrid/916) | SSRL BL12-1 | 2.37 | P 1 21 1 | 83.2 52.8 106.3 90.0 98.3 90.0 | PILATUS 6M | AS3.1-PRPF3-HLA*B27 |
|
||||
| [7ORR](https://www.rcsb.org/structure/7ORR) | IRRMC [10.18430/M37ORR](https://doi.org/10.18430/M37ORR) | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 |
|
||||
| [7OS3](https://www.rcsb.org/structure/7OS3) | MXRDR [10.18150/74YTYQ](https://doi.org/10.18150/74YTYQ) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.18 | P 21 21 21 | 78.2 91.0 105.8 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Rhizobium etli inducible L-asparaginase |
|
||||
| [7OS3](https://www.rcsb.org/structure/7OS3) | MXRDR [10.18150/74YTYQ](https://doi.org/10.18150/74YTYQ) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.18 | P 21 21 21 | 78.2 91.0 105.8 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Rhizobium etli inducible L-asparaginase ReAV solved by S-SAD (orthorhombic form START) |
|
||||
| [7OU1](https://www.rcsb.org/structure/7OU1) | MXRDR [10.18150/VQQIHQ](https://doi.org/10.18150/VQQIHQ) | BESSY 14.3 | 1.65 | P 1 21 1 | 77.9 91.3 114.2 90.0 97.1 90.0 | marCCD, 225 mm plate | Crystal structure of Rhizobium etli inducible L-asparaginase ReAV (monoclinic form MP2) |
|
||||
| [7PH1](https://www.rcsb.org/structure/7PH1) | IRRMC [10.18430/M37PH1](https://doi.org/10.18430/M37PH1) | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid |
|
||||
| [7PQ7](https://www.rcsb.org/structure/7PQ7) | IRRMC [10.18430/M3.IRRMC.6072](https://doi.org/10.18430/M3.IRRMC.6072) | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 |
|
||||
| [7Q6J](https://www.rcsb.org/structure/7Q6J) | Zenodo [10.5281/zenodo.4686876](https://doi.org/10.5281/zenodo.4686876) | PETRA III, DESY P11 | 2.20 | P 21 21 21 | 72.7 115.9 116.2 90.0 90.0 90.0 | PILATUS 6MF | Crystal structure of the human GDAP1 CMT2 mutant-H123R |
|
||||
| [7QIJ](https://www.rcsb.org/structure/7QIJ) | SBGrid [10.15785/sbgrid/907](https://doi.org/10.15785/sbgrid/907) | PETRA III, EMBL c/o DESY P13 (MX1) | 4.10 | P 21 21 21 | 143.5 324.9 369.4 90.0 90.0 90.0 | PILATUS 6M-F | Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY |
|
||||
| [7QIS](https://www.rcsb.org/structure/7QIS) | IRRMC [10.18430/M37QIS](https://doi.org/10.18430/M37QIS) | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX |
|
||||
| [7RAA](https://www.rcsb.org/structure/7RAA) | SBGrid [10.15785/sbgrid/881](https://doi.org/10.15785/sbgrid/881) | SSRL BL12-2 | 2.69 | P 43 21 2 | 66.4 66.4 298.3 90.0 90.0 90.0 | PILATUS 6M | Designed StabIL-2 seq15 |
|
||||
@@ -141,6 +158,7 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
| [7YZX](https://www.rcsb.org/structure/7YZX) | IRRMC [10.18430/M37YZX](https://doi.org/10.18430/M37YZX) | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. |
|
||||
| [8A1A](https://www.rcsb.org/structure/8A1A) | IRRMC [10.18430/M38A1A](https://doi.org/10.18430/M38A1A) | SLS X06SA | 2.05 | P 65 | 191.9 191.9 122.4 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct |
|
||||
| [8AGQ](https://www.rcsb.org/structure/8AGQ) | IRRMC [10.18430/M38AGQ](https://doi.org/10.18430/M38AGQ) | SLS X06DA | 1.09 | C 1 2 1 | 89.9 55.4 54.8 90.0 113.5 90.0 | PILATUS 2MF | Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione |
|
||||
| [8C3E](https://www.rcsb.org/structure/8C3E) | Zenodo [10.5281/zenodo.14555180](https://doi.org/10.5281/zenodo.14555180) | Home source, Rigaku PhotonJet-S | 2.10 | P 31 2 1 | 57.8 57.8 41.5 90.0 90.0 120.0 | CrysAlisPro HPAD, 775 x 800 | Engineered mini-protein LCB2 (blocking ligand of SARS-Cov-2 spike protein) |
|
||||
| [8DQB](https://www.rcsb.org/structure/8DQB) | IRRMC [10.18430/m38dqb](https://doi.org/10.18430/m38dqb) | NSLS-II 19-ID | 2.50 | I 2 3 | 164.1 164.1 164.1 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of 3-dehydroquinate dehydratase I from Klebsiella oxytoca (I23 Form) |
|
||||
| [8DYZ](https://www.rcsb.org/structure/8DYZ) | SBGrid [10.15785/sbgrid/957](https://doi.org/10.15785/sbgrid/957) | CHESS F1 | 1.27 | P 43 21 2 | 79.6 79.6 38.3 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset |
|
||||
| [8DZ7](https://www.rcsb.org/structure/8DZ7) | SBGrid [10.15785/sbgrid/958](https://doi.org/10.15785/sbgrid/958) | CHESS F1 | 1.34 | P 21 21 21 | 30.5 56.4 73.9 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset |
|
||||
@@ -175,10 +193,10 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
| [8YS9](https://www.rcsb.org/structure/8YS9) | IRRMC [10.18430/M38YS9](https://doi.org/10.18430/M38YS9) | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH |
|
||||
| [9B22](https://www.rcsb.org/structure/9B22) | IRRMC [10.18430/m39b22](https://doi.org/10.18430/m39b22) | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) |
|
||||
| [9BN8](https://www.rcsb.org/structure/9BN8) | IRRMC [10.18430/m39bn8](https://doi.org/10.18430/m39bn8) | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 |
|
||||
| [9C18](https://www.rcsb.org/structure/9C18) | Zenodo [10.5281/zenodo.11405662](https://doi.org/10.5281/zenodo.11405662) | NSLS-II 17-ID-1 | 1.90 | P 1 | 41.9 42.0 60.2 84.1 87.2 63.7 | Dectris EIGER1 Si 9M | Human biliverdin IX beta reductase in complex with NADP |
|
||||
| [9C18](https://www.rcsb.org/structure/9C18) | Zenodo [10.5281/zenodo.11405662](https://doi.org/10.5281/zenodo.11405662) | NSLS-II 17-ID-1 | 1.90 | P 1 | 41.9 42.0 60.2 84.1 87.2 63.7 | Dectris EIGER1 Si 9M | Human biliverdin IX beta reductase in complex with NADP in space group P1 |
|
||||
| [9CHW](https://www.rcsb.org/structure/9CHW) | SBGrid [10.15785/sbgrid/1124](https://doi.org/10.15785/sbgrid/1124) | APS 21-ID-F | 2.16 | P 61 | 98.7 98.7 82.1 90.0 90.0 120.0 | Rayonix MX-300 | Crystal structure of human polymerase eta with incoming dAMPnPP nucleotide opposite threofuranosyl thymidine in DNA template |
|
||||
| [9CRW](https://www.rcsb.org/structure/9CRW) | IRRMC [10.18430/m39crw](https://doi.org/10.18430/m39crw) | CLSI 08ID-1 | 2.49 | P 1 21 1 | 84.0 104.6 118.8 90.0 93.4 90.0 | Dectris Eiger 9M | Crystal structure of the Candida albicans kinesin-8 proximal tail domain |
|
||||
| [9E2T](https://www.rcsb.org/structure/9E2T) | SBGrid [10.15785/sbgrid/1148](https://doi.org/10.15785/sbgrid/1148) | SSRL BL12-1 | 2.28 | P 1 | 75.5 78.1 101.2 94.6 103.4 114.5 | Dectris EIGER2 Si 16M | Structure of a de novo designed interleukin-21 mimetic complex |
|
||||
| [9E2T](https://www.rcsb.org/structure/9E2T) | SBGrid [10.15785/sbgrid/1148](https://doi.org/10.15785/sbgrid/1148) | SSRL BL12-1 | 2.28 | P 1 | 75.5 78.1 101.2 94.6 103.4 114.5 | Dectris EIGER2 Si 16M | Structure of a de novo designed interleukin-21 mimetic complex with IL-21R and IL-2Rg |
|
||||
| [9EA5](https://www.rcsb.org/structure/9EA5) | SBGrid [10.15785/sbgrid/1142](https://doi.org/10.15785/sbgrid/1142) | SSRL BL9-2 | 2.00 | P 1 21 1 | 65.9 73.1 98.4 90.0 108.7 90.0 | PILATUS 6M | Structure of Citrobacter BubCD D104A mutant |
|
||||
| [9FCF](https://www.rcsb.org/structure/9FCF) | MXRDR [10.18150/DGZKW3](https://doi.org/10.18150/DGZKW3) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.36 | P 4 | 91.3 91.3 35.8 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with ProFAR |
|
||||
| [9FCG](https://www.rcsb.org/structure/9FCG) | MXRDR [10.18150/LDLSBT](https://doi.org/10.18150/LDLSBT) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.54 | P 4 | 87.8 87.8 35.6 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with PrFAR |
|
||||
@@ -187,7 +205,7 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
| [9GJX](https://www.rcsb.org/structure/9GJX) | IRRMC [10.18430/M39GJX](https://doi.org/10.18430/M39GJX) | Diamond I04 | 2.40 | P 1 21 1 | 76.8 115.8 103.8 90.0 110.3 90.0 | Eiger 16M | Bacillus licheniformis nitroreductase |
|
||||
| [9GQG](https://www.rcsb.org/structure/9GQG) | ESRF [10.15151/ESRF-DC-1900353437](https://doi.org/10.15151/ESRF-DC-1900353437) | ESRF ID30B | 2.00 | P 32 2 1 | 48.2 48.2 188.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | The FK1 domain of FKBP51 in complex with the macrocyclic SAFit analog m5(10,7)-(E)-OH |
|
||||
| [9H0Q](https://www.rcsb.org/structure/9H0Q) | Zenodo [10.5281/zenodo.13912326](https://doi.org/10.5281/zenodo.13912326) | SOLEIL PROXIMA 2 | 2.55 | H 3 2 | 169.5 169.5 344.0 90.0 90.0 120.0 | Dectris EIGER1 Si 9M | N terminal domain of BC2L-C lectin in complex with N-(beta-L-Fucopyranosyl)-biphenyl-3-carboxamide |
|
||||
| [9HNC](https://www.rcsb.org/structure/9HNC) | MXRDR [10.60884/0K7B68](https://doi.org/10.60884/0K7B68) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.88 | P 1 2 1 | 123.8 123.6 187.7 90.0 90.1 90.0 | PILATUS 6M-F | Crystal structure of potassium-independent L-asparaginase |
|
||||
| [9HNC](https://www.rcsb.org/structure/9HNC) | MXRDR [10.60884/0K7B68](https://doi.org/10.60884/0K7B68) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.88 | P 1 2 1 | 123.8 123.6 187.7 90.0 90.1 90.0 | PILATUS 6M-F | Crystal structure of potassium-independent L-asparaginase from Phaseolus vulgaris (PvAIII, PvAspG2) |
|
||||
| [9HS7](https://www.rcsb.org/structure/9HS7) | IRRMC [10.18430/M39HS7](https://doi.org/10.18430/M39HS7) | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER |
|
||||
| [9I0A](https://www.rcsb.org/structure/9I0A) | IRRMC [10.18430/M39I0A](https://doi.org/10.18430/M39I0A) | SOLEIL PROXIMA 1 | 2.22 | P 21 21 2 | 75.2 98.7 208.6 90.0 90.0 90.0 | Dectris Eiger 16M | CARM1 in complex with arg-aDMA analog |
|
||||
| [9I80](https://www.rcsb.org/structure/9I80) | Zenodo [10.5281/zenodo.14844040](https://doi.org/10.5281/zenodo.14844040) | SOLEIL PROXIMA 1 | 1.95 | P 41 | 81.2 81.2 165.0 90.0 90.0 90.0 | Dectris Eiger 16M | LecA in complex with a tolcapone derivative glycomimetic |
|
||||
@@ -204,7 +222,9 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
| [9PBB](https://www.rcsb.org/structure/9PBB) | IRRMC [10.18430/M39PBB](https://doi.org/10.18430/M39PBB) | SSRL BL12-1 | 2.17 | C 1 2 1 | 97.4 45.9 72.2 90.0 105.0 90.0 | Dectris EIGER2 Si 16M | 293K human S-adenosylmethionine decarboxylase |
|
||||
| [9Q41](https://www.rcsb.org/structure/9Q41) | SBGrid [10.15785/sbgrid/1194](https://doi.org/10.15785/sbgrid/1194) | CHESS 7B2 | 1.95 | C 2 2 21 | 118.6 133.7 82.4 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | Crystal Structure of Human Apo Spermidine Synthase |
|
||||
| [9Q66](https://www.rcsb.org/structure/9Q66) | SBGrid [10.15785/sbgrid/1208](https://doi.org/10.15785/sbgrid/1208) | NSLS-II 17-ID-1 | 2.01 | P 1 21 1 | 105.9 67.3 158.0 90.0 99.1 90.0 | Dectris EIGER1 Si 9M | Human prolyl endopeptidase (PREP) - complex with JP-4-1-7 |
|
||||
| [9QW8](https://www.rcsb.org/structure/9QW8) | ESRF [10.15151/ESRF-DC-2127908021](https://doi.org/10.15151/ESRF-DC-2127908021) | ESRF ID23-1 | 1.80 | P 1 | 35.6 35.6 100.9 86.5 84.2 72.5 | Dectris EIGER2 CdTe 16M | FKBP12 in complex with bifunctional ligand 1ad |
|
||||
| [9QVV](https://www.rcsb.org/structure/9QVV) | Zenodo [10.5281/zenodo.19456697](https://doi.org/10.5281/zenodo.19456697) | Diamond I03 | 2.72 | I 2 2 2 | 120.1 123.8 123.8 90.0 90.0 90.0 | Eiger 16M | Crystal structure of the 4CHRD domain of human chordin, mutant designed to abolish binding to sulphated glycosaminoglycans |
|
||||
| [9QW2](https://www.rcsb.org/structure/9QW2) | Keele University [10.21252/yzsx-0e16](https://doi.org/10.21252/yzsx-0e16) | Diamond I03 | 1.92 | P 1 21 1 | 55.4 108.2 55.6 90.0 90.9 90.0 | PILATUS3 6M | Crystal structure of human lung surfactant protein D trimeric fragment with bound synthetic HepII-HepI-PhosI ligand |
|
||||
| [9QW8](https://www.rcsb.org/structure/9QW8) | ESRF [10.15151/ESRF-DC-2127908021](https://doi.org/10.15151/ESRF-DC-2127908021) | ESRF ID23-1 | 1.80 | P 1 | 35.6 35.6 100.9 86.5 84.2 72.5 | Dectris EIGER2 CdTe 16M | FKBP12 in complex with bifunctional ligand 1ad and the first bromodomain of BRD4 |
|
||||
| [9RCI](https://www.rcsb.org/structure/9RCI) | Zenodo [10.5281/zenodo.15615368](https://doi.org/10.5281/zenodo.15615368) | SOLEIL PROXIMA 2 | 1.66 | P 1 | 35.9 39.3 100.9 98.3 90.3 90.1 | Dectris Eiger 9M | Crystal Structure of Flap Endonuclease FEN1 with Compound 28 |
|
||||
| [9RCS](https://www.rcsb.org/structure/9RCS) | XRDa [10.51093/xrd-00383](https://doi.org/10.51093/xrd-00383) | Diamond I24 | 3.01 | P 1 21 1 | 70.0 78.8 82.3 90.0 88.6 90.0 | Eiger 9M | Cardioderma bat coronavirus KY43 receptor binding domain in complex with human CEACAM6 |
|
||||
| [9RP9](https://www.rcsb.org/structure/9RP9) | IRRMC [10.18430/M39RP9](https://doi.org/10.18430/M39RP9) | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex |
|
||||
@@ -217,22 +237,21 @@ This page lists the rotation datasets. The serial (XFEL stills) datasets of the
|
||||
| [9VYB](https://www.rcsb.org/structure/9VYB) | IRRMC [10.18430/M39VYB](https://doi.org/10.18430/M39VYB) | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd |
|
||||
| [9W3Y](https://www.rcsb.org/structure/9W3Y) | IRRMC [10.18430/M39W3Y](https://doi.org/10.18430/M39W3Y) | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) |
|
||||
| [9YL4](https://www.rcsb.org/structure/9YL4) | Zenodo [10.5281/zenodo.17298261](https://doi.org/10.5281/zenodo.17298261) | APS 17-ID | 3.70 | P 21 21 21 | 95.8 111.3 403.0 90.0 90.0 90.0 | PILATUS 6M | Crystal structure of PprA S-F filament from Deinococcus radiodurans |
|
||||
| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA |
|
||||
| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 5.10 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA |
|
||||
| [9Z44](https://www.rcsb.org/structure/9Z44) | IRRMC [10.18430/M39Z44](https://doi.org/10.18430/M39Z44) | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain |
|
||||
| [9Z72](https://www.rcsb.org/structure/9Z72) | SBGrid [10.15785/sbgrid/1239](https://doi.org/10.15785/sbgrid/1239) | SSRL BL9-2 | 2.38 | P 31 2 1 | 59.2 59.2 426.2 90.0 90.0 120.0 | Dectris EIGER2 Si 16M | Structure of V. cholerae CapS (form 1) |
|
||||
| [9ZLO](https://www.rcsb.org/structure/9ZLO) | Zenodo [10.5281/zenodo.18652652](https://doi.org/10.5281/zenodo.18652652) | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE |
|
||||
| [9ZM0](https://www.rcsb.org/structure/9ZM0) | IRRMC [10.18430/M39ZM0](https://doi.org/10.18430/M39ZM0) | NSLS-II 17-ID-1 | 2.10 | P 1 21 1 | 50.4 30.1 91.2 90.0 97.1 90.0 | Dectris EIGER1 Si 9M | Crystal structure of monomeric Atg23 |
|
||||
| [9ZMU](https://www.rcsb.org/structure/9ZMU) | IRRMC [10.18430/M39ZMU](https://doi.org/10.18430/M39ZMU) | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) |
|
||||
|
||||
Seven rows have no PDB code. Six are small-molecule / chemical-crystallography datasets, kept
|
||||
because they exercise short wavelengths, CdTe sensors, fine slicing and non-zero detector
|
||||
2θ; the seventh is the second collection in the 6R72 Zenodo record, described below. They have
|
||||
no deposited macromolecular values, so those columns are blank, and their titles are the
|
||||
repository record titles verbatim.
|
||||
The table holds 201 PDB entries. Six more datasets, small-molecule / chemical-crystallography
|
||||
sets kept because they exercise short wavelengths, CdTe sensors, fine slicing and non-zero
|
||||
detector 2θ, have no PDB entry and are listed [below](#datasets-with-no-pdb-entry).
|
||||
|
||||
Five datasets are in primitive space groups with no screw axis - 6ZQR, 6ZQY,
|
||||
6ZR0 and 9FCF in P 4, and 6NEN in P 3 1 2. They are in the battery as negative controls for
|
||||
screw-axis detection: the correct answer for each has no systematic absences.
|
||||
Twelve datasets are in primitive, non-triclinic space groups with no screw axis - 6P8P, 6ZQR,
|
||||
6ZQY, 6ZR0, 9FCF and 9FCG in P 4, 6PB3 and 9UPT in P 6, 5JVN in P 6 2 2, 6NEN in P 3 1 2, 8SQO in
|
||||
P 4 3 2 and 9HNC in P 1 2 1. They are negative controls for screw-axis detection: the correct
|
||||
answer for each has no systematic absences.
|
||||
|
||||
6Z9G is the collection's only index-4 superstructure: its deposited cell is four times the
|
||||
sublattice a/2, b, c/2, and the four copies of each of its two entities are related by the
|
||||
@@ -254,8 +273,10 @@ contain).
|
||||
**6R72 - two collections on one crystal.** The Zenodo record holds two complete 360° sweeps of
|
||||
3600 × 0.1° frames taken from the same crystal: a helical collection, which produced the
|
||||
deposited structure, and a low-dose collection from a single position, which was not used for a
|
||||
deposition and therefore has no PDB entry. Both are in the table, sharing one DOI; the deposited
|
||||
values belong to the helical collection only. The record also ships the authors' `XDS.INP`.
|
||||
deposition. The battery's `6r72` row runs the **low-dose** collection (`V-CK63-8-ld_1_master.h5`,
|
||||
pinned) and scores it against the deposited space group and cell, which describe the same crystal;
|
||||
the deposited resolution belongs to the helical collection. The helical collection is in the
|
||||
archive but is not a battery row. The record also ships the authors' `XDS.INP`.
|
||||
|
||||
**The three CHESS depositions - wedges plus a measured background.** Each crystal was rotated in
|
||||
50° wedges of 500 × 0.1° frames and translated between wedges to spread the dose. Each crystal
|
||||
@@ -292,7 +313,7 @@ the rest were deleted, so a run over the data directory sees a single collection
|
||||
| 9CRW | a dose pair on one crystal 37 min apart - 0.025 s at 289 mm, 0.010 s at 276 mm | the 0.025 s sweep, whose 2.5 Å target matches the deposited 2.49 Å |
|
||||
| 7RIS | two crystals at two wavelengths - 1.53494 Å (Ho derivative) and 1.03329 Å (the deposited native) | **both** |
|
||||
|
||||
**Eleven further archives hold more than one collection.** Their layout was read from the
|
||||
**Thirteen further archives hold more than one collection.** Their layout was read from the
|
||||
image files and repository listings; one sweep is kept for a run over the data directory unless
|
||||
noted.
|
||||
|
||||
@@ -309,8 +330,10 @@ noted.
|
||||
| 9E2T | one continuous sweep plus screening images | the 2700-frame sweep |
|
||||
| 8OWM | three MXRDR zips covering one 1800-frame sweep, plus a processed-data zip | the three sweep zips (proc zip skipped) |
|
||||
| 7D98 | one 250 × 0.5° miniCBF sweep (frames 11-260), plus four HDF5 masters that repeat frames 61-260 in 60-frame pieces | the miniCBF sweep; the HDF5 files stay beside it and the row is pinned |
|
||||
| 6H2P | two sweeps of one crystal, 1800 × 0.1° at 0.918 Å and 3600 × 0.1° at 1.893 Å (the Mn K edge) | **both**, as two battery rows, `6h2p_native` and `6h2p_1p89A`; the long-wavelength row has no deposited resolution to compare with |
|
||||
| 8C3E | four 0.5° ω scans of one crystal at different (φ, χ) settings, 56, 150, 150 and 50 frames (`lcb2_8_newt_001` to `_004`) | the 150-frame `_003` scan |
|
||||
|
||||
**Three archives needed special handling to obtain the images.**
|
||||
**Four archives needed special handling to obtain the images.**
|
||||
|
||||
- **5KY6** is served by MXRDR as 11 separate RAR archives, one folder of frames per archive, 50
|
||||
frames per archive except the last, 564 frames in all. Reading them needs a RAR reader with
|
||||
@@ -320,6 +343,9 @@ noted.
|
||||
downloaded by hand in a browser.
|
||||
- **4P8R**'s IRRMC tar holds one 800 × 0.2° sweep as per-frame `.bz2` files, which rugnux does
|
||||
not read; they were decompressed with `bunzip2` after extraction.
|
||||
- **2WNN, 2WNQ, 2WNZ, 2XFW and 4BWL** are each served by the Zenodo record as two zips of 180
|
||||
frames (`<pdb>-images-1-180.zip`, `<pdb>-images-181-360.zip`, or `2wnq-181-360.zip`); both were
|
||||
extracted into one directory, which holds the one 360 × 0.5° sweep.
|
||||
|
||||
## Datasets published as Raw Data Letters
|
||||
|
||||
@@ -342,6 +368,57 @@ The authors of the second letter also published their own reciprocal-space recon
|
||||
6RLR data as a separate Zenodo record,
|
||||
[10.5281/zenodo.6961763](https://doi.org/10.5281/zenodo.6961763).
|
||||
|
||||
## Twinned and pseudo-symmetric datasets
|
||||
|
||||
The rows below are twinned, or have a lattice metrically close to a higher symmetry than the
|
||||
crystal's - the case where a data-reduction program is most easily led into the wrong point group.
|
||||
What is said here is read from the depositions and their cells, except where a sentence says
|
||||
otherwise; where the battery keeps further evidence for a row, it is in
|
||||
`tools/battery/symmetry/<id>/`.
|
||||
|
||||
**The pathological-data series.** 2WNN, 2WNQ, 2WNZ, 2XFW and 4BWL come from one Zenodo record,
|
||||
"A series of pathological macromolecular crystallography datasets with twinning and other lattice
|
||||
disorders" ([10.5281/zenodo.54568](https://doi.org/10.5281/zenodo.54568)), which was published
|
||||
for testing data-processing and refinement programs and is described in I. Campeotto, A. Lebedev,
|
||||
A. M. M. Schreurs, L. M. J. Kroon-Batenburg, E. Lowe, S. E. V. Phillips, G. N. Murshudov and
|
||||
A. R. Pearson, "Pathological macromolecular crystallographic data affected by twinning,
|
||||
partial-disorder and exhibiting multiple lattices for testing of data processing and refinement
|
||||
tools" (2018), Sci. Rep. 8, 14876
|
||||
[doi:10.1038/s41598-018-32962-6](https://doi.org/10.1038/s41598-018-32962-6). All five are
|
||||
deposited in P 1 21 1 with c cos β ≈ -a/2, so the lattice is metrically C-centred orthorhombic,
|
||||
and the twin law four of them declare, -h,-k,h+l, is the two-fold that orthorhombic lattice adds:
|
||||
|
||||
| PDB | Deposited twin fraction of -h,-k,h+l |
|
||||
|---|---|
|
||||
| 4BWL | 0.488 |
|
||||
| 2WNQ | 0.463 |
|
||||
| 2WNN | 0.334 |
|
||||
| 2XFW | 0.096 |
|
||||
| 2WNZ | none declared |
|
||||
|
||||
At a fraction near 0.5 the intensities have the symmetry of C 2 2 2<sub>1</sub>, so these rows
|
||||
test whether a twinned P 2<sub>1</sub> crystal is reported as C 2 2 2<sub>1</sub>. For 4BWL and
|
||||
2WNQ, refining the deposited model in each candidate group keeps P 2<sub>1</sub>, and no
|
||||
C 2 2 2<sub>1</sub> operator maps the deposited chains onto each other; neither row accepts
|
||||
C 2 2 2<sub>1</sub> as an alternative.
|
||||
|
||||
**8C3E** is a home-source dataset deposited in P 3<sub>1</sub> 2 1 with no twin law declared,
|
||||
whose intensities, the depositor's included, read Laue class 6/mmm in POINTLESS: the operator that makes
|
||||
6/mmm out of -3m1 is a merohedral twin law of P 3<sub>1</sub> 2 1, and refining the deposited
|
||||
model keeps P 3<sub>1</sub> 2 1. The 75° scan also leaves the screw along c open; a run that
|
||||
names that axis as undetermined and offers the deposited group among its alternatives scores the
|
||||
row `unscored` (`screw_undetermined`, see `tools/battery/README.md`) rather than failed.
|
||||
|
||||
**3MC4 and 3R6O** carry a `reference_mismatch` note in the manifest: the uploaded frames are of a
|
||||
crystal twinned about 30% (law k,h,-l, seen also by XDS on the same frames), while the deposited
|
||||
data are of an untwinned crystal of the same form. The row is scored as usual; the note tells the
|
||||
reader of a report that the merged statistics are not expected to match the deposition's.
|
||||
|
||||
**Pseudo-symmetric cells.** 6OWW (P 1 21 1, a ≈ b, β = 89.9°), 6P8J (P 1 21 1, β = 90.1°),
|
||||
9QW2 (P 1 21 1, a ≈ c, β = 90.9°), 5OJV (P 21 21 2, a ≈ c), 7Q6J (P 21 21 21, b ≈ c) and 9QVV
|
||||
(I 2 2 2, b ≈ c) all have a deposited cell within a fraction of a degree or of an ångström of a
|
||||
higher lattice symmetry. 6OWW is one of the rows that accept an alternative answer, below.
|
||||
|
||||
## Detector column for marCCD and SMV files
|
||||
|
||||
marCCD and SMV files name the detector differently - or not at all. A marCCD file names no model:
|
||||
@@ -354,16 +431,20 @@ Detector column carries what the file itself establishes: the plate size (`marCC
|
||||
plate`), the comment's name where one is present (`Rayonix MX-300`), or the serial (`SMV, S/N
|
||||
930`).
|
||||
|
||||
8C3E's files are CBF written by CrysAlisPro's HPAD export, whose header gives the image size
|
||||
(`# Detector: 775 x 800`) and no model; its row carries that (`CrysAlisPro HPAD, 775 x 800`).
|
||||
The PDB entry names the detector as a Rigaku HyPix-6000HE.
|
||||
|
||||
## Deposited models and structure factors
|
||||
|
||||
184 of the 191 datasets have a released PDB entry, and RCSB
|
||||
reports released structure factors (`status_code_sf = REL`) for every one of them. A merged
|
||||
All 201 PDB entries in the table are released, and RCSB reports released structure factors
|
||||
(`status_code_sf = REL`) for every one of them; the six small-molecule datasets have none. A merged
|
||||
result from this pipeline can therefore be checked against the deposited model or against the
|
||||
deposited intensities.
|
||||
|
||||
## Rows where our reduction and the deposition disagree
|
||||
|
||||
Six of the 181 rows are ones where `rugnux` does not reproduce the deposited space group or
|
||||
Seven of the battery's rows are ones where `rugnux` does not reproduce the deposited space group or
|
||||
cell, and where we have looked at the disagreement closely enough to change how the row is
|
||||
scored. They are collected here because a scoring row that silently disagrees with a published
|
||||
entry is not something a reader should have to discover from the code.
|
||||
@@ -383,7 +464,7 @@ How the manifest records it, in `tools/battery/open.json`:
|
||||
fields it names - a space group, a cell, or both - and the row passes if our answer matches any
|
||||
of the references, the deposited one included. Each must carry `why`; an alternative with no
|
||||
stated reason is a schema error, not a silent pass, so the mechanism cannot become a way to
|
||||
turn a failure into a pass quietly. This is how the five knife-edge rows below are recorded:
|
||||
turn a failure into a pass quietly. This is how the six knife-edge rows below are recorded:
|
||||
we are not asserting that our answer is right, only that both descriptions are defensible and
|
||||
that picking either one is acceptable. The report counts these rows separately from ordinary
|
||||
passes and prints the reason, so a reader can see how many there are and judge each.
|
||||
@@ -395,7 +476,7 @@ How the manifest records it, in `tools/battery/open.json`:
|
||||
|
||||
### 8XBP is a question about provenance, not about symmetry
|
||||
|
||||
8XBP is different in kind from the other five and should not be read alongside them. Nothing
|
||||
8XBP is different in kind from the other six and should not be read alongside them. Nothing
|
||||
here concerns the deposited model or its space group. The question is whether the raw images
|
||||
uploaded with the entry are the same crystal the deposited cell describes: the master file
|
||||
records `data_collection_date` 2023-06-21 where the entry records a collection date of
|
||||
@@ -452,7 +533,8 @@ Whether this crystal is partially twinned or purely pseudo-symmetric has not bee
|
||||
Here the better-supported answer is the deposited one, which is the opposite of 8XTE: the two
|
||||
rows look alike in the table and are not alike in the evidence. Both answers are accepted.
|
||||
|
||||
**6PXB.** Unscored rather than overridden, because the evidence does not settle either way. Our
|
||||
**6PXB.** Both answers accepted rather than overridden, because the evidence does not settle
|
||||
either way. Our
|
||||
merge and POINTLESS both read a 312 point group, the added two-folds correlate at or above the
|
||||
level of the three-folds nobody disputes, and merging in the higher group *lowers*
|
||||
R<sub>meas</sub> at twice the multiplicity. Against that, the deposited asymmetric unit's six
|
||||
@@ -463,7 +545,7 @@ accepted and the row still tests everything else about the set.
|
||||
|
||||
### 9RCI: two defensible descriptions of one lattice
|
||||
|
||||
The sixth row is not about symmetry but about which cell describes the crystal. The Patterson
|
||||
This row is not about symmetry but about which cell describes the crystal. The Patterson
|
||||
has an off-origin peak at 62.5% of the origin, so a genuine translational NCS relates the two
|
||||
halves of the cell `rugnux` reports, and the deposited cell is that supercell's
|
||||
(0, 1/2, 1/2)-centred sublattice to 0.17%. Both are correct descriptions of the same diffraction:
|
||||
@@ -473,7 +555,20 @@ not a measurement, so the row accepts either. The alternative cell recorded in t
|
||||
computed from the deposited cell alone (c' = b + 2c, centring removed), not copied from our
|
||||
output, so it stays a statement about the deposition's lattice.
|
||||
|
||||
### The limit that applies to all four symmetry rows
|
||||
### 6OWW: a monoclinic deposition whose intensities read tetragonal
|
||||
|
||||
6OWW is deposited in P 1 2<sub>1</sub> 1 with eight chains, on a cell with a ≈ b and β = 89.9°.
|
||||
The deposited model nearly obeys the added operators: a four-fold to 0.13-0.16 Å and a two-fold
|
||||
to 0.10 Å, and its |F<sub>c</sub>|<sup>2</sup> correlate across the added 422 operators at
|
||||
0.97-1.00. POINTLESS reads Laue class 4/mmm both on our observations and on the depositor's
|
||||
amplitudes, and ZANUDA, refining the deposited model in each candidate group, prefers
|
||||
P 4<sub>3</sub> 2<sub>1</sub> 2 to P 2<sub>1</sub> on our data and on the depositor's, with lower
|
||||
R-free each time. The row accepts P 4<sub>1</sub> 2<sub>1</sub> 2 (the enantiomorph pair is
|
||||
counted as one by the scorer) beside the deposited group. As with the trigonal and tetragonal rows
|
||||
above, an exact pseudo-symmetry would explain the same observations, so this is an accepted
|
||||
alternative and not a statement that the deposition is wrong.
|
||||
|
||||
### The limit that applies to all five symmetry rows
|
||||
|
||||
A merohedral twin at a twin fraction of exactly 0.5 and a crystal that genuinely has the higher
|
||||
symmetry predict **identical** intensities. No amount of data and no refinement R separates them,
|
||||
@@ -484,11 +579,19 @@ and completeness; where it is a pseudo-symmetry that close, merging in it costs
|
||||
measurable either. That is why these rows are described as open questions, and why none of them
|
||||
should be read as a statement that a deposited model is wrong.
|
||||
|
||||
## Dataset directories whose name is not the PDB code
|
||||
## Battery rows whose id is not the PDB code
|
||||
|
||||
| Directory | PDB code in the table | Why |
|
||||
| Battery id | PDB code in the table | Why |
|
||||
|---|---|---|
|
||||
| `7brr` | 7D1M | The IRRMC archive and its DOI are published under 7BRR, which the PDB obsoleted on 2020-10-28 and replaced with 7D1M. The directory and the DOI keep the archive's own name; the deposited values are 7D1M's. |
|
||||
| `7brr` | 7D1M | The IRRMC archive and its DOI are published under 7BRR, which the PDB obsoleted on 2020-10-28 and replaced with 7D1M. The battery id, the directory and the DOI keep the archive's own name; the deposited values are 7D1M's. |
|
||||
| `6h2p_native` | 6H2P | the 0.918 Å sweep of the 6H2P archive, which the deposition's resolution belongs to |
|
||||
| `6h2p_1p89A` | 6H2P | the 1.893 Å sweep of the same crystal; scored on the deposited space group and cell only |
|
||||
|
||||
## Datasets in the table that are not in the battery
|
||||
|
||||
| PDB | Why |
|
||||
|---|---|
|
||||
| 9VX7 | The uploaded sweep does not index in the deposited cell, with `rugnux` or with DIALS or XDS given that cell, while XDS indexes it de novo in a different cell; the deposited values cannot be scored against these images, so the row is not in the battery. |
|
||||
|
||||
## An archive that ships placeholder images
|
||||
|
||||
@@ -500,7 +603,6 @@ reader that globs `*.img` will pick them up, so they are named here rather than
|
||||
|
||||
| Dataset | Repository record | Why there is no PDB code |
|
||||
|---|---|---|
|
||||
| `6r72/ld` | Zenodo record 10.5281/zenodo.14894181, file prefix `V-CK63-8-ld_1_` | a second collection in the 6R72 record - a low-dose sweep on the same crystal, not the one the deposited structure was built from |
|
||||
| `cuhf2` | Zenodo record 10.5281/zenodo.6347466 | a small-molecule dataset, not a PDB deposition |
|
||||
| `dnba` | Zenodo record 10.5281/zenodo.1036416 | a small-molecule dataset, not a PDB deposition |
|
||||
| `metformin` | Zenodo record 10.5281/zenodo.20135265 | a small-molecule dataset, not a PDB deposition |
|
||||
@@ -530,24 +632,26 @@ symmetries rather than to be easy to process. The counts below describe where it
|
||||
like everything else on this page, they are metadata about the depositions and their files, not
|
||||
measurements.
|
||||
|
||||
- **Repository:** IRRMC 95, SBGrid 38, Zenodo 34, MXRDR 16, Keele University 4, ESRF 3, XRDa 5,
|
||||
UQ eSpace 1.
|
||||
- **Repository**, over the 207 datasets on this page (the 201 rows of the table and the six
|
||||
small-molecule sets): IRRMC 95, Zenodo 42, SBGrid 40, MXRDR 16, Keele University 5, XRDa 5,
|
||||
ESRF 3, UQ eSpace 1.
|
||||
- **Facility** - counted from the facility part of the Facility / beamline column, the beamline
|
||||
ignored so that entries deposited with and without one count the same, over the 185 rows that
|
||||
name one: APS 28, Diamond 20, ESRF 17, NSLS-II 14, BESSY 12, PETRA III 12, SSRL 11, ALS 8,
|
||||
SLS 8, SPring-8 8, SOLEIL 7, SSRF 7, PAL/PLS 5, CHESS 4, CLSI 4, ALBA 3, Australian
|
||||
Synchrotron 3, ELETTRA 2, LNLS 2, MAX IV 2, NSLS 2, Photon Factory 2, and one each from NSRRC,
|
||||
RRCAT Indus-2, SRS Daresbury and EMBL/DESY Hamburg (DORIS) - 26 facilities. The other ten rows were collected on laboratory sources: nine on
|
||||
rotating anodes and one on a liquid-metal jet.
|
||||
- **Crystal system, from the deposited space group of the 189 PDB-coded rows:** orthorhombic 47,
|
||||
monoclinic 44, tetragonal 31, trigonal 21, hexagonal 20, cubic 13, triclinic 13.
|
||||
- **Pink beam:** none of these datasets was collected with pink beam. All 189 PDB-coded rows
|
||||
are deposited as `SINGLE WAVELENGTH` (`_diffrn_radiation.pdbx_diffrn_protocol`), and all
|
||||
but 5REO, which leaves the field blank, as monochromatic (`pdbx_monochromatic_or_laue_m_l`
|
||||
`M`); 9Q41 is the one row recorded with a multilayer rather than a crystal monochromator
|
||||
(CHESS Rh/B4C). The battery's pink-beam data are in-house SLS measurements (tag `pink-beam`
|
||||
in `tools/battery/inhouse.json`), not on this page.
|
||||
- **Long cell axes:** sixteen PDB-coded rows have a deposited cell axis longer than 320 Å - 4P8R,
|
||||
ignored so that entries deposited with and without one count the same, over the 190 rows that
|
||||
name one: APS 29, Diamond 21, ESRF 19, NSLS-II 14, PETRA III 13, BESSY 12, SSRL 11, ALS 9,
|
||||
SLS 8, SPring-8 8, SOLEIL 7, SSRF 7, PAL/PLS 5, CHESS 4, ALBA 3, Australian Synchrotron 3,
|
||||
CLSI 3, ELETTRA 2, LNLS 2, MAX IV 2, NSLS 2, Photon Factory 2, and one each from NSRRC,
|
||||
RRCAT Indus-2, SRS Daresbury and EMBL/DESY Hamburg (DORIS) - 26 facilities. The other eleven
|
||||
rows were collected on laboratory sources: nine on rotating anodes, one on a liquid-metal jet
|
||||
and one on a sealed tube.
|
||||
- **Crystal system, from the deposited space group of the 201 rows:** monoclinic 53,
|
||||
orthorhombic 50, tetragonal 30, trigonal 22, hexagonal 20, cubic 13, triclinic 13.
|
||||
- **Pink beam:** none of these datasets was collected with pink beam. All 201 rows are deposited
|
||||
as `SINGLE WAVELENGTH` (`_diffrn_radiation.pdbx_diffrn_protocol`), and all but 5REO, which
|
||||
leaves the field blank, as monochromatic (`pdbx_monochromatic_or_laue_m_l` `M`); 9Q41 is the
|
||||
one row recorded with a multilayer rather than a crystal monochromator (CHESS Rh/B4C). The
|
||||
battery's pink-beam data are in-house SLS measurements (tag `pink-beam` in
|
||||
`tools/battery/inhouse.json`), not on this page.
|
||||
- **Long cell axes:** sixteen rows have a deposited cell axis longer than 320 Å - 4P8R,
|
||||
4MTK, 7D98, 8V4O, 9ZMU, 9V16, 9Z72, 4NWV, 9YL4, 5NW5, 6QAJ, 7QIJ, 8T7R, 9H0Q, 6G1F and 6OEL.
|
||||
|
||||
The marCCD, SMV and gzip-compressed miniCBF datasets are the reason rugnux reads those formats
|
||||
|
||||
@@ -33,6 +33,10 @@ the paper of the entry.
|
||||
| `alvra103`, `alvra103_int16` | [103](https://cxidb.org/id-103.html), [10.11577/1650020](https://doi.org/10.11577/1650020) | SwissFEL Alvra | JUNGFRAU 16M, 75 µm; SwissFEL HDF5, float32 keV (converted) | [6S0L](https://www.rcsb.org/structure/6S0L) | C 2 2 21, 2.65 | Nass et al., IUCrJ (2020) |
|
||||
| `alvra213`, `alvra213_int16` | [213](https://cxidb.org/id-213.html), [10.11577/2282689](https://doi.org/10.11577/2282689) | SwissFEL Alvra | JUNGFRAU 4M, 75 µm; SwissFEL HDF5, float32 keV (converted) | [8BKH](https://www.rcsb.org/structure/8BKH) (dark state) | P 1 21 1, 1.35 | Barends et al., Nature (2024) |
|
||||
|
||||
Every set of the manifest is in the table and every set in the table is in the manifest, with the
|
||||
same CXIDB entry, PDB entry, space group and d<sub>min</sub>; `tools/battery/doc_check.py` checks
|
||||
this. The beamline of `pal90` is the CXIDB entry's (NCI); the PDB entry 6IRK records CSI.
|
||||
|
||||
## The files we use
|
||||
|
||||
Paths are relative to the still data root of the site config (`tools/battery/README.md`). CXIDB
|
||||
|
||||
@@ -12,7 +12,11 @@ machine: the protocol, the REFMAC check, the timing benchmark, how to take timin
|
||||
what to send back.
|
||||
|
||||
`test_score.py` covers the scoring rules that decide a verdict (stdlib `unittest`, no data and no
|
||||
run needed): `cd tools/battery && python3 test_score.py`.
|
||||
run needed): `cd tools/battery && python3 test_score.py`. `doc_check.py` checks the manifests
|
||||
against the pages that document their datasets - `open.json` against
|
||||
[External test data](../../docs/EXTERNAL_TEST_DATA.md), `still_manifest.json` against its stills
|
||||
page, `inhouse.json` against the Arms table below - and exits non-zero on a mismatch (stdlib, no
|
||||
data): `cd tools/battery && python3 doc_check.py`.
|
||||
|
||||
## Arms
|
||||
|
||||
@@ -832,7 +836,8 @@ whole range; the manifest keeps the rule used as `dmin_rule`.
|
||||
(the largest sweep, chosen by frame count), and with `--refresh` it shows where discovery now
|
||||
disagrees with an unpinned manifest input. Add the row to `open.json` with the deposited
|
||||
reference (`sg`, `sgno`, `cell`, `dmin`) and tags. Set `"pinned": true` when the choice between
|
||||
sweeps was deliberate. Record the source and DOI in `docs/EXTERNAL_TEST_DATA.md`.
|
||||
sweeps was deliberate. Record the source and DOI in `docs/EXTERNAL_TEST_DATA.md`, then run
|
||||
`python3 doc_check.py`, which fails until the page and the manifests agree (below).
|
||||
A set whose frames are not the crystal the deposited data came from (checked independently,
|
||||
e.g. with XDS on the same frames) gets `"reference_mismatch": "<why>"`. It is an annotation only:
|
||||
every check still runs and every number still counts; the report prints the note beside the set's
|
||||
|
||||
@@ -0,0 +1,137 @@
|
||||
#!/usr/bin/env python3
|
||||
"""doc_check.py -- the battery manifests against the pages that document their datasets.
|
||||
|
||||
open.json <-> docs/EXTERNAL_TEST_DATA.md
|
||||
still_manifest.json <-> docs/EXTERNAL_TEST_DATA_STILLS.md
|
||||
inhouse.json <-> the inhouse row of the Arms table in tools/battery/README.md
|
||||
|
||||
Open arm: every manifest row is a row of the page's Datasets table (through the "Battery rows
|
||||
whose id is not the PDB code" table where the id is not the PDB code) or of "Datasets with no PDB
|
||||
entry"; every Datasets row is in the manifest or under "Datasets in the table that are not in the
|
||||
battery"; space group, cell (to the page's 0.1 A / 0.1 deg) and d_min (to 0.01 A) agree; the
|
||||
stated row count and the per-repository counts are the table's. Still battery: every set is in
|
||||
the page's table with its CXIDB entry, PDB entry, space group and d_min, and every set the page
|
||||
names is in the manifest. In-house: each set's specimen is named in the README.
|
||||
|
||||
python3 doc_check.py (exit status 1 on any mismatch; stdlib only, no data needed)
|
||||
"""
|
||||
import collections
|
||||
import json
|
||||
import os
|
||||
import re
|
||||
import sys
|
||||
|
||||
HERE = os.path.dirname(os.path.abspath(__file__))
|
||||
DOCS = os.path.join(HERE, "..", "..", "docs")
|
||||
# in-house id prefix -> the name the README's Arms table gives the specimen
|
||||
INHOUSE = {"lyso": "lysozyme", "lysoI": "lysozyme", "thau": "thaumatin", "insu": "insulin",
|
||||
"cytc": "cytochrome C", "myob": "myoglobin", "nothing": "no-crystal controls",
|
||||
"aspirin": "aspirin", "citricacid": "citric acid", "hepes": "HEPES", "yag": "YAG",
|
||||
"kdp": "KDP", "lcystine": "L-cystine"}
|
||||
|
||||
errors = []
|
||||
|
||||
|
||||
def section(text, heading):
|
||||
"""The body of a '## heading' section, up to the next '## '."""
|
||||
body = text.split("\n## " + heading + "\n", 1)[1]
|
||||
return body.split("\n## ", 1)[0]
|
||||
|
||||
|
||||
def table(body, n=0):
|
||||
"""Rows of the n-th Markdown table in body, as lists of stripped cells."""
|
||||
blocks = re.findall(r"(?:^\|.*\n?)+", body, re.M)
|
||||
rows = blocks[n].splitlines()[2:]
|
||||
return [[c.strip() for c in r.strip("|").split(" | ")] for r in rows]
|
||||
|
||||
|
||||
def check_open():
|
||||
sets = {s["id"]: s for s in json.load(open(os.path.join(HERE, "open.json")))["sets"]}
|
||||
text = open(os.path.join(DOCS, "EXTERNAL_TEST_DATA.md")).read()
|
||||
rows = {re.match(r"\[(\w{4})\]", r[0]).group(1): r for r in table(section(text, "Datasets"))}
|
||||
renamed = {r[0].strip("`"): r[1] for r in table(section(text, "Battery rows whose id is not the PDB code"))}
|
||||
absent = {r[0] for r in table(section(text, "Datasets in the table that are not in the battery"))}
|
||||
no_pdb = {r[0].strip("`"): r for r in table(section(text, "Datasets with no PDB entry"))}
|
||||
small = {r[0].strip("`"): r for r in table(section(text, "Datasets with no PDB entry"), 1)}
|
||||
|
||||
used = set()
|
||||
for sid, s in sets.items():
|
||||
if sid in no_pdb:
|
||||
ref, row = s.get("ref"), small.get(sid)
|
||||
if ref and row and (row[1].split("`")[1] != ref["sg"] or not same_cell(row[2].replace("/", " "), ref["cell"], 0.0005)):
|
||||
errors.append(f"open {sid}: space group or cell differ from the small-molecule table")
|
||||
continue
|
||||
pdb = renamed.get(sid, sid.upper())
|
||||
row = rows.get(pdb)
|
||||
if row is None:
|
||||
errors.append(f"open {sid}: not on EXTERNAL_TEST_DATA.md")
|
||||
continue
|
||||
used.add(pdb)
|
||||
ref = s["ref"]
|
||||
if row[4] != ref["sg"]:
|
||||
errors.append(f"open {sid}: space group {row[4]!r} on the page, {ref['sg']!r} in the manifest")
|
||||
if not same_cell(row[5], ref["cell"], 0.051):
|
||||
errors.append(f"open {sid}: cell {row[5]} on the page, {ref['cell']} in the manifest")
|
||||
if ref["dmin"] is not None and abs(float(row[3]) - ref["dmin"]) > 0.0051:
|
||||
errors.append(f"open {sid}: d_min {row[3]} on the page, {ref['dmin']} in the manifest")
|
||||
for pdb in sorted(set(rows) - used - absent):
|
||||
errors.append(f"open {pdb}: on the page but not in open.json, nor listed as not in the battery")
|
||||
for pdb in sorted(absent & used):
|
||||
errors.append(f"open {pdb}: listed as not in the battery, but open.json has it")
|
||||
|
||||
m = re.search(r"The table holds (\d+) PDB entries", text)
|
||||
if not m or int(m.group(1)) != len(rows):
|
||||
errors.append(f"open: the page states {m and m.group(1)} PDB entries, its table has {len(rows)}")
|
||||
repos = collections.Counter(r[1].split(" [")[0] for r in rows.values())
|
||||
repos.update(r[1].split(" record")[0] for r in no_pdb.values())
|
||||
stated = dict((name, int(n)) for name, n in re.findall(
|
||||
r"([A-Za-z][\w ]*?) (\d+)[,.]", section(text, "The collection in numbers").split("- **Repository**")[1].split(":", 1)[1].split("\n- ")[0]))
|
||||
if stated != dict(repos):
|
||||
errors.append(f"open: repository counts on the page {stated}, the tables give {dict(repos)}")
|
||||
|
||||
|
||||
def same_cell(text, cell, tol):
|
||||
vals = [float(v) for v in text.split()]
|
||||
return len(vals) == 6 and all(abs(a - b) <= tol for a, b in zip(vals, cell))
|
||||
|
||||
|
||||
def check_still():
|
||||
sets = {s["id"]: s for s in json.load(open(os.path.join(HERE, "still_manifest.json")))["sets"]}
|
||||
text = open(os.path.join(DOCS, "EXTERNAL_TEST_DATA_STILLS.md")).read()
|
||||
seen = set()
|
||||
for row in table(section(text, "Datasets")):
|
||||
ids = re.findall(r"`(\w+)`", row[0])
|
||||
pdbs = re.findall(r"\[(\w{4})\]\(https://www.rcsb", row[4])
|
||||
cxidb = int(re.match(r"\[(\d+)\]", row[1]).group(1))
|
||||
sg, dmin = row[5].rsplit(", ", 1)
|
||||
for i, sid in enumerate(ids):
|
||||
seen.add(sid)
|
||||
s = sets.get(sid)
|
||||
if s is None:
|
||||
errors.append(f"still {sid}: on the page but not in still_manifest.json")
|
||||
continue
|
||||
pdb = pdbs[i] if len(pdbs) == len(ids) else pdbs[0]
|
||||
got = (s["cxidb"], s["pdb"], s["sg"], s["d_cut"])
|
||||
if got != (cxidb, pdb, sg, float(dmin)):
|
||||
errors.append(f"still {sid}: page {(cxidb, pdb, sg, float(dmin))}, manifest {got}")
|
||||
for sid in sorted(set(sets) - seen):
|
||||
errors.append(f"still {sid}: in still_manifest.json but not on the page")
|
||||
|
||||
|
||||
def check_inhouse():
|
||||
sets = json.load(open(os.path.join(HERE, "inhouse.json")))["sets"]
|
||||
readme = open(os.path.join(HERE, "README.md")).read()
|
||||
arm = next(l for l in readme.splitlines() if l.startswith("| **inhouse** |"))
|
||||
for s in sets:
|
||||
name = INHOUSE.get(s["id"].split("_")[0])
|
||||
if name is None or name not in arm:
|
||||
errors.append(f"inhouse {s['id']}: its specimen is not named in README.md's Arms table")
|
||||
|
||||
|
||||
check_open()
|
||||
check_still()
|
||||
check_inhouse()
|
||||
for e in errors:
|
||||
print(e)
|
||||
print("doc_check: " + (f"{len(errors)} mismatch(es)" if errors else "manifests and docs agree"))
|
||||
sys.exit(1 if errors else 0)
|
||||
@@ -35,7 +35,7 @@
|
||||
{"id": "6iu8", "input": "6iu8/6iu8_VIT1_MBD_Co/low/low_000001.cbf", "wavelength": 1.648, "ref": {"sg": "P 31", "sgno": 144, "cell": [85.503, 85.503, 98.355, 90.0, 90.0, 120.0], "dmin": 2.7}, "tags": ["cbf", "trigonal"]},
|
||||
{"id": "6iu9", "input": "6iu9/6iu9_VIT1_MBD_Fe/peak/data01_000001.cbf", "wavelength": 1.7401, "ref": {"sg": "P 31", "sgno": 144, "cell": [85.321, 85.321, 97.573, 90.0, 90.0, 120.0], "dmin": 3.0}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
|
||||
{"id": "6jgi", "input": "6jgi/6jgi/data/00001.img", "wavelength": 0.75, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.857, 62.403, 69.172, 90.0, 90.0, 90.0], "dmin": 0.85}, "tags": ["marCCD", "orthorhombic"], "tiers": {"ci": "marCCD, orthorhombic P212121 at 0.75 A"}},
|
||||
{"id": "6jgj", "input": "6jgj/6jgj/data/000001.cbf", "wavelength": 0.35, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.87, 62.34, 68.85, 90.0, 90.0, 90.0], "dmin": 0.77}, "tags": ["cbf", "orthorhombic", "cdte"]},
|
||||
{"id": "6jgj", "input": "6jgj/6jgj/data/000001.cbf", "wavelength": 0.35, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.87, 62.34, 68.85, 90.0, 90.0, 90.0], "dmin": 0.78}, "tags": ["cbf", "orthorhombic", "cdte"]},
|
||||
{"id": "6moj", "input": "6moj/A9_1_00001.cbf", "wavelength": 0.97741, "ref": {"sg": "I 41 2 2", "sgno": 98, "cell": [130.418, 130.418, 293.453, 90.0, 90.0, 90.0], "dmin": 2.431}, "tags": ["cbf", "tetragonal"], "tiers": {"ci": "body-centred tetragonal I4122"}},
|
||||
{"id": "6o2h", "input": "6o2h/lys_nitr_10_1_0001.cbf", "wavelength": 0.9768, "ref": {"sg": "P 1", "sgno": 1, "cell": [27.424, 32.134, 34.513, 88.657, 108.46, 111.877], "dmin": 1.212}, "tags": ["cbf", "triclinic", "diffuse"]},
|
||||
{"id": "6oel", "input": "6oel/1449-8_3_001.img", "wavelength": 0.99994, "ref": {"sg": "F 41 3 2", "sgno": 210, "cell": [328.1, 328.1, 328.1, 90.0, 90.0, 90.0], "dmin": 3.1}, "tags": ["SMV", "cubic"], "tiers": {"smoke": "SMV reader (ADSC), cubic F4132"}},
|
||||
|
||||
Reference in new issue
Block a user