The row's alternative was labelled P 31 1 2 (151) while its own reason argued for P 32 1 2; the deposited P 32 has P 32 1 2 (153) as its 312 supergroup, and P 31 1 2 is accepted from it as the hand, so scoring is unchanged (rugnux's P 31 1 2 still passes as an accepted alternative). Evidence re-checked on the rc173 run: the added two-folds correlate at 0.98-0.99 against 0.98 for the three-folds and 0.32-0.40 for the 321/622 operators, POINTLESS on the P1 merge picks P -3 1 m at likelihood 1.000, and the zone centric in 312 but not in 3 reads centric (+435 nats). The deposition's 55502 unique reflections to 1.747 A are what Laue class -3 holds, so the depositor merged in point group 3; the model breaks the two-fold at a level it can resolve (R 0.22 vs 0.25 for the two indexings). Both answers stay accepted. The row is pinned to the first sweep (0-180 deg at 200 mm); the second (180-360 deg at 300 mm, half the exposure, files numbered by phi) is the same crystal's continuation, and the two were tied on frame count, so the choice rested on the alphabetical tie-break. The earlier P 6 2 2 over-promotion was rugnux's and is refused by the current code. Co-Authored-By: Claude Opus 5 (1M context) <noreply@anthropic.com> Claude-Session: https://claude.ai/code/session_013nW6FNRP1bBJJ8pfHiByAT
173 lines
40 KiB
JSON
173 lines
40 KiB
JSON
{"arm": "open", "sets": [
|
|
{"id": "11if", "input": "11if/BopeA_18500_a_B2-PEF_11if/data/PSL-1503_13949_master.h5", "ref": {"sg": "P 43", "sgno": 78, "cell": [51.14, 51.14, 71.92, 90.0, 90.0, 90.0], "dmin": 1.51}, "tags": ["h5", "tetragonal"], "tiers": {"smoke": "Eiger NXmx from another facility, 4-fold screw"}},
|
|
{"id": "36gk", "input": "36gk/CLS-0074_5-3_36GK/data/CLS-0074_5-3_master.h5", "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [120.58, 189.49, 199.69, 90.0, 90.0, 90.0], "dmin": 2.28}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "3inp", "input": "3inp/IDP02542_3inp/data/idp02542b.001", "ref": {"sg": "F 41 3 2", "sgno": 210, "cell": [224.08, 224.08, 224.08, 90.0, 90.0, 90.0], "dmin": 2.05}, "tags": ["marCCD", "cubic"]},
|
|
{"id": "3ky7", "input": "3ky7/IDP90258_3ky7/data/idp90258f.001", "ref": {"sg": "P 43 3 2", "sgno": 212, "cell": [125.176, 125.176, 125.176, 90.0, 90.0, 90.0], "dmin": 2.35}, "tags": ["marCCD", "cubic"]},
|
|
{"id": "5ebi", "input": "5ebi/dna-rna-chimera_Ba_high_2_001.img", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [35.72, 44.1, 35.72, 90.0, 119.98, 90.0], "dmin": 1.09}, "pinned": true, "tags": ["marCCD", "monoclinic", "twin"]},
|
|
{"id": "5epe", "input": "5epe/030805_5epe/data/E1_7_set.001", "ref": {"sg": "F 2 3", "sgno": 196, "cell": [157.536, 157.536, 157.536, 90.0, 90.0, 90.0], "dmin": 1.9}, "tags": ["marCCD", "cubic"]},
|
|
{"id": "5f6m", "input": "5f6m/crystal3_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [54.81, 58.51, 67.42, 90.0, 90.0, 90.0], "dmin": 1.1}, "tags": ["cbf", "orthorhombic", "diffuse"]},
|
|
{"id": "5j23", "input": "5j23/012132_5j23/data/XZ2_set.001", "ref": {"sg": "H 3", "sgno": 146, "cell": [175.822, 175.822, 136.839, 90.0, 90.0, 120.0], "dmin": 2.3}, "tags": ["marCCD", "trigonal", "twin"]},
|
|
{"id": "5jvn", "input": "5jvn/5jvn/data/PPDK-AV2820_w1_3_0001.cbf", "ref": {"sg": "P 6 2 2", "sgno": 177, "cell": [249.43, 249.43, 84.06, 90.0, 90.0, 120.0], "dmin": 2.9}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "5lzl", "input": "5lzl/pcalad/alad-levoil6_M3S15_1_0001.cbf", "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [205.561, 205.561, 199.171, 90.0, 90.0, 120.0], "dmin": 3.47}, "tags": ["cbf", "trigonal"]},
|
|
{"id": "5m17", "input": "5m17/BxGH99_WTDD_HA00AG2801_2_0001.cbf", "ref": {"sg": "I 4", "sgno": 79, "cell": [108.576, 108.576, 67.746, 90.0, 90.0, 90.0], "dmin": 1.03}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "5nw5", "input": "5nw5/5NW5_1_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [92.14, 169.8, 390.16, 90.0, 90.0, 90.0], "dmin": 6.502}, "tags": ["cbf", "orthorhombic", "low-resolution"]},
|
|
{"id": "5reo", "input": "5reo/cbf/Mpro-x0752_1_0001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [112.39, 52.59, 44.38, 90.0, 103.04, 90.0], "dmin": 1.88}, "tags": ["cbf", "monoclinic"], "tiers": {"smoke": "fastest set (10 s): miniCBF, monoclinic"}},
|
|
{"id": "5src", "input": "5src/5src/data/FRS004_15_1_00001.cbf", "ref": {"sg": "P 43", "sgno": 78, "cell": [88.68, 88.68, 39.23, 90.0, 90.0, 90.0], "dmin": 1.05}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "6fid", "input": "6fid/Trypsin_x1_align_2_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [59.947, 64.107, 69.694, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6fvz", "input": "6fvz/maox215_6fvz/data/maox215_w1_1_0001.cbf", "ref": {"sg": "C 2 2 2", "sgno": 21, "cell": [131.182, 222.753, 86.482, 90.0, 90.0, 90.0], "dmin": 1.8}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6fwc", "input": "6fwc/maox225_6fwc/data/maox225_1_00001.cbf", "ref": {"sg": "C 2 2 2", "sgno": 21, "cell": [131.728, 222.051, 86.293, 90.0, 90.0, 90.0], "dmin": 1.7}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6h2p_native", "input": "6h2p/ProlMut1MnCAC_6h2p/data/Prol_Mut1_Mn_X1_nat_1_0002.cbf", "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [103.453, 107.075, 216.543, 90.0, 90.0, 90.0], "dmin": 1.479}, "tags": ["cbf", "orthorhombic", "two-wavelength"]},
|
|
{"id": "6h2p_1p89A", "input": "6h2p/ProlMut1MnCAC_6h2p/data/Prol_Mut1_Mn_X_pk1_2_0001.cbf", "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [103.453, 107.075, 216.543, 90.0, 90.0, 90.0], "dmin": null}, "tags": ["cbf", "orthorhombic", "long-wavelength", "two-wavelength"]},
|
|
{"id": "6h5t", "input": "6h5t/6h5t/data/SH3-1_x2_1_001.img", "ref": {"sg": "I 4 2 2", "sgno": 97, "cell": [86.792, 86.792, 141.768, 90.0, 90.0, 90.0], "dmin": 1.689}, "tags": ["marCCD", "tetragonal"]},
|
|
{"id": "6hv2", "input": "6hv2/6hv2/data/coll_1_master.h5", "ref": {"sg": "P 61 2 2", "sgno": 178, "cell": [68.928, 68.928, 133.563, 90.0, 90.0, 120.0], "dmin": 1.709}, "tags": ["h5", "hexagonal"]},
|
|
{"id": "6hwj", "input": "6hwj/bg3006_2_0001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [59.812, 96.07, 80.252, 90.0, 106.69, 90.0], "dmin": 1.979}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "6i3j", "input": "6i3j/6i3j/data/BF19_go_1_0001.img", "ref": {"sg": "F 2 2 2", "sgno": 22, "cell": [134.382, 203.846, 226.744, 90.0, 90.0, 90.0], "dmin": 2.59}, "tags": ["marCCD", "orthorhombic"]},
|
|
{"id": "6iu5", "input": "6iu5/6iu5_VIT1_MBD_Zn/peak/peak_000001.cbf", "ref": {"sg": "P 31", "sgno": 144, "cell": [84.942, 84.942, 98.19, 90.0, 90.0, 120.0], "dmin": 2.25}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
|
|
{"id": "6iu6", "input": "6iu6/6iu6_VIT1_MBD_Ni/peak/peak_000001.cbf", "ref": {"sg": "P 31", "sgno": 144, "cell": [84.744, 84.744, 97.398, 90.0, 90.0, 120.0], "dmin": 2.9}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
|
|
{"id": "6iu8", "input": "6iu8/6iu8_VIT1_MBD_Co/low/low_000001.cbf", "ref": {"sg": "P 31", "sgno": 144, "cell": [85.503, 85.503, 98.355, 90.0, 90.0, 120.0], "dmin": 2.7}, "tags": ["cbf", "trigonal"]},
|
|
{"id": "6iu9", "input": "6iu9/6iu9_VIT1_MBD_Fe/peak/data01_000001.cbf", "ref": {"sg": "P 31", "sgno": 144, "cell": [85.321, 85.321, 97.573, 90.0, 90.0, 120.0], "dmin": 3.0}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
|
|
{"id": "6jgi", "input": "6jgi/6jgi/data/00001.img", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.857, 62.403, 69.172, 90.0, 90.0, 90.0], "dmin": 0.85}, "tags": ["marCCD", "orthorhombic"]},
|
|
{"id": "6jgj", "input": "6jgj/6jgj/data/000001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.87, 62.34, 68.85, 90.0, 90.0, 90.0], "dmin": 0.77}, "tags": ["cbf", "orthorhombic", "cdte"]},
|
|
{"id": "6moj", "input": "6moj/A9_1_00001.cbf", "ref": {"sg": "I 41 2 2", "sgno": 98, "cell": [130.418, 130.418, 293.453, 90.0, 90.0, 90.0], "dmin": 2.431}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "6o2h", "input": "6o2h/lys_nitr_10_1_0001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [27.424, 32.134, 34.513, 88.657, 108.46, 111.877], "dmin": 1.212}, "tags": ["cbf", "triclinic", "diffuse"]},
|
|
{"id": "6oel", "input": "6oel/1449-8_3_001.img", "ref": {"sg": "F 41 3 2", "sgno": 210, "cell": [328.1, 328.1, 328.1, 90.0, 90.0, 90.0], "dmin": 3.1}, "tags": ["SMV", "cubic"], "tiers": {"smoke": "SMV reader (ADSC), cubic F4132"}},
|
|
{"id": "6p8p", "input": "6p8p/14_12_1_0001.cbf", "ref": {"sg": "P 4", "sgno": 75, "cell": [97.525, 97.525, 60.134, 90.0, 90.0, 90.0], "dmin": 1.635}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "6pb3", "input": "6pb3/14_16_1_000001.cbf", "ref": {"sg": "P 6", "sgno": 168, "cell": [100.436, 100.436, 48.86, 90.0, 90.0, 120.0], "dmin": 2.048}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "6pxb", "input": "6pxb/TJB1_3_rachel_1_0001.cbf", "pinned": true, "ref": {"sg": "P 32", "sgno": 145, "cell": [64.021, 64.021, 119.447, 90.0, 90.0, 120.0], "dmin": 1.747}, "ref_alternatives": [{"sg": "P 32 1 2", "sgno": 153, "why": "The deposition merged in point group 3 (its 55502 unique reflections to 1.747 A are what Laue class -3 holds, twice what -3 1 m would) and refined six chains in P 32. The intensities read point group 312 instead: the three added two-folds correlate at 0.98-0.99, at or above the three-folds nobody disputes (0.98), against 0.37-0.40 for the 321 and 622 operators, POINTLESS on our P1 merge picks P -3 1 m (likelihood 1.000), and the reflections centric in 312 but not in 3 are distributed as centric (+435 nats), which a twin law cannot produce. Against that, the deposited chains pair under the added two-fold at 0.3-0.7 A, more than coordinate error at 1.75 A, and the model tells the two indexings apart (R 0.22 against 0.25), so the two-fold may be a near-exact non-crystallographic one; ZANUDA settles on P 32 2 1, whose operators these data do not support. Neither answer is established, so both are accepted; P 31 1 2, which the data cannot separate from P 32 1 2, is accepted as its hand"}], "tags": ["cbf", "trigonal"]},
|
|
{"id": "6pxc", "input": "6pxc/TJB6_1_Rachel_1_0001.cbf", "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [44.19, 64.827, 87.239, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6r72", "input": "6r72/V-CK63-8-ld_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [117.805, 110.754, 155.615, 90.0, 93.23, 90.0], "dmin": 3.95}, "pinned": true, "tags": ["h5", "monoclinic"]},
|
|
{"id": "6rlr", "input": "6rlr/_b4_1_master.h5", "ref": {"sg": "P 1", "sgno": 1, "cell": [39.986, 39.998, 63.643, 80.39, 76.29, 68.15], "dmin": 2.0}, "tags": ["h5", "triclinic", "twin"]},
|
|
{"id": "6toc", "input": "6toc/zenodo/dts_1_00001.cbf", "ref": {"sg": "P 42", "sgno": 77, "cell": [31.523, 31.523, 81.599, 90.0, 90.0, 90.0], "dmin": 1.853}, "ref_alternatives": [{"sg": "P 42 2 2", "sgno": 93, "why": "Our reduction and an independent POINTLESS run on our own P1 merge both read point group 422, and the deposited asymmetric unit's two chains are related by the very two-fold the higher group adds, to 0.16 A CA RMSD over 43 residues - coordinate error at 1.85 A. Merging in P 42 2 2 costs 0.0006 in R_meas for 1.75x the multiplicity and correlates better with the deposited model (0.9802 vs 0.9764). The refinement test is NOT unanimous: ZANUDA 1.097 refines P 42 2 2 to R-free 0.2561 against P 42's 0.2636 at half the parameters and reports the deposited assignment incorrect, while an independent Refmac 5.8.0431 comparison on a symmetry-consistent free set puts P 42 ahead by 0.004-0.020 depending on cycle count - less than the spread between refinement protocols. Neither answer is established: a pseudo-symmetry too exact for any test we have remains a live explanation, and so does the deposited assignment. Either is accepted"}], "tags": ["cbf", "tetragonal", "twin"]},
|
|
{"id": "6ttn", "input": "6ttn/6ttn/data/H6H_33_01_hyo_full_1_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [39.894, 79.841, 104.701, 90.0, 90.0, 90.0], "dmin": 1.12}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6u7g", "input": "6u7g/6u7g/data/SNB02_11_8_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [99.555, 98.682, 147.525, 90.0, 104.6, 90.0], "dmin": 2.35}, "pinned": true, "tags": ["h5", "monoclinic"]},
|
|
{"id": "6ukf", "input": "6ukf/6ukf/data/XDC-7_Pn6_000001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [61.018, 37.317, 69.027, 90.0, 109.768, 90.0], "dmin": 1.0}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "6vww", "input": "6vww/IDP51000_6vww/data/m4H11g_00001.cbf", "ref": {"sg": "P 63", "sgno": 173, "cell": [150.539, 150.539, 111.31, 90.0, 90.0, 120.0], "dmin": 2.2}, "tags": ["cbf", "hexagonal", "twin"], "tiers": {"smoke": "merohedral twin, P63"}},
|
|
{"id": "6w4h", "input": "6w4h/IDP51000_6W4H/data/idp51000-201-a_1_2_3.001", "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [167.74, 167.74, 51.942, 90.0, 90.0, 120.0], "dmin": 1.8}, "tags": ["marCCD", "trigonal"]},
|
|
{"id": "6wzo", "input": "6wzo/9_1_1_000001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [43.718, 50.061, 69.337, 106.499, 90.094, 97.145], "dmin": 1.42}, "tags": ["cbf", "triclinic"]},
|
|
{"id": "6yqf", "input": "6yqf/6yqf/data/SYCE2TEX12-8_1_0001.cbf", "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [42.67, 59.68, 156.49, 90.0, 90.0, 90.0], "dmin": 3.327}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6z8o", "input": "6z8o/HASE01-gaKr1_w1_1_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [63.716, 97.022, 121.318, 90.0, 104.656, 90.0], "dmin": 2.2}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "6ze4", "input": "6ze4/806/o8_1_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [93.56, 109.88, 116.11, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf", "orthorhombic"], "tiers": {"smoke": "known hard: P212121 under-called as P21 since rc168"}},
|
|
{"id": "7arr", "input": "7arr/PF4N_04D_w1_1_00001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [30.937, 32.068, 43.087, 114.16, 91.88, 109.86], "dmin": 1.1}, "tags": ["cbf", "triclinic"]},
|
|
{"id": "7atg", "input": "7atg/7atg/data/put-2-2.0s_5_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [17.97, 31.02, 43.86, 90.0, 90.0, 90.0], "dmin": 0.6}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "7bgt", "input": "7bgt/MPMV2243_3_001.img", "ref": {"sg": "P 1", "sgno": 1, "cell": [29.296, 67.618, 69.716, 76.845, 83.875, 83.645], "dmin": 1.93}, "tags": ["marCCD", "triclinic"]},
|
|
{"id": "7brr", "input": "7brr/7brr/data/3C_2_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [55.45, 99.02, 59.583, 90.0, 108.54, 90.0], "dmin": 1.35}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "7dkp", "input": "7dkp/7dkp/data/LOX1-sree-p1a9-1p2_w1_1_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [49.84, 169.451, 49.842, 90.0, 93.51, 90.0], "dmin": 1.45}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "7k1l", "input": "7k1l/IDP52015_7k1l/data/cs1C2eg_00001.cbf", "ref": {"sg": "P 63", "sgno": 173, "cell": [150.83, 150.83, 110.73, 90.0, 90.0, 120.0], "dmin": 2.25}, "tags": ["cbf", "hexagonal"], "tiers": {"smoke": "known hard: screw axis (P6 vs P63)"}},
|
|
{"id": "7kcn", "input": "7kcn/7kcn/data/ttr_hiuase_1_D1_33_00001.cbf", "ref": {"sg": "P 41 2 2", "sgno": 91, "cell": [67.03, 67.03, 116.89, 90.0, 90.0, 90.0], "dmin": 1.46}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "7l6j", "input": "7l6j/7l6j/data/idp97824-102sm-a_1_1_7.001", "ref": {"sg": "I 41 3 2", "sgno": 214, "cell": [171.693, 171.693, 171.693, 90.0, 90.0, 90.0], "dmin": 1.78}, "tags": ["marCCD", "cubic"]},
|
|
{"id": "7l84", "input": "7l84/301_helical_1_0001.cbf", "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [79.344, 79.344, 37.81, 90.0, 90.0, 90.0], "dmin": 1.7}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "7mzt", "input": "7mzt/7mzt/data/BVG2_Pn3_000001.cbf", "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [113.619, 96.989, 108.33, 90.0, 90.0, 90.0], "dmin": 4.07}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "7n0i", "input": "7n0i/8_2_1_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [75.846, 131.557, 140.048, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["cbf", "orthorhombic", "tncs"]},
|
|
{"id": "7n2s", "input": "7n2s/1449-4_1_00001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [83.211, 52.789, 106.291, 90.0, 98.278, 90.0], "dmin": 2.37}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "7orr", "input": "7orr/7orr/data/Nsp10-VT00022_1_master.h5", "ref": {"sg": "I 21 3", "sgno": 199, "cell": [105.88, 105.88, 105.88, 90.0, 90.0, 90.0], "dmin": 1.79}, "tags": ["h5", "cubic"]},
|
|
{"id": "7os3", "input": "7os3/pos2_1/pos2_1_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [78.15, 91.05, 105.84, 90.0, 90.0, 90.0], "dmin": 2.177}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "7ph1", "input": "7ph1/7ph1/data/9_1_0001.cbf", "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [74.975, 81.289, 124.248, 90.0, 90.0, 90.0], "dmin": 1.18}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "7pq7", "input": "7pq7/7pq7/data/1436_p52_A3_1_1_00001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [120.88, 51.73, 75.54, 90.0, 125.14, 90.0], "dmin": 1.55}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "7qij", "input": "7qij/907/dg046_2_data_1_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [143.46, 324.92, 369.38, 90.0, 90.0, 90.0], "dmin": 4.1}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "7qis", "input": "7qis/7qis/data/Chymo_Dfe_x1_2_0001.cbf", "ref": {"sg": "P 61", "sgno": 169, "cell": [100.269, 100.269, 206.215, 90.0, 90.0, 120.0], "dmin": 1.83}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "7ris", "input": "7ris/7ris/data/GLVase_Ca_we21108b7b_1_2_2.001_master.h5", "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [44.54, 44.54, 189.95, 90.0, 90.0, 120.0], "dmin": 1.72}, "pinned": true, "tags": ["h5", "trigonal"]},
|
|
{"id": "7rji", "input": "7rji/7rji/data/DD3_00000.cbf", "ref": {"sg": "H 3 2", "sgno": 155, "cell": [83.036, 83.036, 124.83, 90.0, 90.0, 120.0], "dmin": 1.71}, "tags": ["cbf", "trigonal"]},
|
|
{"id": "7t5t", "input": "7t5t/A1_2_00001.cbf", "ref": {"sg": "P 42 21 2", "sgno": 94, "cell": [95.309, 95.309, 104.915, 90.0, 90.0, 90.0], "dmin": 1.35}, "pinned": true, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "7tcd", "input": "7tcd/7tcd/data/col_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [138.504, 47.902, 78.068, 90.0, 107.56, 90.0], "dmin": 1.7}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "7yzx", "input": "7yzx/7yzx/data/783-1_1_0001.cbf", "ref": {"sg": "P 63 2 2", "sgno": 182, "cell": [169.42, 169.42, 141.83, 90.0, 90.0, 120.0], "dmin": 1.9}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "8a1a", "input": "8a1a/L1F11v1_8a1a/data/L1-F11-v1_9ly1_D06_01_2_master.h5", "ref": {"sg": "P 65", "sgno": 170, "cell": [191.866, 191.866, 122.409, 90.0, 90.0, 120.0], "dmin": 2.05}, "tags": ["h5", "hexagonal"]},
|
|
{"id": "8agq", "input": "8agq/8agq_zip_8AGQ/data/coll_1_00001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [89.948, 55.447, 54.787, 90.0, 113.55, 90.0], "dmin": 1.093}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "8dqb", "input": "8dqb/KloxA_17380_a_B1-Apo_I23_Form_8dqb/data/PSL-1405_653_master.h5", "ref": {"sg": "I 2 3", "sgno": 197, "cell": [164.124, 164.124, 164.124, 90.0, 90.0, 90.0], "dmin": 2.5}, "tags": ["h5", "cubic"]},
|
|
{"id": "8dyz", "input": "8dyz/lys_1_2_0001.cbf", "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [79.632, 79.632, 38.296, 90.0, 90.0, 90.0], "dmin": 1.272}, "tags": ["cbf", "tetragonal", "diffuse"]},
|
|
{"id": "8dz7", "input": "8dz7/lys_rt_2_38_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [30.486, 56.401, 73.852, 90.0, 90.0, 90.0], "dmin": 1.34}, "tags": ["cbf", "orthorhombic", "diffuse"]},
|
|
{"id": "8egn", "input": "8egn/PsaeA_00137_b_B5-az13643701_8egn/data/FKC8_4_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [71.69, 75.16, 109.79, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "8iya", "input": "8iya/8iya/data/11_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [102.747, 50.077, 109.248, 90.0, 91.754, 90.0], "dmin": 2.43}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "8k1g", "input": "8k1g/8k1g/data/KP02_0001.cbf", "ref": {"sg": "I 4 2 2", "sgno": 97, "cell": [182.01, 182.01, 80.71, 90.0, 90.0, 90.0], "dmin": 2.09}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "8oic", "input": "8oic/8oic/data/_b20_1_master.h5", "ref": {"sg": "P 1", "sgno": 1, "cell": [73.055, 94.665, 120.589, 105.081, 89.959, 93.826], "dmin": 2.8}, "tags": ["h5", "triclinic"]},
|
|
{"id": "8owm", "input": "8owm/p13x4_1_00001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [95.544, 95.629, 95.841, 90.416, 93.59, 117.775], "dmin": 1.7}, "tags": ["cbf", "triclinic"]},
|
|
{"id": "8pqd", "input": "8pqd/8pqd/data/11AT05_w1_1_1_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [59.39, 59.37, 192.89, 90.0, 90.0, 90.0], "dmin": 1.5}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "8qaw", "input": "8qaw/p18x3/p18x3_1_00001.cbf.gz", "ref": {"sg": "H 3", "sgno": 146, "cell": [137.68, 137.68, 265.907, 90.0, 90.0, 120.0], "dmin": 1.55}, "tags": ["cbf", "trigonal", "long-axis"]},
|
|
{"id": "8qj5", "input": "8qj5/8qj5/data/Lcsbc3_1_2_00001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [57.61, 100.63, 77.93, 90.0, 96.06, 90.0], "dmin": 1.63}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "8qq7", "input": "8qq7/cbf/SpNox-Sp49-B3-B_088_1_0001.cbf", "ref": {"sg": "P 64 2 2", "sgno": 181, "cell": [145.967, 145.967, 153.619, 90.0, 90.0, 120.0], "dmin": 3.62}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "8r5r", "input": "8r5r/8r5r/data/D5-33805_1_1_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [91.74, 132.91, 137.5, 90.0, 90.0, 90.0], "dmin": 3.08}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "8rud", "input": "8rud/p08x03_1_00001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [78.066, 91.386, 114.547, 90.0, 96.9, 90.0], "dmin": 2.1}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "8s38", "input": "8s38/MX733_2_00001.cbf", "ref": {"sg": "I 21 21 21", "sgno": 24, "cell": [95.368, 163.1, 219.023, 90.0, 90.0, 90.0], "dmin": 1.89}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "8sa8", "input": "8sa8/KlaeA_00906_a_B1-PLP_8sa8/data/PSL-0412_255_master.h5", "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [87.887, 131.544, 165.363, 90.0, 104.48, 90.0], "dmin": 1.3}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "8sqo", "input": "8sqo/BrabA_00028_a_A1-Mg_8sqo/data/PSL-1801_942_master.h5", "ref": {"sg": "P 4 3 2", "sgno": 207, "cell": [112.91, 112.91, 112.91, 90.0, 90.0, 90.0], "dmin": 1.55}, "tags": ["h5", "cubic"]},
|
|
{"id": "8sqq", "input": "8sqq/BrabA_00028_a_A1-Apo_8sqq/data/PSL-1810_965_master.h5", "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [171.52, 171.52, 171.52, 90.0, 90.0, 90.0], "dmin": 2.25}, "tags": ["h5", "cubic"]},
|
|
{"id": "8sqt", "input": "8sqt/BrabA_00028_a_A1-Fe_8sqt/data/PSL-1812_971_master.h5", "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [170.72, 170.72, 170.72, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["h5", "cubic"]},
|
|
{"id": "8t7r", "input": "8t7r/8t7r/data/GREEN-04_Pn5_000001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [357.076, 259.582, 255.361, 90.0, 133.13, 90.0], "dmin": 3.84}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "8tha", "input": "8tha/1TEL_double_helix_8tha/data/A3_1_00001.cbf", "ref": {"sg": "P 64", "sgno": 172, "cell": [69.16, 69.16, 29.13, 90.0, 90.0, 120.0], "dmin": 1.68}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "8tyy", "input": "8tyy/CPS_2_1_000001.cbf", "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [214.891, 214.891, 214.891, 90.0, 90.0, 90.0], "dmin": 1.68}, "tags": ["cbf", "cubic"]},
|
|
{"id": "8u0i", "input": "8u0i/8u0i/data/dI-2-05a_4_00001.cbf", "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [50.317, 50.317, 90.596, 90.0, 90.0, 90.0], "dmin": 1.541}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "8v4o", "input": "8v4o/CaalA_00629_a_FS11-AMP_8v4o/data/PSL-1602_2180_master.h5", "ref": {"sg": "P 61 2 2", "sgno": 178, "cell": [139.46, 139.46, 544.99, 90.0, 90.0, 120.0], "dmin": 2.7}, "tags": ["h5", "hexagonal"]},
|
|
{"id": "8xbp", "input": "8xbp/8xbp/data/puck2872_3_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [148.29, 50.78, 60.21, 90.0, 92.33, 90.0], "dmin": 1.99}, "ref_override": {"cell": [148.736, 51.777, 60.181, 90.0, 92.36, 90.0]}, "ref_override_why": "the uploaded sweep is a different crystal from the one the deposited cell describes: master data_collection_date 2023-06-21, deposited _diffrn_detector.pdbx_collection_date 2023-06-23, and the deposited b = 50.78 is 2.0% from the b these images give. The override is the cell DIALS 3.29 indexes de novo on this master, b = 51.777(11); the deposited space group and d_min are kept", "tags": ["h5", "monoclinic"]},
|
|
{"id": "8xte", "input": "8xte/1101/G2_1_00001.cbf", "ref": {"sg": "P 32", "sgno": 145, "cell": [208.77, 208.77, 67.22, 90.0, 90.0, 120.0], "dmin": 1.99}, "ref_alternatives": [{"sg": "P 31 2 1", "sgno": 152, "why": "The evidence favours the higher group here. The twin-immune centric zone of the added two-folds - reflections the higher group makes centric, which are their own twin mates and so cannot be made to read centric by a merohedral twin law - gives <|E^2-1|> = 0.946 +/- 0.012 against a centric expectation of 0.968 and an acentric 0.736, at +707 nats. Re-refinement on a shared free set with the twin law removed from both sides favours P 3_2 2 1 (0.2177/0.2322) over P 3_2 (0.2460/0.2612), and the deposited entry's published R values reproduce only with an undeclared twin law h,-h-k,-l at alpha = 0.50, which is itself a 321-symmetric target. No refinement R can close the question in principle, because a merohedral twin at exactly alpha = 0.5 and true 321 predict identical intensities; the case rests on the centric zone. Both answers are accepted, ours being the better supported"}], "tags": ["cbf", "trigonal"]},
|
|
{"id": "8xtf", "input": "8xtf/1102/puck03_12_1_master.h5", "ref": {"sg": "H 3 2", "sgno": 155, "cell": [211.75, 211.75, 67.42, 90.0, 90.0, 120.0], "dmin": 2.13}, "tags": ["h5", "trigonal"]},
|
|
{"id": "8xtg", "input": "8xtg/1100/mpag15_1_00001.cbf", "ref": {"sg": "P 32", "sgno": 145, "cell": [199.54, 199.54, 67.15, 90.0, 90.0, 120.0], "dmin": 2.0}, "ref_alternatives": [{"sg": "P 31 2 1", "sgno": 152, "why": "The evidence favours the DEPOSITION here, and this row must not be read as the 8xte one. Every correlation-based instrument we have - our own operator correlations, POINTLESS (0.85 on our P1 merge) - reads point group 321, but our own twin-immune centric-zone test, the only one that separates real symmetry from pseudo-symmetry, reads <|E^2-1|> = 0.869 at -44.9 nats, between the two expectations and on the wrong side, i.e. AGAINST the promotion, with an L-test twin fraction of 0.20-0.26. Whether this crystal is partially twinned or purely pseudo-symmetric is not established. Both answers are accepted, the deposition being the better supported"}], "tags": ["cbf", "trigonal"]},
|
|
{"id": "8y74", "input": "8y74/1_1/1_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [125.782, 76.553, 87.143, 90.0, 92.449, 90.0], "dmin": 1.9}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "8ys9", "input": "8ys9/8YS9_xray-data_8ys9/data/SDS_09_18112_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [71.04, 77.68, 83.16, 90.0, 90.0, 90.0], "dmin": 1.46}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9b22", "input": "9b22/KlpnC_20447_a_B1-AR6-AMP_9b22/data/PSL-1011_1580_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [39.826, 92.659, 57.716, 90.0, 91.68, 90.0], "dmin": 1.3}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9bn8", "input": "9bn8/EscoA_17938_a_AE1-UMA-A1AQS_9bn8/data/PSL-0401_8296_master.h5", "ref": {"sg": "P 41", "sgno": 76, "cell": [65.488, 65.488, 134.764, 90.0, 90.0, 90.0], "dmin": 1.35}, "tags": ["h5", "tetragonal"]},
|
|
{"id": "9c18", "input": "9c18/BLVRB-2_5217_master.h5", "ref": {"sg": "P 1", "sgno": 1, "cell": [41.94, 41.977, 60.212, 84.11, 87.24, 63.66], "dmin": 1.9}, "tags": ["h5", "triclinic"]},
|
|
{"id": "9chw", "input": "9chw/D1.001", "ref": {"sg": "P 61", "sgno": 169, "cell": [98.686, 98.686, 82.062, 90.0, 90.0, 120.0], "dmin": 2.16}, "tags": ["marCCD", "hexagonal"]},
|
|
{"id": "9crw", "input": "9crw/data_9crw/data/Kip3-475-22-2_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [83.96, 104.57, 118.78, 90.0, 93.37, 90.0], "dmin": 2.49}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9e2t", "input": "9e2t/ga026f4b-1_5_00001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [75.499, 78.082, 101.219, 94.63, 103.39, 114.55], "dmin": 2.28}, "tags": ["cbf", "triclinic"]},
|
|
{"id": "9ea5", "input": "9ea5/K4_1_00001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [65.868, 73.064, 98.399, 90.0, 108.725, 90.0], "dmin": 2.0}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "9fcg", "input": "9fcg/IBCH-15-p02x06_2_00001.cbf.gz", "ref": {"sg": "P 4", "sgno": 75, "cell": [87.79, 87.79, 35.633, 90.0, 90.0, 90.0], "dmin": 1.54}, "tags": ["cbf", "tetragonal"], "tiers": {"smoke": "cbf.gz reader, pure 4-fold"}},
|
|
{"id": "9fhc", "input": "9fhc/te/te312_2_001.img", "ref": {"sg": "I 2 3", "sgno": 197, "cell": [227.46, 227.46, 227.46, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["marCCD", "cubic"]},
|
|
{"id": "9gdj", "input": "9gdj/slh34_w1_1_1_master.h5", "ref": {"sg": "P 41 21 2", "sgno": 92, "cell": [123.92, 123.92, 126.44, 90.0, 90.0, 90.0], "dmin": 1.47}, "tags": ["h5", "tetragonal", "cdte"]},
|
|
{"id": "9gjx", "input": "9gjx/BlNTR_9gjx/data/SC6_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [76.776, 115.807, 103.807, 90.0, 110.29, 90.0], "dmin": 2.4}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9gqg", "input": "9gqg/MX-2555/FKBP51-MSP500-A-5522-11_1_3094759/FKBP51-MSP500-A-5522-11_1_1_master.h5", "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [48.157, 48.157, 188.036, 90.0, 90.0, 120.0], "dmin": 2.0}, "tags": ["h5", "trigonal"]},
|
|
{"id": "9hnc", "input": "9hnc/asp_7_00001.cbf", "ref": {"sg": "P 1 2 1", "sgno": 3, "cell": [123.764, 123.645, 187.679, 90.0, 90.063, 90.0], "dmin": 1.879}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "9hs7", "input": "9hs7/9hs7/data/B28X1_1_0001.cbf", "ref": {"sg": "P 65", "sgno": 170, "cell": [65.44, 65.44, 88.77, 90.0, 90.0, 120.0], "dmin": 1.698}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "9i0a", "input": "9i0a/carm1END468_9i0a_tar_9I0A/data/X151B1_1_master.h5", "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [75.237, 98.676, 208.551, 90.0, 90.0, 90.0], "dmin": 2.22}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9i80", "input": "9i80/20230422-PX1-LecA_RO5-5315-1/LecA-RO5_1_master.h5", "ref": {"sg": "P 41", "sgno": 76, "cell": [81.214, 81.214, 165.029, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["h5", "tetragonal", "twin"]},
|
|
{"id": "9ig7", "input": "9ig7/9IG7/data/KOD-P596-G2_3_00001.cbf", "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [111.472, 153.471, 69.03, 90.0, 90.0, 90.0], "dmin": 2.6}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "9ih9", "input": "9ih9/run_01_05_datacollection_9IH9/data/design-Xinjian-P1Thro-4_1_5_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [78.758, 133.933, 82.32, 90.0, 101.356, 90.0], "dmin": 1.7}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9jzo", "input": "9jzo/JS_35P2_C3-002_diffraction_files_9JZO/data/JS_35P2_C3-002_0001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [41.63, 43.1, 54.2, 112.97, 90.11, 118.18], "dmin": 1.4}, "tags": ["cbf", "triclinic"], "tiers": {"smoke": "triclinic P1"}},
|
|
{"id": "9khr", "input": "9khr/PfPlrx-DTT-9KHR/data-PfPlrx-DTT-9KHR/ods1467-lp13D1-01001.mccd", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [48.704, 50.31, 78.018, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["marCCD", "orthorhombic"], "tiers": {"smoke": "marCCD reader (.mccd), fast"}},
|
|
{"id": "9mh4", "input": "9mh4/KlaeA_00150_a_B1_9mh4/data/PSL-0501_2719_master.h5", "ref": {"sg": "P 21 3", "sgno": 198, "cell": [138.65, 138.65, 138.65, 90.0, 90.0, 90.0], "dmin": 3.05}, "tags": ["h5", "cubic"]},
|
|
{"id": "9min", "input": "9min/1151/A8_31_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [95.45, 98.54, 155.74, 90.0, 90.0, 90.0], "dmin": 2.05}, "tags": ["cbf", "orthorhombic"], "tiers": {"smoke": "known hard: halved axis"}},
|
|
{"id": "9o0h", "input": "9o0h/3TEL-GG-TNK1-UBA_9o0h/data/E1_1_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [55.15, 65.54, 112.9, 90.0, 90.0, 90.0], "dmin": 2.24}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "9p7q", "input": "9p7q/9p7q_9P7Q/data/SAMDC_MTA_273_40_00001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [96.978, 45.018, 72.061, 90.0, 105.109, 90.0], "dmin": 2.21}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "9pbb", "input": "9pbb/9pbb_9PBB/data/SAMDC_MTA_293_30_00001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [97.418, 45.876, 72.248, 90.0, 104.971, 90.0], "dmin": 2.17}, "pinned": true, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "9q41", "input": "9q41/apoSPDS_1_master.h5", "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [118.568, 133.704, 82.369, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9q66", "input": "9q66/PREP_JP417_D8a_12694_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [105.853, 67.294, 158.019, 90.0, 99.109, 90.0], "dmin": 2.01}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9qw8", "input": "9qw8/MX-2555/run_03_datacollection [2023-09-08 22:19:51]/FKBP12BRD4-5519-6-BD1-PPU688_w1_1_1_master.h5", "ref": {"sg": "P 1", "sgno": 1, "cell": [35.648, 35.65, 100.919, 86.458, 84.218, 72.475], "dmin": 1.8}, "tags": ["h5", "triclinic"]},
|
|
{"id": "9rci", "input": "9rci/FEN1-CD029134_A09-3_AD049A-10_1_master.h5", "ref": {"sg": "P 1", "sgno": 1, "cell": [35.869, 39.297, 100.916, 98.3, 90.32, 90.09], "dmin": 1.662}, "ref_alternatives": [{"cell": [35.869, 39.297, 199.976, 87.087, 90.341, 90.09], "why": "The deposited cell is the (0,1/2,1/2)-centred sublattice of the supercell we report, to 0.17%, and both descriptions of this lattice are defensible. The Patterson has an off-origin peak at 62.5% of the origin, so a real translational NCS relates the two halves of our cell: describing the crystal by the doubled cell with the near-translation left in the content, or by its sublattice with the near-translation absorbed into the lattice, is a choice, not a measurement. The alternative cell is the deposited one doubled along c with the centring removed (c' = b + 2c), computed from the deposited cell alone - not from our output"}], "tags": ["h5", "triclinic", "tncs"]},
|
|
{"id": "9rcs", "input": "9rcs/760_B7_x1_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [70.01, 78.8, 82.34, 90.0, 88.64, 90.0], "dmin": 3.012}, "tags": ["h5", "monoclinic", "cdte"]},
|
|
{"id": "9rp9", "input": "9rp9/data_9RP9/data/TAR148-TAR148_X2_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [73.48, 59.78, 91.67, 90.0, 100.85, 90.0], "dmin": 2.1}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9sl0", "input": "9sl0/wt-1_9sl0/data/design-Yan-HLA-WT-1_1_5_1_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [60.181, 80.201, 111.589, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9t6s", "input": "9t6s/CadC-AF6586_1_5_1_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [63.004, 64.574, 102.705, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["h5", "orthorhombic", "tncs"]},
|
|
{"id": "9upt", "input": "9upt/Raw data 1A/C12_7_00001.img", "ref": {"sg": "P 6", "sgno": 168, "cell": [158.27, 158.27, 53.962, 90.0, 90.0, 120.0], "dmin": 2.369}, "tags": ["SMV", "hexagonal"]},
|
|
{"id": "9vyb", "input": "9vyb/Antitoxin Phd_9vyb/data/G7-5_4187_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [44.37, 47.76, 48.35, 90.0, 90.0, 90.0], "dmin": 2.12}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9w3y", "input": "9w3y/9w3y/data/collect_01_00001_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [60.75, 69.98, 94.24, 90.0, 90.0, 90.0], "dmin": 1.5}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9yl4", "input": "9yl4/data_MJ4720/UWO0004_06_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [95.837, 111.339, 402.967, 90.0, 90.0, 90.0], "dmin": 3.7}, "pinned": true, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "9yzk", "input": "9yzk/CC1_21_TGGGAAGATACTGGATGAGGT_empty_9yzk/data/run_29_00001.cbf", "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [75.836, 163.022, 192.278, 90.0, 98.614, 90.0], "dmin": 5.1}, "tags": ["cbf", "monoclinic"], "tiers": {"smoke": "I2/C2 setting choice at low resolution"}},
|
|
{"id": "9z44", "input": "9z44/CC1_10_CCCGGCCGG_Cclamp_9z44/data/run_41_00001.cbf", "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [73.491, 127.653, 141.183, 90.0, 91.984, 90.0], "dmin": 7.2}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "9z72", "input": "9z72/A7_1_00001.cbf", "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [59.173, 59.173, 426.203, 90.0, 90.0, 120.0], "dmin": 2.38}, "tags": ["cbf", "trigonal", "long-axis"], "tiers": {"smoke": "long axis c=426 A, at the FFT ceiling"}},
|
|
{"id": "9zlo", "input": "9zlo/ASP0887_09_0114_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [38.39, 89.98, 106.97, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9zm0", "input": "9zm0/Atg23ANNS_9zm0_9ZM0/data/SeAtg23_B_10_2115_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [50.409, 30.101, 91.244, 90.0, 97.146, 90.0], "dmin": 2.1}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9zmu", "input": "9zmu/BrmeA_18154_a_B2-Apo_9zmu/data/PSL-0613_7518_master.h5", "ref": {"sg": "P 65 2 2", "sgno": 179, "cell": [47.81, 47.81, 492.58, 90.0, 90.0, 120.0], "dmin": 1.98}, "tags": ["h5", "hexagonal"]},
|
|
{"id": "cuhf2", "input": "cuhf2/03_CuHF2pyz2PF6b_P_O/CuHF2pyz2PF6b_P_O_01.nxs", "pinned": true, "tags": ["nxs", "small-molecule"]},
|
|
{"id": "cytidine", "input": "cytidine/20151020-Cytidine-2th-30/fixed-omega--180-phi-scan01_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [13.98, 14.788, 5.119, 90.0, 90.0, 90.0], "dmin": null}, "tags": ["cbf", "orthorhombic", "small-molecule"]},
|
|
{"id": "dnba", "input": "dnba/35dnba_30K_2_04_00001.cbf", "ref": {"sg": "C 1 2/c 1", "sgno": 15, "cell": [20.2635, 8.7575, 9.6697, 90.0, 109.941, 90.0], "dmin": 0.48}, "tags": ["cbf", "monoclinic", "small-molecule"]},
|
|
{"id": "lalanine", "input": "lalanine/pgw240050_01_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [5.7952, 5.933, 12.362, 90.0, 90.0, 90.0], "dmin": null}, "tags": ["cbf", "orthorhombic", "small-molecule"], "tiers": {"smoke": "small molecule, miniCBF"}},
|
|
{"id": "metformin", "input": "metformin/013_Mmetformin_01_master.h5", "ref": {"sg": "P 1 21/c 1", "sgno": 14, "cell": [7.9104, 13.8794, 7.931, 90.0, 114.606, 90.0], "dmin": 0.45}, "tags": ["h5", "monoclinic", "small-molecule"], "tiers": {"smoke": "small molecule, Diamond I19 NXmx master"}},
|
|
{"id": "nidppe", "input": "nidppe/001_NiDppeCl2_01_master.h5", "ref": {"sg": "P 1 21/c 1", "sgno": 14, "cell": [11.2779, 13.3386, 15.8739, 90.0, 98.7953, 90.0], "dmin": 0.77}, "tags": ["h5", "monoclinic", "small-molecule"]},
|
|
{"id": "5mln", "input": "5mln/5mln/data/CmADHx6_w1_2_0001.cbf", "ref": {"sg": "P 21 2 21", "sgno": 18, "cell": [74.178, 80.425, 80.52, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf"]},
|
|
{"id": "5t39", "input": "5t39/10mMfuc-12h.001", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [50.222, 41.27, 58.504, 90.0, 98.58, 90.0], "dmin": 1.1004}, "tags": ["marccd"]},
|
|
{"id": "6cdl", "input": "6cdl/nnnn_6cdl/data/wt_32-14A_p6n6.0001", "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [58.26, 85.91, 46.051, 90.0, 90.0, 90.0], "dmin": 1.25}, "tags": ["marccd"]},
|
|
{"id": "6f3p", "input": "6f3p/6f3p/data/saha16_1_1.0002", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [142.9, 85.74, 112.01, 90.0, 122.2, 90.0], "dmin": 1.35}, "tags": ["marccd"]},
|
|
{"id": "6g1f", "input": "6g1f/home/data/dls180217/mx13587-30/mat/DpgA-7-HA00AX9676/DpgA-7-HA00AX9676_1_0001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [329.28, 83.9, 133.42, 90.0, 111.58, 90.0], "dmin": 2.248}, "tags": ["cbf"]},
|
|
{"id": "6jgh", "input": "6jgh/6jgh/data/a_00001.img", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.641, 62.506, 68.179, 90.0, 90.0, 90.0], "dmin": 0.94}, "tags": ["marccd"]},
|
|
{"id": "6nen", "input": "6nen/Pm1tr_2_1_001.img", "ref": {"sg": "P 3 1 2", "sgno": 149, "cell": [105.501, 105.501, 35.132, 90.0, 90.0, 120.0], "dmin": 2.151}, "tags": ["smv"]},
|
|
{"id": "6qaj", "input": "6qaj/95_8_8_8_1_0001.cbf", "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [59.774, 169.332, 374.508, 90.0, 90.0, 90.0], "dmin": 2.901}, "tags": ["cbf"]},
|
|
{"id": "6s1u", "input": "6s1u/new_4_0001.img", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [51.603, 29.413, 85.533, 90.0, 103.75, 90.0], "dmin": 1.9}, "tags": ["marccd"]},
|
|
{"id": "6w75", "input": "6w75/IDP51000_6W75/data/idp51000-410-a_1_1_1.001", "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [166.245, 166.245, 98.279, 90.0, 90.0, 120.0], "dmin": 1.951}, "tags": ["marccd"]},
|
|
{"id": "6zqr", "input": "6zqr/ib23a11_M2S3_1_001.img", "ref": {"sg": "P 4", "sgno": 75, "cell": [113.6, 113.6, 44.08, 90.0, 90.0, 90.0], "dmin": 1.93}, "tags": ["smv"]},
|
|
{"id": "6zqy", "input": "6zqy/ib22b32_MS_1_001.img", "ref": {"sg": "P 4", "sgno": 75, "cell": [119.29, 119.29, 44.21, 90.0, 90.0, 90.0], "dmin": 1.85}, "tags": ["smv"]},
|
|
{"id": "6zr0", "input": "6zr0/ib23a23_dc_1_0001.cbf", "ref": {"sg": "P 4", "sgno": 75, "cell": [119.219, 119.219, 44.18, 90.0, 90.0, 90.0], "dmin": 1.94}, "tags": ["cbf"]},
|
|
{"id": "7ou1", "input": "7ou1/omega_1_0001.img", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [77.923, 91.308, 114.164, 90.0, 97.111, 90.0], "dmin": 1.65}, "tags": ["marccd"]},
|
|
{"id": "7raa", "input": "7raa/A6_1_00001.cbf", "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [66.372, 66.372, 298.302, 90.0, 90.0, 90.0], "dmin": 2.69}, "tags": ["cbf"]},
|
|
{"id": "9fcf", "input": "9fcf/IBCH-05-p03x03_3_00001.cbf.gz", "ref": {"sg": "P 4", "sgno": 75, "cell": [91.301, 91.301, 35.836, 90.0, 90.0, 90.0], "dmin": 2.36}, "tags": ["cbf"]},
|
|
{"id": "9h0q", "input": "9h0q/Bc2lCnter-pma127_2_master.h5", "ref": {"sg": "H 3 2", "sgno": 155, "cell": [169.506, 169.506, 344.036, 90.0, 90.0, 120.0], "dmin": 2.55}, "tags": ["h5"]},
|
|
{"id": "5ky6", "input": "5ky6/C11_1_001.img", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [84.511, 57.253, 164.016, 90.0, 102.57, 90.0], "dmin": 1.941}, "tags": ["marccd"]}
|
|
]}
|