Jungfraujoch/docs/EXTERNAL_TEST_DATA.md

External test data

Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only ever sees its own detectors is not tested. The datasets below were collected by other people, on detectors and in file formats we do not produce ourselves, and are used here to check that rugnux reads foreign files correctly and reduces them to sensible results. Most were collected at other facilities; a few come from SLS beamlines, where the data are still written by someone else's detector and someone else's acquisition system. Their authors published all of these for exactly this kind of reuse, and this page is where we credit them.

None of these data were collected by us. If you use any of them, cite the dataset DOI in the table below; the repositories themselves are cited in ACKNOWLEDGEMENT.

Where the values come from

• Source is the repository we downloaded from and that repository's own citable DOI for the archive we took. Every DOI on this page was resolved against DataCite - or, for 6NEN, whose DOI is registered with Crossref, against Crossref - before it was written down, and the identity of each dataset was taken from the repository's record for the archive - not from our directory names.
• Beamline, resolution, space group and cell are the values deposited with the PDB entry, read from the RCSB data API. They describe the published experiment. They are not our reprocessing results; no quantity measured by Jungfraujoch appears on this page.
• Detector is read out of the image files themselves - the NXmx /entry/instrument/detector/description, the miniCBF # Detector: header, the marCCD instrument header or the SMV key block - because the detector named in a PDB entry is often only approximate. Where the two differ, the difference is listed below the table.
• Anything that could not be established from one of those sources is left blank.

Datasets

PDB	Source	Facility / beamline	dmin (Å)	Space group	Unit cell a b c α β γ (Å, °)	Detector (from file)	Title
11IF	IRRMC 10.18430/M311IF	NSLS-II 19-ID	1.51	P 43	51.1 51.1 71.9 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2
36GK	IRRMC 10.18430/M336GK	CLSI 08ID-1	2.28	I 2 2 2	120.6 189.5 199.7 90.0 90.0 90.0	Dectris Eiger 9M	D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain
3INP	IRRMC 10.18430/m33inp	APS 21-ID-F	2.05	F 41 3 2	224.1 224.1 224.1 90.0 90.0 90.0	marCCD, 225 mm plate	2.05 Angstrom Resolution Crystal Structure of D-ribulose-phosphate 3-epimerase from Francisella tularensis.
3KY7	IRRMC 10.18430/m33ky7	APS 21-ID-G	2.35	P 43 3 2	125.2 125.2 125.2 90.0 90.0 90.0	marCCD, 300 mm plate	2.35 Angstrom resolution crystal structure of a putative tRNA (guanine-7-)-methyltransferase (trmD) from Staphylococcus aureus subsp. aureus MRSA252
5EBI	MXRDR 10.18150/9887707	BESSY 14.2	1.09	P 1 21 1	35.7 44.1 35.7 90.0 120.0 90.0	marCCD, 225 mm plate	Crystal structure of a DNA-RNA chimera in complex with Ba2+ ions: a case of unusual multi-domain twinning
5EPE	IRRMC 10.18430/m3159c	APS 21-ID-G	1.90	F 2 3	157.5 157.5 157.5 90.0 90.0 90.0	Rayonix MX-300	Crystal structure of SAM-dependent methyltransferase from Thiobacillus denitrificans in complex with S-Adenosyl-L-homocysteine
5F6M	SBGrid 10.15785/sbgrid/201	SSRL BL11-1	1.10	P 21 21 21	54.8 58.5 67.4 90.0 90.0 90.0	PILATUS 6M	Isotropic Trypsin Model for Comparison of Diffuse Scattering
5J23	IRRMC 10.18430/M35J23	APS 21-ID-G	2.30	H 3	175.8 175.8 136.8 90.0 90.0 120.0	Rayonix MX-300	Crystal structure of NADPH-dependent glyoxylate/hydroxypyruvate reductase SMc04462 (SmGhrB) from Sinorhizobium meliloti in complex with 2'-phospho-ADP-ribose
5JVN	IRRMC 10.18430/m35jvn	ESRF ID29	2.90	P 6 2 2	249.4 249.4 84.1 90.0 90.0 120.0	PILATUS3 6M	C3-type pyruvate phosphate dikinase: intermediate state of the swiveling-domain mechanism
5KY6	MXRDR 10.18150/repod.1494374	BESSY 14.2	1.94	P 1 21 1	84.5 57.3 164.0 90.0 102.6 90.0	marCCD, 225 mm plate	Human muscle fructose-1,6-bisphosphate aldolase
5LZL	Zenodo 10.5281/zenodo.54757	Diamond I02	3.47	P 31 2 1	205.6 205.6 199.2 90.0 90.0 120.0	PILATUS 6M-F	Pyrobaculum calidifontis 5-aminolaevulinic acid dehydratase
5M17	Zenodo 10.5281/zenodo.4300323	Diamond I02	1.03	I 4	108.6 108.6 67.7 90.0 90.0 90.0	PILATUS 6M-F	Structure of the GH99 endo-alpha-mannanase from Bacteroides xylanisolvens
5MLN	IRRMC 10.18430/m35mln	ESRF ID23-2	1.60	P 21 2 21	74.2 80.4 80.5 90.0 90.0 90.0	PILATUS3 2M	The crystal structure of alcohol dehydrogenase 10 from Candida magnoliae
5NW5	SBGrid 10.15785/sbgrid/446	SLS X06DA	6.50	P 21 21 21	92.1 169.8 390.2 90.0 90.0 90.0	PILATUS 2MF	Crystal structure of the Rif1 N-terminal domain (RIF1-NTD) from Saccharomyces cerevisiae in complex with DNA
5REO	Zenodo 10.5281/zenodo.3730956	Diamond I04-1	1.88	C 1 2 1	112.4 52.6 44.4 90.0 103.0 90.0	PILATUS 6M-F	PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578
5SRC	IRRMC 10.18430/M35SRC	ALS 8.3.1	1.05	P 43	88.7 88.7 39.2 90.0 90.0 90.0	PILATUS3 6M	PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers
5T39	SBGrid 10.15785/sbgrid/356	APS 21-ID-F	1.10	P 1 21 1	50.2 41.3 58.5 90.0 98.6 90.0	Rayonix MX-300	Crystal Structure of the N-terminal domain of EvdMO1 in the presence of SAH and D-fucose
6CDL	IRRMC 10.18430/m36cdl	APS 22-ID	1.25	P 21 21 2	58.3 85.9 46.1 90.0 90.0 90.0	marCCD, 300 mm plate	HIV-1 wild type protease with GRL-03214A, 6-5-5-ring fused umbrella-like tetrahydropyranofuran as the P2-ligand, a cyclopropylaminobenzothiazole as the P2'-ligand and 3,5-difluorophenylmethyl as the P1-ligand
6F3P	IRRMC 10.18430/M36F3P	APS 22-ID	1.35	C 1 2 1	142.9 85.7 112.0 90.0 122.2 90.0	marCCD, 300 mm plate	Crystal structure of S-adenosyl-L-homocysteine hydrolase from Pseudomonas aeruginosa in complex with 3'-deoxyadenosine and K+ cation
6FID	SBGrid 10.15785/sbgrid/541	ESRF ID30B	2.20	P 21 21 21	59.9 64.1 69.7 90.0 90.0 90.0	PILATUS3 6M	Bovine trypsin solved by S-SAD on ID30B
6FVZ	IRRMC 10.18430/m36fvz	ESRF ID23-2	1.80	C 2 2 2	131.2 222.8 86.5 90.0 90.0 90.0	PILATUS3 X 2M	Crystal structure of human monoamine oxidase B (MAO B) in complex with an inhibitor
6FWC	IRRMC 10.18430/m36fwc	ESRF MASSIF-3	1.70	C 2 2 2	131.7 222.1 86.3 90.0 90.0 90.0	PILATUS 2MF	Crystal structure of human monoamine oxidase B (MAO B) in complex with fluorophenyl-chromone-carboxamide
6G1F	Zenodo 10.5281/zenodo.1059413	Diamond I03	2.25	C 1 2 1	329.3 83.9 133.4 90.0 111.6 90.0	PILATUS3 6M	Crystal structure of D-phenylglycine aninotransferase (D-PhgAT) from Pseudomonas stutzeri with PLP internal aldimine
6H2P	IRRMC 10.18430/m36h2p	BESSY 14.1	1.48	C 2 2 21	103.5 107.1 216.5 90.0 90.0 90.0	PILATUS 6M	Crystal Structure of Arg184Gln mutant of Human Prolidase with Mn ions and Cacodylate ligand
6H5T	IRRMC 10.18430/m36h5t	BESSY 14.3	1.69	I 4 2 2	86.8 86.8 141.8 90.0 90.0 90.0	marCCD, 225 mm plate	Intersectin SH3A short isoform
6HV2	IRRMC 10.18430/m36hv2	SLS X06SA	1.71	P 61 2 2	68.9 68.9 133.6 90.0 90.0 120.0	Dectris Eiger 16M	MMP-13 in complex with the peptide IMISF
6HWJ	SBGrid 10.15785/sbgrid/614	ALBA XALOC	1.98	P 1 21 1	59.8 96.1 80.3 90.0 106.7 90.0	PILATUS 6M	Glucosamine kinase (crystal form A)
6I3J	IRRMC 10.18430/m36i3j	BESSY 14.1	2.59	F 2 2 2	134.4 203.8 226.7 90.0 90.0 90.0	marCCD, 225 mm plate	Bilirubin oxidase from Myrothecium verrucaria in complex with ferricyanide
6IU5	Zenodo 10.5281/zenodo.2532134	SPring-8 BL41XU	2.25	P 31	84.9 84.9 98.2 90.0 90.0 120.0	PILATUS3 6M	Crystal structure of cytoplasmic metal binding domain with zinc ions
6IU6	Zenodo 10.5281/zenodo.2532134	SPring-8 BL41XU	2.90	P 31	84.7 84.7 97.4 90.0 90.0 120.0	PILATUS3 6M	Crystal structure of cytoplasmic metal binding domain with nickel ions
6IU8	Zenodo 10.5281/zenodo.2532134	SPring-8 BL41XU	2.70	P 31	85.5 85.5 98.4 90.0 90.0 120.0	PILATUS3 6M	Crystal structure of cytoplasmic metal binding domain with cobalt
6IU9	Zenodo 10.5281/zenodo.2532134	SPring-8 BL41XU	3.00	P 31	85.3 85.3 97.6 90.0 90.0 120.0	PILATUS3 6M	Crystal structure of cytoplasmic metal binding domain with iron ions
6JGH	IRRMC 10.18430/m36jgh	SPring-8 BL44XU	0.94	P 21 21 21	50.6 62.5 68.2 90.0 90.0 90.0	marCCD, 300 mm plate	Crystal structure of the F99S/M153T/V163A/T203I variant of GFP at 0.94 A
6JGI	IRRMC 10.18430/m36jgi	SPring-8 BL44XU	0.85	P 21 21 21	50.9 62.4 69.2 90.0 90.0 90.0	marCCD, 300 mm plate	Crystal structure of the S65T/F99S/M153T/V163A variant of GFP at 0.85 A
6JGJ	IRRMC 10.18430/m36jgj	SPring-8 BL41XU	0.77	P 21 21 21	50.9 62.3 68.8 90.0 90.0 90.0	PILATUS3 300K	Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A
6MOJ	SBGrid 10.15785/sbgrid/620	ALS 5.0.1	2.43	I 41 2 2	130.4 130.4 293.5 90.0 90.0 90.0	PILATUS3 6M	Dimeric DARPin A_angle_R5 complex with EpoR
6NEN	UQ eSpace 10.14264/uql.2018.843	Australian Synchrotron MX2	2.15	P 3 1 2	105.5 105.5 35.1 90.0 90.0 120.0	SMV, S/N 928	Catalytic domain of Proteus mirabilis ScsC
6O2H	SBGrid 10.15785/sbgrid/747	CHESS F1	1.21	P 1	27.4 32.1 34.5 88.7 108.5 111.9	PILATUS3 6M	Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset
6OEL	SBGrid 10.15785/sbgrid/652	ALS 8.2.1	3.10	F 41 3 2	328.1 328.1 328.1 90.0 90.0 90.0	SMV, S/N 905	Engineered Fab bound to IL-4 receptor
6P8P	SBGrid 10.15785/sbgrid/673	APS 24-ID-C	1.64	P 4	97.5 97.5 60.1 90.0 90.0 90.0	PILATUS 6M-F	Structure of P. aeruginosa ATCC27853 HORMA1
6PB3	SBGrid 10.15785/sbgrid/681	APS 24-ID-E	2.05	P 6	100.4 100.4 48.9 90.0 90.0 120.0	Dectris Eiger 16M	Structure of Rhizobiales Trip13
6PXB	SBGrid 10.15785/sbgrid/698	APS 24-ID-E	1.75	P 32	64.0 64.0 119.4 90.0 90.0 120.0	PILATUS 6M-F	N-Terminal SH2 domain of the p120RasGAP
6PXC	SBGrid 10.15785/sbgrid/699	APS 24-ID-E	1.60	I 2 2 2	44.2 64.8 87.2 90.0 90.0 90.0	PILATUS 6M-F	N-Terminal SH2 domain of the p120RasGAP bound to a p190RhoGAP phosphotyrosine peptide
6QAJ	SBGrid 10.15785/sbgrid/637	Diamond I03	2.90	C 2 2 21	59.8 169.3 374.5 90.0 90.0 90.0	PILATUS3 6M	Structure of the tripartite motif of KAP1/TRIM28
6R72	Zenodo 10.5281/zenodo.14894181	SOLEIL PROXIMA 2	3.95	P 1 21 1	117.8 110.8 155.6 90.0 93.2 90.0	Dectris Eiger 9M	Crystal structure of BmrA-E504A in an outward-facing conformation
6RLR	Zenodo 10.5281/zenodo.5886687	Diamond I04	2.00	P 1	40.0 40.0 63.6 80.4 76.3 68.2	Eiger 16M	Crystal structure of CD9 large extracellular loop
6S1U	MXRDR 10.18150/repod.0005795	BESSY 14.2	1.90	P 1 21 1	51.6 29.4 85.5 90.0 103.8 90.0	marCCD, 225 mm plate	Crystal structure of dimeric M-PMV protease C7A/D26N/C106A mutant in complex with inhibitor
6TOC	Zenodo 10.5281/zenodo.3571040	SLS X06DA	1.85	P 42	31.5 31.5 81.6 90.0 90.0 90.0	PILATUS 2MF	Crystal structure of the oligomerisation domain of the transcription factor PHOSPHATE STARVATION RESPONSE 1 from Arabidopsis (crystal form 3).
6TTN	IRRMC 10.18430/m36ttn	BESSY 14.1	1.12	P 21 21 21	39.9 79.8 104.7 90.0 90.0 90.0	PILATUS 6M	N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine
6U7G	IRRMC 10.18430/m36u7g	APS 23-ID-B	2.35	P 1 21 1	99.6 98.7 147.5 90.0 104.6 90.0	Dectris Eiger 16M	HCoV-229E RBD Class V in complex with human APN
6UKF	IRRMC 10.18430/m36ukf	APS 22-ID	1.00	P 1 21 1	61.0 37.3 69.0 90.0 109.8 90.0	Dectris Eiger 16M	HhaI endonuclease in Complex with DNA at 1 Angstrom Resolution
6VWW	IRRMC 10.18430/m36vww	APS 19-ID	2.20	P 63	150.5 150.5 111.3 90.0 90.0 120.0	PILATUS3 6M	Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2.
6W4H	IRRMC 10.18430/m36w4h	APS 21-ID-F	1.80	P 31 2 1	167.7 167.7 51.9 90.0 90.0 120.0	Rayonix MX-300	1.80 Angstrom Resolution Crystal Structure of NSP16 - NSP10 Complex from SARS-CoV-2
6W75	IRRMC 10.18430/m36w75	APS 21-ID-F	1.95	P 32 2 1	166.2 166.2 98.3 90.0 90.0 120.0	Rayonix MX-300	1.95 Angstrom Resolution Crystal Structure of NSP10 - NSP16 Complex from SARS-CoV-2
6WZO	SBGrid 10.15785/sbgrid/785	APS 24-ID-E	1.42	P 1	43.7 50.1 69.3 106.5 90.1 97.1	Dectris Eiger 16M	Structure of SARS-CoV-2 Nucleocapsid dimerization domain, P1 form
6YQF	IRRMC 10.18430/m36yqf	Diamond I24	3.33	P 21 21 2	42.7 59.7 156.5 90.0 90.0 90.0	PILATUS3 6M	Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly
6Z8O	Zenodo 10.5281/zenodo.3873216	ESRF ID30B	2.20	P 1 21 1	63.7 97.0 121.3 90.0 104.7 90.0	Dectris Eiger 4M	Structure of [NiFeSe] hydrogenase G491A variant from Desulfovibrio vulgaris Hildenborough pressurized with Krypton gas - structure G491A-Kr
6ZE4	SBGrid 10.15785/sbgrid/806	BESSY 14.1	1.60	P 21 21 21	93.6 109.9 116.1 90.0 90.0 90.0	PILATUS 6M	FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide
6ZQR	Keele University 10.21252/r2nx-0425	Diamond I02	1.93	P 4	113.6 113.6 44.1 90.0 90.0 90.0	SMV, S/N 922	Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with GlcNAc ligand bound
6ZQY	Keele University 10.21252/hx7e-rd04	Diamond I04	1.85	P 4	119.3 119.3 44.2 90.0 90.0 90.0	SMV, S/N 921	Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with Neu5Ac ligand bound
6ZR0	Keele University 10.21252/zcfy-cw20	Diamond I04	1.94	P 4	119.2 119.2 44.2 90.0 90.0 90.0	PILATUS 6M Prosport+	Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with N-acetylalanine ligand bound
7ARR	MXRDR 10.18150/EM87YL	PETRA III, EMBL c/o DESY P13 (MX1)	1.10	P 1	30.9 32.1 43.1 114.2 91.9 109.9	PILATUS 6M-F	The de novo designed hybrid alpha/beta-miniprotein
7ATG	IRRMC 10.18430/m37atg	PETRA III, EMBL c/o DESY P13 (MX1)	0.60	P 21 21 21	18.0 31.0 43.9 90.0 90.0 90.0	PILATUS 6M-F	Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution
7BGT	MXRDR 10.18150/1HQGWO	BESSY 14.2	1.93	P 1	29.3 67.6 69.7 76.8 83.9 83.6	marCCD, 225 mm plate	Mason-Pfizer Monkey Virus Protease mutant C7A/D26N/C106A in complex with peptidomimetic inhibitor
7D1M	IRRMC 10.18430/m37brr	SSRF BL17U1	1.35	P 1 21 1	55.5 99.0 59.6 90.0 108.5 90.0	Dectris Eiger 16M	CRYSTAL STRUCTURE OF THE SARS-CoV-2 MAIN PROTEASE COMPLEXED WITH GC376
7DKP	IRRMC 10.18430/M37DKP	ESRF MASSIF-3	1.45	P 1 21 1	49.8 169.5 49.8 90.0 93.5 90.0	Dectris Eiger 4M	Crystal structure of E. coli Grx2 in complex with GSH at 1.45 A resolution
7K1L	IRRMC 10.18430/m37k1l	APS 19-ID	2.25	P 63	150.8 150.8 110.7 90.0 90.0 120.0	PILATUS3 6M	Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate
7KCN	IRRMC 10.18430/m37kcn	LNLS W01B-MX2	1.46	P 41 2 2	67.0 67.0 116.9 90.0 90.0 90.0	PILATUS 2M	Reconstructed ancestor of HIUases and Transthyretins
7L6J	IRRMC 10.18430/m37l6j	APS 21-ID-F	1.78	I 41 3 2	171.7 171.7 171.7 90.0 90.0 90.0	Rayonix MX-300	Crystal Structure of the Putative Hydrolase from Stenotrophomonas maltophilia
7L84	SBGrid 10.15785/sbgrid/816	APS 24-ID-C	1.60	P 43 21 2	79.3 79.3 37.8 90.0 90.0 90.0	PILATUS 6M-F	Hen Egg White Lysozyme by Native S-SAD at Room Temperature
7MZT	IRRMC 10.18430/m37mzt	APS 22-ID	4.07	P 21 21 2	113.6 97.0 108.3 90.0 90.0 90.0	Dectris Eiger 16M	Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A
7N0I	SBGrid 10.15785/sbgrid/835	ALS 5.0.2	2.20	P 21 21 21	75.8 131.6 140.0 90.0 90.0 90.0	PILATUS3 6M	Structure of the SARS-CoV-2 N protein C-terminal domain bound to single-domain antibody E2
7N2S	SBGrid 10.15785/sbgrid/916	SSRL BL12-1	2.37	P 1 21 1	83.2 52.8 106.3 90.0 98.3 90.0	PILATUS 6M	AS3.1-PRPF3-HLA*B27
7ORR	IRRMC 10.18430/M37ORR	MAX IV BioMAX	1.79	I 21 3	105.9 105.9 105.9 90.0 90.0 90.0	Dectris Eiger 16M	Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022
7OS3	MXRDR 10.18150/74YTYQ	PETRA III, EMBL c/o DESY P13 (MX1)	2.18	P 21 21 21	78.2 91.0 105.8 90.0 90.0 90.0	PILATUS 6M-F	Crystal structure of Rhizobium etli inducible L-asparaginase
7OU1	MXRDR 10.18150/VQQIHQ	BESSY 14.3	1.65	P 1 21 1	77.9 91.3 114.2 90.0 97.1 90.0	marCCD, 225 mm plate	Crystal structure of Rhizobium etli inducible L-asparaginase ReAV (monoclinic form MP2)
7PH1	IRRMC 10.18430/M37PH1	BESSY 14.2	1.18	I 2 2 2	75.0 81.3 124.2 90.0 90.0 90.0	PILATUS3 2M	Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid
7PQ7	IRRMC 10.18430/M3.IRRMC.6072	ELETTRA 11.2C	1.55	C 1 2 1	120.9 51.7 75.5 90.0 125.1 90.0	PILATUS 6M	Crystal structure of Campylobacter jejuni DsbA1
7QIJ	SBGrid 10.15785/sbgrid/907	PETRA III, EMBL c/o DESY P13 (MX1)	4.10	P 21 21 21	143.5 324.9 369.4 90.0 90.0 90.0	PILATUS 6M-F	Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY
7QIS	IRRMC 10.18430/M37QIS	BESSY 14.2	1.83	P 61	100.3 100.3 206.2 90.0 90.0 120.0	PILATUS3 2M	CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX
7RAA	SBGrid 10.15785/sbgrid/881	SSRL BL12-2	2.69	P 43 21 2	66.4 66.4 298.3 90.0 90.0 90.0	PILATUS 6M	Designed StabIL-2 seq15
7RIS	IRRMC 10.18430/M37RIS	APS 21-ID-D	1.72	P 32 2 1	44.5 44.5 189.9 90.0 90.0 120.0	Dectris Eiger 9M	Crystal structure of RPA3624, a beta-propeller lactonase from Rhodopseudomonas palustris, with active-site bound phosphate
7RJI	IRRMC 10.18430/M37RJI	LNLS W01B-MX2	1.71	H 3 2	83.0 83.0 124.8 90.0 90.0 120.0	PILATUS 2M	BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid
7T5T	SBGrid 10.15785/sbgrid/864	SSRL BL9-2	1.35	P 42 21 2	95.3 95.3 104.9 90.0 90.0 90.0	PILATUS 6M	Structure of Thauera sp. K11 CapP
7TCD	IRRMC 10.18430/m37tcd	SLS X06SA	1.70	C 1 2 1	138.5 47.9 78.1 90.0 107.6 90.0	Dectris Eiger 16M	LOV2-DARPIN fusion: D13
7YZX	IRRMC 10.18430/M37YZX	Diamond I24	1.90	P 63 2 2	169.4 169.4 141.8 90.0 90.0 120.0	PILATUS3 6M	ScpA from Streptococcus pyogenes, D783A mutant.
8A1A	IRRMC 10.18430/M38A1A	SLS X06SA	2.05	P 65	191.9 191.9 122.4 90.0 90.0 120.0	Dectris Eiger 16M	Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct
8AGQ	IRRMC 10.18430/M38AGQ	SLS X06DA	1.09	C 1 2 1	89.9 55.4 54.8 90.0 113.5 90.0	PILATUS 2MF	Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione
8DQB	IRRMC 10.18430/m38dqb	NSLS-II 19-ID	2.50	I 2 3	164.1 164.1 164.1 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal structure of 3-dehydroquinate dehydratase I from Klebsiella oxytoca (I23 Form)
8DYZ	SBGrid 10.15785/sbgrid/957	CHESS F1	1.27	P 43 21 2	79.6 79.6 38.3 90.0 90.0 90.0	PILATUS3 6M	Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset
8DZ7	SBGrid 10.15785/sbgrid/958	CHESS F1	1.34	P 21 21 21	30.5 56.4 73.9 90.0 90.0 90.0	PILATUS3 6M	Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset
8EGN	IRRMC 10.18430/M38EGN	CLSI 08B1-1	1.95	P 21 21 21	71.7 75.2 109.8 90.0 90.0 90.0	PILATUS3 6M	Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701
8IYA	IRRMC 10.18430/m38iya	SSRF BL02U1	2.43	C 1 2 1	102.7 50.1 109.2 90.0 91.8 90.0	Dectris EIGER2 Si 9M	Complex of SETDB1-derived peptide bound to UBE2E1
8K1G	IRRMC 10.18430/M38K1G	PAL/PLS 11C	2.09	I 4 2 2	182.0 182.0 80.7 90.0 90.0 90.0	PILATUS3 6M	Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae
8OIC	IRRMC 10.18430/m38oic	Diamond I04	2.80	P 1	73.1 94.7 120.6 105.1 90.0 93.8	Eiger 16M	Trichomonas vaginalis riboside hydrolase (His-tagged)
8OWM	MXRDR 10.18150/II5MT4	PETRA III, EMBL c/o DESY P13 (MX1)	1.70	P 1	95.5 95.6 95.8 90.4 93.6 117.8	Dectris Eiger 16M	Crystal structure of glutamate dehydrogenase 2 from Arabidopsis thaliana binding Ca, NAD and 2,2-dihydroxyglutarate
8PQD	IRRMC 10.18430/m38pqd	ESRF MASSIF-3	1.50	P 21 21 21	59.4 59.4 192.9 90.0 90.0 90.0	Dectris Eiger 4M	c-KIT kinase domain in complex with avapritinib derivative 10
8QAW	MXRDR 10.18150/INUP4Q	PETRA III, EMBL c/o DESY P13 (MX1)	1.55	H 3	137.7 137.7 265.9 90.0 90.0 120.0	Dectris Eiger 16M	Medicago truncatula HISN5 (IGPD) in complex with MN, IMD, EDO, FMT, GOL and TRS
8QJ5	IRRMC 10.18430/m38qj5	ELETTRA 11.2C	1.63	P 1 21 1	57.6 100.6 77.9 90.0 96.1 90.0	PILATUS 6M	Crystal structure of the Levansucrase beta from Pseudomonas syringae pv. actinidiae
8QQ7	Zenodo 10.5281/zenodo.14901515	ESRF MASSIF-1	3.62	P 64 2 2	146.0 146.0 153.6 90.0 90.0 120.0	PILATUS3 2M	Structure of SpNOX: a Bacterial NADPH oxidase
8R5R	IRRMC 10.18430/m38r5r	ESRF ID23-1	3.08	P 21 21 21	91.7 132.9 137.5 90.0 90.0 90.0	Dectris EIGER2 CdTe 16M	Structure of apo TDO with a bound inhibitor
8RUD	MXRDR 10.18150/RBG2F9	PETRA III, EMBL c/o DESY P13 (MX1)	2.10	P 1 21 1	78.1 91.4 114.5 90.0 96.9 90.0	Dectris Eiger 16M	Crystal structure of Rhizobium etli L-asparaginase ReAV K138A mutant
8S38	MXRDR 10.18150/CGLBVH	PETRA III, EMBL c/o DESY P13 (MX1)	1.89	I 21 21 21	95.4 163.1 219.0 90.0 90.0 90.0	PILATUS 6M-F	Crystal structure of Medicago truncatula glutamate dehydrogenase 2 in complex with citrate and NAD
8SA8	IRRMC 10.18430/M38SA8	NSLS-II 19-ID	1.30	I 1 2 1	87.9 131.5 165.4 90.0 104.5 90.0	Dectris EIGER2 Si 9M	Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form)
8SQO	IRRMC 10.18430/m38sqo	NSLS-II 19-ID	1.55	P 4 3 2	112.9 112.9 112.9 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (magnesium bound, F16L mutant)
8SQQ	IRRMC 10.18430/M38SQQ	NSLS-II 19-ID	2.25	F 4 3 2	171.5 171.5 171.5 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant)
8SQT	IRRMC 10.18430/M38SQT	NSLS-II 19-ID	2.20	F 4 3 2	170.7 170.7 170.7 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant)
8T7R	IRRMC 10.18430/M38T7R	APS 22-ID	3.84	C 1 2 1	357.1 259.6 255.4 90.0 133.1 90.0	Dectris Eiger 16M	Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07
8THA	IRRMC 10.18430/m38tha	SSRL BL9-2	1.68	P 64	69.2 69.2 29.1 90.0 90.0 120.0	PILATUS 6M	1TEL, non-compressed, double-helical crystal form
8TYY	SBGrid 10.15785/sbgrid/1040	APS 24-ID-E	1.68	F 4 3 2	214.9 214.9 214.9 90.0 90.0 90.0	Dectris Eiger 16M	Structure of a bacterial Ubl-deubiquitinase complex (form 2)
8U0I	IRRMC 10.18430/m38u0i	ALS 8.2.1	1.54	P 43 21 2	50.3 50.3 90.6 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal structure of PA0012 complexed with cyclic-di-GMP from Pseudomonas aeruginosa
8V4O	IRRMC 10.18430/m38v4o	NSLS-II 19-ID	2.70	P 61 2 2	139.5 139.5 545.0 90.0 90.0 120.0	Dectris EIGER2 Si 9M	Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans
8XBP	IRRMC 10.18430/M38XBP	SOLEIL PROXIMA 1	1.99	C 1 2 1	148.3 50.8 60.2 90.0 92.3 90.0	Dectris Eiger 16M	Crystal structure of AtNATA1 bound to Acetyl CoA
8XTE	SBGrid 10.15785/sbgrid/1101	SSRF BL19U1	1.99	P 32	208.8 208.8 67.2 90.0 90.0 120.0	PILATUS3 6M	Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP
8XTF	SBGrid 10.15785/sbgrid/1102	SSRF BL02U1	2.13	H 3 2	211.8 211.8 67.4 90.0 90.0 120.0	Dectris EIGER2 Si 9M	Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C
8XTG	SBGrid 10.15785/sbgrid/1100	SSRF BL19U1	2.00	P 32	199.5 199.5 67.2 90.0 90.0 120.0		Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA
8Y74	XRDa 10.51093/xrd-00227	SSRF BL02U1	1.90	C 1 2 1	125.8 76.6 87.1 90.0 92.4 90.0	Dectris EIGER2 Si 9M	Crystal structure of 9-mer peptide from H9N2 avian influenza virus in complex with BF2*0201
8YS9	IRRMC 10.18430/M38YS9	PAL/PLS 5C (4A)	1.46	P 21 21 21	71.0 77.7 83.2 90.0 90.0 90.0	Dectris Eiger 9M	Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH
9B22	IRRMC 10.18430/m39b22	NSLS-II 19-ID	1.30	P 1 21 1	39.8 92.7 57.7 90.0 91.7 90.0	Dectris EIGER2 Si 9M	Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound)
9BN8	IRRMC 10.18430/m39bn8	NSLS-II 19-ID	1.35	P 41	65.5 65.5 134.8 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19
9C18	Zenodo 10.5281/zenodo.11405662	NSLS-II 17-ID-1	1.90	P 1	41.9 42.0 60.2 84.1 87.2 63.7	Dectris EIGER1 Si 9M	Human biliverdin IX beta reductase in complex with NADP
9CHW	SBGrid 10.15785/sbgrid/1124	APS 21-ID-F	2.16	P 61	98.7 98.7 82.1 90.0 90.0 120.0	Rayonix MX-300	Crystal structure of human polymerase eta with incoming dAMPnPP nucleotide opposite threofuranosyl thymidine in DNA template
9CRW	IRRMC 10.18430/m39crw	CLSI 08ID-1	2.49	P 1 21 1	84.0 104.6 118.8 90.0 93.4 90.0	Dectris Eiger 9M	Crystal structure of the Candida albicans kinesin-8 proximal tail domain
9E2T	SBGrid 10.15785/sbgrid/1148	SSRL BL12-1	2.28	P 1	75.5 78.1 101.2 94.6 103.4 114.5	Dectris EIGER2 Si 16M	Structure of a de novo designed interleukin-21 mimetic complex
9EA5	SBGrid 10.15785/sbgrid/1142	SSRL BL9-2	2.00	P 1 21 1	65.9 73.1 98.4 90.0 108.7 90.0	PILATUS 6M	Structure of Citrobacter BubCD D104A mutant
9FCF	MXRDR 10.18150/DGZKW3	PETRA III, EMBL c/o DESY P13 (MX1)	2.36	P 4	91.3 91.3 35.8 90.0 90.0 90.0	Dectris EIGER1 Si 16M	Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with ProFAR
9FCG	MXRDR 10.18150/LDLSBT	PETRA III, EMBL c/o DESY P13 (MX1)	1.54	P 4	87.8 87.8 35.6 90.0 90.0 90.0	Dectris EIGER1 Si 16M	Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with PrFAR
9FHC	Zenodo 10.5281/zenodo.11472085	SLS X06SA	2.20	I 2 3	227.5 227.5 227.5 90.0 90.0 90.0	marCCD, 225 mm plate	Crystallographic structure of AcrB V612F with bound minocycline
9GDJ	ESRF 10.15151/ESRF-DC-1848199439	ESRF ID23-1	1.47	P 41 21 2	123.9 123.9 126.4 90.0 90.0 90.0	Dectris EIGER2 CdTe 16M	C-Methyltransferase SgMT from Streptomyces griseoviridis
9GJX	IRRMC 10.18430/M39GJX	Diamond I04	2.40	P 1 21 1	76.8 115.8 103.8 90.0 110.3 90.0	Eiger 16M	Bacillus licheniformis nitroreductase
9GQG	ESRF 10.15151/ESRF-DC-1900353437	ESRF ID30B	2.00	P 32 2 1	48.2 48.2 188.0 90.0 90.0 120.0	Dectris EIGER2 Si 9M	The FK1 domain of FKBP51 in complex with the macrocyclic SAFit analog m5(10,7)-(E)-OH
9H0Q	Zenodo 10.5281/zenodo.13912326	SOLEIL PROXIMA 2	2.55	H 3 2	169.5 169.5 344.0 90.0 90.0 120.0	Dectris EIGER1 Si 9M	N terminal domain of BC2L-C lectin in complex with N-(beta-L-Fucopyranosyl)-biphenyl-3-carboxamide
9HNC	MXRDR 10.60884/0K7B68	PETRA III, EMBL c/o DESY P13 (MX1)	1.88	P 1 2 1	123.8 123.6 187.7 90.0 90.1 90.0	PILATUS 6M-F	Crystal structure of potassium-independent L-asparaginase
9HS7	IRRMC 10.18430/M39HS7	ALBA XALOC	1.70	P 65	65.4 65.4 88.8 90.0 90.0 120.0	PILATUS3 X 6M	Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER
9I0A	IRRMC 10.18430/M39I0A	SOLEIL PROXIMA 1	2.22	P 21 21 2	75.2 98.7 208.6 90.0 90.0 90.0	Dectris Eiger 16M	CARM1 in complex with arg-aDMA analog
9I80	Zenodo 10.5281/zenodo.14844040	SOLEIL PROXIMA 1	1.95	P 41	81.2 81.2 165.0 90.0 90.0 90.0	Dectris Eiger 16M	LecA in complex with a tolcapone derivative glycomimetic
9IG7	IRRMC 10.18430/M39IG7	PETRA III, EMBL c/o DESY P13 (MX1)	2.60	P 21 21 2	111.5 153.5 69.0 90.0 90.0 90.0	Dectris EIGER1 Si 16M	KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides
9IH9	IRRMC 10.18430/M39IH9	ESRF MASSIF-3	1.70	C 1 2 1	78.8 133.9 82.3 90.0 101.4 90.0	Dectris EIGER1 Si 4M	KEAP1 complexed to linear peptide 6
9JZO	IRRMC 10.18430/m39jzo	PAL/PLS 11C	1.40	P 1	41.6 43.1 54.2 113.0 90.1 118.2	PILATUS3 6M	Crystal structure of PHICD111_20024_EAD.
9KHR	Zenodo 10.5281/zenodo.14070468	RRCAT INDUS-2 PX-BL21	2.00	P 21 21 21	48.7 50.3 78.0 90.0 90.0 90.0	marCCD, 225 mm plate	Crystal structure of Plasmoredoxin, a disulfide oxidoreductase from Plasmodium falciparum crystallized in the presence of Dithiothreitol (DTT)
9MH4	IRRMC 10.18430/M39MH4	NSLS-II 19-ID	3.05	P 21 3	138.7 138.7 138.7 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes
9MIN	SBGrid 10.15785/sbgrid/1151	ALS 8.2.1	2.05	P 21 21 21	95.5 98.5 155.7 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Structure of a designed minibinder to NYESO1-A*02:01
9O0H	IRRMC 10.18430/M39O0H	SSRL BL12-2	2.24	P 21 21 21	55.2 65.5 112.9 90.0 90.0 90.0	Dectris EIGER2 Si 16M	The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker
9P7Q	IRRMC 10.18430/M39P7Q	SSRL BL12-1	2.21	C 1 2 1	97.0 45.0 72.1 90.0 105.1 90.0	Dectris EIGER2 Si 16M	273K human S-adenosylmethionine decarboxylase
9PBB	IRRMC 10.18430/M39PBB	SSRL BL12-1	2.17	C 1 2 1	97.4 45.9 72.2 90.0 105.0 90.0	Dectris EIGER2 Si 16M	293K human S-adenosylmethionine decarboxylase
9Q41	SBGrid 10.15785/sbgrid/1194	CHESS 7B2	1.95	C 2 2 21	118.6 133.7 82.4 90.0 90.0 90.0	Dectris EIGER2 Si 16M	Crystal Structure of Human Apo Spermidine Synthase
9Q66	SBGrid 10.15785/sbgrid/1208	NSLS-II 17-ID-1	2.01	P 1 21 1	105.9 67.3 158.0 90.0 99.1 90.0	Dectris EIGER1 Si 9M	Human prolyl endopeptidase (PREP) - complex with JP-4-1-7
9QW8	ESRF 10.15151/ESRF-DC-2127908021	ESRF ID23-1	1.80	P 1	35.6 35.6 100.9 86.5 84.2 72.5	Dectris EIGER2 CdTe 16M	FKBP12 in complex with bifunctional ligand 1ad
9RCI	Zenodo 10.5281/zenodo.15615368	SOLEIL PROXIMA 2	1.66	P 1	35.9 39.3 100.9 98.3 90.3 90.1	Dectris Eiger 9M	Crystal Structure of Flap Endonuclease FEN1 with Compound 28
9RCS	XRDa 10.51093/xrd-00383	Diamond I24	3.01	P 1 21 1	70.0 78.8 82.3 90.0 88.6 90.0	Eiger 9M	Cardioderma bat coronavirus KY43 receptor binding domain in complex with human CEACAM6
9RP9	IRRMC 10.18430/M39RP9	SOLEIL PROXIMA 1	2.10	C 1 2 1	73.5 59.8 91.7 90.0 100.8 90.0	Dectris Eiger 16M	Crystal structure of mouse pVHL-ElonginB-ElonginC complex
9SL0	IRRMC 10.18430/M39SL0	ESRF MASSIF-1	1.60	P 21 21 21	60.2 80.2 111.6 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal structure of HLA-A0201 in complex with peptide LLWNGPMAV
9T6S	SBGrid 10.15785/sbgrid/1260	ESRF ID30B	2.00	P 21 21 21	63.0 64.6 102.7 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of the Listeria monocytogenes CadC with Cadmium
9UPT	XRDa 10.51093/xrd-00191	NSRRC TPS 05A	2.37	P 6	158.3 158.3 54.0 90.0 90.0 120.0	SMV, S/N 930	Structure of AtBgl1A, a GH1 beta-Glucosidase from Acetivibrio thermocellus
9VX7	IRRMC 10.18430/M39VX7	PAL/PLS 5C (4A)	4.85	P 64	122.5 122.5 118.9 90.0 90.0 120.0	PILATUS3 6M	Transcription factor
9VYB	IRRMC 10.18430/M39VYB	PAL/PLS 5C (4A)	2.12	P 21 21 21	44.4 47.8 48.4 90.0 90.0 90.0	Dectris Eiger 9M	Antitoxin Phd
9W3Y	IRRMC 10.18430/M39W3Y	Photon Factory BL-1A	1.50	P 21 21 21	60.7 70.0 94.2 90.0 90.0 90.0	Dectris EIGER1 Si 4M	X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6)
9YL4	Zenodo 10.5281/zenodo.17298261	APS 17-ID	3.70	P 21 21 21	95.8 111.3 403.0 90.0 90.0 90.0	PILATUS 6M	Crystal structure of PprA S-F filament from Deinococcus radiodurans
9YZK	IRRMC 10.18430/M39YZK	ALS 8.2.2	4.44	I 1 2 1	75.8 163.0 192.3 90.0 98.6 90.0	PILATUS3 S 2M	Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
9Z44	IRRMC 10.18430/M39Z44	ALS 8.2.1	7.20	I 1 2 1	73.5 127.7 141.2 90.0 92.0 90.0	Dectris EIGER2 Si 9M	Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain
9Z72	SBGrid 10.15785/sbgrid/1239	SSRL BL9-2	2.38	P 31 2 1	59.2 59.2 426.2 90.0 90.0 120.0	Dectris EIGER2 Si 16M	Structure of V. cholerae CapS (form 1)
9ZLO	Zenodo 10.5281/zenodo.18652652	Australian Synchrotron MX2	2.00	P 21 21 21	38.4 90.0 107.0 90.0 90.0 90.0	Dectris EIGER1 Si 16M	Crystal structure of Proteus mirabilis UreE
9ZM0	IRRMC 10.18430/M39ZM0	NSLS-II 17-ID-1	2.10	P 1 21 1	50.4 30.1 91.2 90.0 97.1 90.0	Dectris EIGER1 Si 9M	Crystal structure of monomeric Atg23
9ZMU	IRRMC 10.18430/M39ZMU	NSLS-II 19-ID	1.98	P 65 2 2	47.8 47.8 492.6 90.0 90.0 120.0	Dectris EIGER2 Si 9M	Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form)
—	Zenodo 10.5281/zenodo.1036416	Diamond Light Source I19-1				PILATUS 2M	0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1
—	Zenodo 10.5281/zenodo.14894181					Dectris Eiger 9M	Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation
—	Zenodo 10.5281/zenodo.20041091	Diamond Light Source I19-2				Eiger 2X 4M (CdTe)	Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor
—	Zenodo 10.5281/zenodo.20135265	Diamond Light Source I19-2				Eiger 2X 4M (CdTe)	Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor
—	Zenodo 10.5281/zenodo.6347466	Diamond Light Source I19-2				Eiger 2X 4M (CdTe)	Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source
—	Zenodo 10.5281/zenodo.33555	Diamond Light Source I19-1				PILATUS 2M	Example Cytidine data set from I19-1 at Diamond Light Source
—	Zenodo 10.5281/zenodo.11946282	Diamond Light Source I19				PILATUS 2M	RODIN X-ray Diffraction Data 2360282 (L-alanine)

Seven rows have no PDB code. Six are small-molecule / chemical-crystallography datasets, kept because they exercise short wavelengths, CdTe sensors, fine slicing and non-zero detector 2θ; the seventh is the second collection in the 6R72 Zenodo record, described below. They have no deposited macromolecular values, so those columns are blank, and their titles are the repository record titles verbatim.

Five datasets are in primitive space groups with no screw axis - 6ZQR, 6ZQY, 6ZR0 and 9FCF in P 4, and 6NEN in P 3 1 2. They are in the battery as negative controls for screw-axis detection: the correct answer for each has no systematic absences.

Archives that are not a single sweep

Most rows above are a single continuous rotation. The archives described in this section are not, or needed special handling to obtain the images; their layout is read from the image files themselves, from the repository file listings and from the depositors' own description of the record. Not every archive in the table has had its layout audited to this depth. Where an archive held more than one collection, only one is kept - the repository's project page is not a reliable guide to this, because it describes the project rather than the tarball (7TCD's page lists a 900-frame miniCBF sweep the archive does not contain).

6R72 - two collections on one crystal. The Zenodo record holds two complete 360° sweeps of 3600 × 0.1° frames taken from the same crystal: a helical collection, which produced the deposited structure, and a low-dose collection from a single position, which was not used for a deposition and therefore has no PDB entry. Both are in the table, sharing one DOI; the deposited values belong to the helical collection only. The record also ships the authors' XDS.INP.

The three CHESS depositions - wedges plus a measured background. Each crystal was rotated in 50° wedges of 500 × 0.1° frames and translated between wedges to spread the dose. Each crystal also has a rotation at 1° per frame taken with the crystal translated out of the beam, which the depositors include as a measured background and say can be matched to the diffraction frames by the phi value in the image header.

PDB	Crystals	Wedges per crystal	Background rotation
8DYZ	1	8	360 frames
8DZ7	2	4	200 frames per crystal
6O2H	4	1, 3, 2, 5 - 11 in all	50, 145, 95, 235 frames, one per crystal

Seven IRRMC archives hold more than one collection. In six of them one sweep is kept and the rest were deleted, so a run over the data directory sees a single collection per dataset. 7RIS is the exception: its two sweeps are at different wavelengths and both are kept.

PDB	What the archive holds	Kept
6UKF	two sweeps on one crystal - 960 x 0.25° (240°) and 1440 x 0.25° (360°)	the 360° sweep
7DKP	two complete 360° sweeps on one crystal, 3° apart in ω	the first
9PBB	two overlapping 135° wedges of one crystal, 90 x 1.5° each	the first
8U0I	a 69-frame screening wedge and three 180° sweeps on three crystals	the first 180° sweep
36GK	two 360° sweeps of 1800 x 0.2° at the same geometry	the one the archive and DOI are named for
9CRW	a dose pair on one crystal 37 min apart - 0.025 s at 289 mm, 0.010 s at 276 mm	the 0.025 s sweep, whose 2.5 Å target matches the deposited 2.49 Å
7RIS	two crystals at two wavelengths - 1.53494 Å (Ho derivative) and 1.03329 Å (the deposited native)	both

Ten further archives hold more than one collection. Their layout was read from the image files and repository listings; one sweep is kept for a run over the data directory unless noted.

PDB / dataset	What the archive holds	Kept
5JVN	two 360° sweeps of one crystal, 3600 × 0.1° each (w1_3, w1_4)	the w1_3 sweep
6FID	two 360° sweeps of one crystal, 3600 × 0.1° each	the first
6IU8	a two-wavelength MAD pair, 720 × 0.5° each at 1.605 Å (low remote) and 1.740 Å (peak)	both - the pair is the point
7OS3	four 360° sweeps at λ 2.066 Å, 3600 × 0.1° each, from two crystal positions (pos2_1/2, pos3_1/2)	all four are kept as separate sweep directories pos*/
7L84	two ~720° helical sweeps, 1439 × 0.5° each at λ 1.892 Å, room temperature	the 301_helical_1 sweep
5M17	seven crystals in one tar (5M03/5M17/5MEL/5MC8/5M5D/5M3W/5LYR), one 1800-frame sweep each	only the 5M17 tar was downloaded
cytidine	six scans, three ω and three φ, at 2θ = 30° (I19-1 commissioning)	the 1800-frame φ scan
lalanine	four runs of the RODIN L-alanine deposition at 2θ = 20°	the 900-frame pgw240050_01 run
9E2T	one continuous sweep plus screening images	the 2700-frame sweep
8OWM	three MXRDR zips covering one 1800-frame sweep, plus a processed-data zip	the three sweep zips (proc zip skipped)

Three archives needed special handling to obtain the images.

• 5KY6 is served by MXRDR as 11 separate RAR archives, one folder of frames per archive, 50 frames per archive except the last, 564 frames in all. Reading them needs a RAR reader with RAR3 filter support: the official 7-Zip 7zz reads them, while the unrar-free and p7zip builds of Enterprise Linux 8 cannot.
• 6ZR0's zip, as the Keele University repository serves it, is damaged: it has no central directory. Frames 1-1059 of the 1060 were recovered from the zip's local file headers; the last frame is lost.
• 6NEN's University of Queensland eSpace record blocks scripted download, so its archive was downloaded by hand in a browser.

Datasets published as Raw Data Letters

Three of the datasets - 6R72, 8QQ7 and 6RLR - were published as IUCrData Raw Data Letters, a format whose purpose is to make raw images citable and re-processable in their own right. The letters describe the collections and the difficulties in them, and are the reference for what the data are:

• V. Zampieri, A. Vermot, M. Thepaut, I. Petit-Hartlein, F. Fieschi, P. Falson and V. Chaptal, "X-ray diffraction images for two membrane protein crystals presenting high anisotropy; the B. subtilis ABC transporter BmrA and the S. pneumoniae NADPH oxidase" (2025), IUCrData 10, x250591 doi:10.1107/S2414314625005917 - covers 6R72 and 8QQ7.
• V. Neviani, M. Lutz, W. Oosterheert, P. Gros and L. Kroon-Batenburg, "Crystal structure of the second extracellular domain of human tetraspanin CD9: twinning and diffuse scattering" (2022), IUCrData 7, x220852 doi:10.1107/S2414314622008525 - covers 6RLR.

The authors of the second letter also published their own reciprocal-space reconstruction of the 6RLR data as a separate Zenodo record, 10.5281/zenodo.6961763.

Detector: image file vs PDB entry

For 163 of the 164 PDB-coded rows both the image file and the PDB entry name a detector. (For 8XTG neither can be compared - the header reads PILATUS XXX, S/N XX-XXX.) The table above uses the file value in every case, because the entry's label is often approximate.

marCCD and SMV files name the detector differently - or not at all. A marCCD file names no model: its instrument header states the image dimensions and the pixel size, from which the plate size follows (3072 x 73.242 um = 225 mm, 4096 x 73.242 um = 300 mm), and its comment block a serial number; the LS-CAT beamlines additionally write detector='Rayonix MX-300 s/n 023' into the dataset comment. An SMV header names only a serial (DETECTOR_SN=930). For those rows the Detector column carries what the file itself establishes: the plate size (marCCD, 225 mm plate), the comment's name where one is present (Rayonix MX-300), or the serial (SMV, S/N 930).

Eighteen of the 163 genuinely conflict - the two sources name detectors that cannot both be right:

PDB	PDB entry says	Image file says	Conflict
5MLN	MARMOSAIC 225 mm CCD	PILATUS3 2M, S/N 24-0118, ESRF ID23	model / size
6FWC	DECTRIS EIGER X 4M	PILATUS 2MF, S/N 24-0109-F	model / size
6JGJ	DECTRIS PILATUS3 6M	PILATUS3 300K, S/N 3-0226	model / size
6P8P	DECTRIS PILATUS3 S 6M	PILATUS 6M-F, S/N 60-0112-F	generation
7ATG	DECTRIS PILATUS3 S 6M	PILATUS 6M-F, S/N 60-0117-F	generation
7N2S	DECTRIS EIGER X 16M	PILATUS 6M, S/N 60-0101	model / size
8R5R	DECTRIS PILATUS 6M	Dectris EIGER2 CdTe 16M	model / size
8RUD	DECTRIS PILATUS 6M	Dectris Eiger 16M, E-32-0107	model / size
9H0Q	DECTRIS EIGER X 16M	Dectris EIGER1 Si 9M, E-18-0102	model / size
9HNC	DECTRIS EIGER X 16M	PILATUS 6M-F, S/N 60-0117-F	model / size
9KHR	MAR CCD 165 mm	marCCD, S/N 35, 3072 x 3072 pixels of 73.242 um	plate size
9O0H	DECTRIS EIGER X 16M	Dectris EIGER2 Si 16M, S/N D021324	generation
9Q41	DECTRIS PILATUS 6M	Dectris EIGER2 Si 16M	model / size
9SL0	DECTRIS PILATUS4 X 4M	Dectris EIGER2 Si 9M	model / size
9UPT	RAYONIX MX300-HS	SMV, S/N 930, 3072 x 3072 pixels of 102.588 um	plate size
9VX7	DECTRIS EIGER X 9M	PILATUS3 6M, S/N 60-0133	model / size
9Z44	DECTRIS EIGER X 9M	Dectris EIGER2 Si 9M, S/N E-18-0131	generation
9Z72	DECTRIS EIGER X 16M	Dectris EIGER2 Si 16M, S/N E-32-0127	generation

For 9SL0 the file is decisive and the entry is wrong: 3108 x 3262 pixels of 75 um on 450 um silicon, written by EIGER2 firmware release-2022.1.2, is an EIGER2 9M and not a PILATUS4 4M.

For 9KHR and 9UPT the file names no model, so the comparison is on geometry, and it is decisive both times: 3072 x 3072 pixels of 73.242 um is a 225 mm plate, not the entry's 165 mm one, and 3072 x 3072 pixels of 102.588 um is a 315 mm plate, which no 300 mm detector has. The 6FWC frames were written by the same PILATUS 2M-F, S/N 24-0109-F, that wrote the 5NW5 and 6TOC frames at SLS X06DA, although the entry deposits an EIGER 4M at ESRF MASSIF-3.

The other 145 agree with their entry, up to how much each side states, which is not a conflict. An NXmx description often gives the model and size but no generation (Dectris Eiger 16M) where the entry names one (DECTRIS EIGER X 16M); a miniCBF header sometimes names a generation (PILATUS3 6M) that the entry leaves off (DECTRIS PILATUS 6M), as for 6YQF, 7PH1, 7QIS, 7YZX, 8XTE and 9YZK. Other rows differ as DECTRIS EIGER X 9M against the file's Dectris EIGER1 Si 9M, MARMOSAIC 300 mm CCD against a comment reading Rayonix MX-300 (the same detector under its later brand), or by a serial number or an -F suffix the entry leaves off. The ADSC entries (ADSC QUANTUM 315, ADSC QUANTUM 315r) have SMV files of 3072 x 3072 pixels of 0.1026 mm (0.102592 mm for 6NEN), a 315 mm detector; the marCCD files are 225 mm plates where the entry names a 225 mm detector and 300 mm plates where it names a 300 mm one.

Deposited models and structure factors

164 of the 171 datasets have a released PDB entry, and RCSB reports released structure factors (status_code_sf = REL) for every one of them. A merged result from this pipeline can therefore be checked against the deposited model or against the deposited intensities.

Rows where our reduction and the deposition disagree

Six of the 171 rows are ones where rugnux does not reproduce the deposited space group or cell, and where we have looked at the disagreement closely enough to change how the row is scored. They are collected here because a scoring row that silently disagrees with a published entry is not something a reader should have to discover from the code.

These are open questions, not errors we are attributing to the PDB. A deposited entry was arrived at by someone who had something we do not: a model that had to refine, and usually more knowledge of the crystal than the images carry. Where we describe evidence below, it is evidence about what these images support, which is a narrower thing than what the crystal is. In every one of the symmetry rows the possibility that the crystal really has the lower symmetry, with a pseudo-symmetry too exact for any test available to us to see, remains live - see the limit at the end of this section.

How the manifest records it, in tools/battery/open.json:

• ref always keeps the deposited values verbatim, so the deposition is never lost.
• ref_alternatives lists the other answers the row accepts. Each one replaces the reference fields it names - a space group, a cell, or both - and the row passes if our answer matches any of the references, the deposited one included. Each must carry why; an alternative with no stated reason is a schema error, not a silent pass, so the mechanism cannot become a way to turn a failure into a pass quietly. This is how the five knife-edge rows below are recorded: we are not asserting that our answer is right, only that both descriptions are defensible and that picking either one is acceptable. The report counts these rows separately from ordinary passes and prints the reason, so a reader can see how many there are and judge each.
• ref_override replaces the fields the battery scores against, with ref_override_why. It asserts a corrected reference, so it is for a reference we can show to be wrong about these images - 8XBP below - and not for a disagreement that is open.
• unscored drops the row from scoring entirely. It is a last resort: it also loses a test that still works, which is why an open question is now recorded as accepted alternatives instead.

8XBP is a question about provenance, not about symmetry

8XBP is different in kind from the other five and should not be read alongside them. Nothing here concerns the deposited model or its space group. The question is whether the raw images uploaded with the entry are the same crystal the deposited cell describes: the master file records data_collection_date 2023-06-21 where the entry records a collection date of 2023-06-23, and the deposited b = 50.78 A is 2.0% away from the b these images give. Two independent signals, one of them nothing to do with our processing. The override replaces the cell with the one DIALS 3.29 indexes de novo on this master and keeps the deposited space group and resolution.

Four trigonal and tetragonal rows where we read a higher point group

PDB	Deposited	rugnux reads	Where it stands
6TOC	P 42	P 42 2 2	both acceptable; the refinement test is not unanimous
8XTE	P 32	P 31 2 1 / P 32 2 1	both acceptable; ours is the better supported
8XTG	P 32	P 31 2 1 / P 32 2 1	both acceptable; the deposition is the better supported
6PXB	P 32	P 31 1 2 / P 32 1 2	both acceptable; unresolved in either direction

All four accept either answer: the deposited group and the one we read both pass. None of them is a claim that the deposited assignment is wrong - each is a question we cannot close, and 8XTE and 8XTG do not lean the same way, so they should not be read in one voice. The two 8XT* rows were for a time scored against our own answer by editing the reference itself, with no reason recorded; the deposition is back in ref verbatim and the disagreement is stated here.

6TOC. The deposited asymmetric unit holds two chains, and they are related by the very two-fold the higher group adds, to 0.16 A C-alpha RMSD over 43 residues - coordinate error at the deposited 1.85 A. Merging in P 4₂ 2 2 costs 0.0006 in R_meas for 1.75 times the multiplicity, and correlates better with the deposited model than the P 4₂ merge does. POINTLESS, run independently on our own P1 merge, reads the same point group. The refinement test - refine in each candidate group and compare R-free, which is the one comparison not biased toward the group the deposited model was refined in - does not come out unanimous: ZANUDA 1.097 makes P 4₂ 2 2 the better group at half the parameters and reports the deposited assignment incorrect, while an independent Refmac 5.8.0431 comparison on a symmetry-consistent free set makes P 4₂ the better one, by less than the spread between refinement protocols - the spread of the test exceeds the effect it is being asked to measure. Both answers are therefore accepted, with the refinement evidence recorded as split.

8XTE. The distinguishing test is the twin-immune centric zone: reflections that the higher group makes centric but the subgroup does not are their own twin mates, so a merohedral twin law cannot make them read centric. They read <|E^2-1|> = 0.946 +/- 0.012 against a centric expectation of 0.968 and an acentric one of 0.736. Re-refinement on a shared free set, with the twin law removed from both sides, favours the higher group. The deposited entry's published R values are themselves reproducible only with a twin law the entry does not declare, at a twin fraction of 0.50 - and a 0.50-twinned target already has the symmetry in question. Of the four rows this is the one where the evidence most clearly favours what we read; it still cannot be closed, because the centric zone is the only test that speaks to it (see the limit below), so both answers are accepted.

8XTG. This row is genuinely open and is flagged as such in the manifest. Every correlation-based instrument we have - our own operator correlations, and POINTLESS on our P1 merge - reads the higher point group, but the centric-zone test, the only one of them that can separate real symmetry from pseudo-symmetry, reads <|E^2-1|> = 0.869 at -44.9 nats: between the two expectations, and on the wrong side. The L-test indicates a twin fraction near 0.20-0.26. Whether this crystal is partially twinned or purely pseudo-symmetric has not been established. Here the better-supported answer is the deposited one, which is the opposite of 8XTE: the two rows look alike in the table and are not alike in the evidence. Both answers are accepted.

6PXB. Unscored rather than overridden, because the evidence does not settle either way. Our merge and POINTLESS both read a 312 point group, the added two-folds correlate at or above the level of the three-folds nobody disputes, and merging in the higher group lowers R_meas at twice the multiplicity. Against that, the deposited asymmetric unit's six chains pair under the added two-fold at 0.3-0.7 A, which is more than coordinate error at 1.75 A, and ZANUDA settles on a different trigonal supergroup - 321 rather than 312 - whose operators these data do not support. Neither answer is established in either direction, so both are accepted and the row still tests everything else about the set.

9RCI: two defensible descriptions of one lattice

The sixth row is not about symmetry but about which cell describes the crystal. The Patterson has an off-origin peak at 62.5% of the origin, so a genuine translational NCS relates the two halves of the cell rugnux reports, and the deposited cell is that supercell's (0, 1/2, 1/2)-centred sublattice to 0.17%. Both are correct descriptions of the same diffraction: one leaves the near-translation in the contents of a doubled cell, the other absorbs it into the lattice and indexes only the strong sublattice. Which one a program should prefer is a choice, not a measurement, so the row accepts either. The alternative cell recorded in the manifest is computed from the deposited cell alone (c' = b + 2c, centring removed), not copied from our output, so it stays a statement about the deposition's lattice.

The limit that applies to all four symmetry rows

A merohedral twin at a twin fraction of exactly 0.5 and a crystal that genuinely has the higher symmetry predict identical intensities. No amount of data and no refinement R separates them, and the same holds, approximately, for a pseudo-symmetry that is merely very exact. Every test described above measures how nearly a symmetry operator holds on these images; none of them can show that it holds exactly. Where the higher symmetry is right, merging in it gains multiplicity and completeness; where it is a pseudo-symmetry that close, merging in it costs nothing measurable either. That is why these rows are described as open questions, and why none of them should be read as a statement that a deposited model is wrong.

Dataset directories whose name is not the PDB code

Directory	PDB code in the table	Why
7brr	7D1M	The IRRMC archive and its DOI are published under 7BRR, which the PDB obsoleted on 2020-10-28 and replaced with 7D1M. The directory and the DOI keep the archive's own name; the deposited values are 7D1M's.

An archive that ships placeholder images

8AGQ's data/ directory contains 30 files named ForBackgroundOnly_000NN.img alongside the 1800-frame sweep. They are not images: each is a 64-byte text file holding a path string. A reader that globs *.img will pick them up, so they are named here rather than silently left.

Datasets with no PDB entry

Dataset	Repository record	Why there is no PDB code
6r72/ld	Zenodo record 10.5281/zenodo.14894181, file prefix V-CK63-8-ld_1_	a second collection in the 6R72 record - a low-dose sweep on the same crystal, not the one the deposited structure was built from
cuhf2	Zenodo record 10.5281/zenodo.6347466	a small-molecule dataset, not a PDB deposition
dnba	Zenodo record 10.5281/zenodo.1036416	a small-molecule dataset, not a PDB deposition
metformin	Zenodo record 10.5281/zenodo.20135265	a small-molecule dataset, not a PDB deposition
nidppe	Zenodo record 10.5281/zenodo.20041091	a small-molecule dataset, not a PDB deposition
cytidine	Zenodo record 10.5281/zenodo.33555	a small-molecule dataset, not a PDB deposition
lalanine	Zenodo record 10.5281/zenodo.11946282	a small-molecule dataset, not a PDB deposition

Five of the six small-molecule sets have a published structure to check a run against. These are reference values from the literature, not results obtained here.

Dataset	Space group	Cell (A, deg)	T	Reference
dnba	C 1 2/c 1 (15)	20.2635 8.7575 9.6697 / 90 109.941 90	30 K	the Zenodo record's own title and the xia2.html the depositors ship inside it, corroborated by COD 4510614/4510615 - Cryst. Growth Des. 13 (2013) 1861-1871 doi:10.1021/cg300906j
metformin	P 1 21/c 1 (14)	7.9104 13.8794 7.9310 / 90 114.606 90	100 K	the hydrochloride, form I; COD 2108029 - Acta Cryst. B73 (2017) 10-22 doi:10.1107/S2052520616017844
nidppe	P 1 21/c 1 (14)	11.2779 13.3386 15.8739 / 90 98.7953 90	150 K	COD 2012031 - Acta Cryst. C57 (2001) 690-693 doi:10.1107/S0108270101003961
cytidine	P 21 21 21 (19)	13.98 14.788 5.119 / 90 90 90	296 K	β-cytidine; COD 2001311 - D. L. Ward, Acta Cryst. C49 (1993) 1789-1792 doi:10.1107/S0108270193003464
lalanine	P 21 21 21 (19)	5.7952 5.933 12.362 / 90 90 90	ambient	COD 2104782 - N. A. Tumanov et al., Acta Cryst. B66 (2010) 458-471 doi:10.1107/S010876811001983X

cuhf2 has no confirmed cell. Its space group is published as P 4/n m m (Phys. Rev. B 81, 064422 (2010) doi:10.1103/PhysRevB.81.064422) but no numeric cell was located, so a run on it can be scored on the space group and not on the cell.

The collection in numbers

The collection was chosen to widen the spread of file formats, detectors, facilities and symmetries rather than to be easy to process. The counts below describe where it comes from; like everything else on this page, they are metadata about the depositions and their files, not measurements.

• Repository: IRRMC 84, SBGrid 35, Zenodo 28, MXRDR 14, ESRF 3, Keele University 3, XRDa 3, UQ eSpace 1.
• Facility - counted from the facility part of the Facility / beamline column, the beamline ignored so that entries deposited with and without one count the same, over the 170 rows that name one: APS 26, Diamond 20, ESRF 16, NSLS-II 14, BESSY 12, PETRA III 12, SSRL 11, ALS 8, SLS 7, SOLEIL 7, SPring-8 7, SSRF 6, PAL/PLS 5, CHESS 4, CLSI 3, ALBA 2, Australian Synchrotron 2, ELETTRA 2, LNLS 2, and one each from MAX IV, NSRRC, Photon Factory and RRCAT Indus-2 - 23 facilities.
• Crystal system, from the deposited space group of the 164 PDB-coded rows: orthorhombic 42, monoclinic 40, tetragonal 22, trigonal 19, hexagonal 16, cubic 13, triclinic 12.
• Long cell axes: eleven PDB-coded rows have a deposited cell axis longer than 320 Å - 8V4O, 9ZMU, 9Z72, 9YL4, 5NW5, 6QAJ, 7QIJ, 8T7R, 9H0Q, 6G1F and 6OEL.

The marCCD, SMV and gzip-compressed miniCBF datasets are the reason rugnux reads those formats natively, and accepts the .img and numeric-suffix (.001) file names they arrive with.

Licences

Each dataset carries the licence of its own deposition, stated on the record page linked above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each record states. None of these data are redistributed with Jungfraujoch; this page only records where they came from.