Jungfraujoch is developed at one facility, so the reader and the reduction pipeline are exercised on data collected elsewhere - other detectors, other file formats, other conventions. That data was collected and published by other people, and until now nothing in the repository said so. NON_SLS_TEST_DATA lists all 51 datasets: the DOI to cite for each, the repository it came from, and the experiment as deposited. Beamline, resolution, space group and cell are the values deposited with the corresponding PDB entry, read from the RCSB data API - not results measured here; no quantity produced by this software appears on the page. The detector is read out of the image file instead, because the detector named in a PDB entry is often only approximate, and the twelve cases where the two disagree are listed rather than silently reconciled. ACKNOWLEDGEMENT gains a section for the repositories themselves, with the IRRMC, SBGrid and Zenodo citations and the PDB citation for the metadata. Every DOI on both pages was resolved before it was written down. Co-Authored-By: Claude Opus 5 (1M context) <noreply@anthropic.com> Claude-Session: https://claude.ai/code/session_01Lc5JG6kJqZoCWaoZ43JGTW
19 KiB
Non-SLS test data
Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only
ever sees one facility's detectors is not tested. The datasets below were collected elsewhere,
on detectors and in file formats we do not produce ourselves, and are used here to check that
rugnux reads foreign files correctly and reduces them to sensible results. Their authors
published them for exactly this kind of reuse, and this page is where we credit them.
None of these data were collected by us. If you use any of them, cite the dataset DOI in the table below; the repositories themselves are cited in ACKNOWLEDGEMENT.
Where the values come from
- Source is the repository we downloaded from and that repository's own citable DOI for the archive we took. Every DOI on this page was resolved against DataCite before it was written down, and the identity of each dataset was taken from the repository's record for the archive - not from our directory names.
- Beamline, resolution, space group and cell are the values deposited with the PDB entry, read from the RCSB data API. They describe the published experiment. They are not our reprocessing results; no quantity measured by Jungfraujoch appears on this page.
- Detector is read out of the image files themselves - the NXmx
/entry/instrument/detector/descriptionor the miniCBF# Detector:header - because the detector named in a PDB entry is often only approximate. Where the two differ, the difference is listed below the table. - Anything that could not be established from one of those sources is left blank.
Datasets
| PDB | Source | Facility / beamline | dmin (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title |
|---|---|---|---|---|---|---|---|
| 11IF | IRRMC 10.18430/M311IF | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 |
| 5REO | Zenodo 10.5281/zenodo.3730956 | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 |
| 5SRC | IRRMC 10.18430/M35SRC | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers |
| 6JGJ | IRRMC 10.18430/m36jgj | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A |
| 6LEO | Zenodo 10.5281/zenodo.4003042 | SPring-8 BL32XU | 2.52 | C 2 2 21 | 73.5 95.3 101.4 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of thiosulfate transporter YeeE from Spirochaeta thermophila |
| 6TTN | IRRMC 10.18430/m36ttn | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine |
| 6YQF | IRRMC 10.18430/m36yqf | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly |
| 6ZE4 | SBGrid 10.15785/sbgrid/806 | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide |
| 7ATG | IRRMC 10.18430/m37atg | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution |
| 7K1L | IRRMC 10.18430/m37k1l | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate |
| 7KCN | IRRMC 10.18430/m37kcn | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins |
| 7MZT | IRRMC 10.18430/m37mzt | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A |
| 7ORR | IRRMC 10.18430/M37ORR | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 |
| 7PH1 | IRRMC 10.18430/M37PH1 | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid |
| 7PQ7 | IRRMC 10.18430/M3.IRRMC.6072 | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 |
| 7QIS | IRRMC 10.18430/M37QIS | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX |
| 7RJI | IRRMC 10.18430/M37RJI | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid |
| 7YZX | IRRMC 10.18430/M37YZX | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. |
| 8EGN | IRRMC 10.18430/M38EGN | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 |
| 8K1G | IRRMC 10.18430/M38K1G | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae |
| 8R5R | IRRMC 10.18430/m38r5r | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor |
| 8SA8 | IRRMC 10.18430/M38SA8 | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) |
| 8SQQ | IRRMC 10.18430/M38SQQ | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) |
| 8SQT | IRRMC 10.18430/M38SQT | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) |
| 8T7R | IRRMC 10.18430/M38T7R | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 |
| 8THA | IRRMC 10.18430/m38tha | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form |
| 8V4O | IRRMC 10.18430/m38v4o | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans |
| 8XTE | SBGrid 10.15785/sbgrid/1101 | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP |
| 8XTF | SBGrid 10.15785/sbgrid/1102 | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C |
| 8XTG | SBGrid 10.15785/sbgrid/1100 | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA | |
| 8YS9 | IRRMC 10.18430/M38YS9 | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH |
| 9B22 | IRRMC 10.18430/m39b22 | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) |
| 9BN8 | IRRMC 10.18430/m39bn8 | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 |
| 9HS7 | IRRMC 10.18430/M39HS7 | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER |
| 9JZO | IRRMC 10.18430/m39jzo | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. |
| 9MH4 | IRRMC 10.18430/M39MH4 | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes |
| 9MIN | SBGrid 10.15785/sbgrid/1151 | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 |
| 9O0H | IRRMC 10.18430/M39O0H | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker |
| 9RP9 | IRRMC 10.18430/M39RP9 | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex |
| 9VX7 | IRRMC 10.18430/M39VX7 | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor |
| 9VYB | IRRMC 10.18430/M39VYB | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd |
| 9W3Y | IRRMC 10.18430/M39W3Y | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) |
| 9YZK | IRRMC 10.18430/M39YZK | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA |
| 9Z44 | IRRMC 10.18430/M39Z44 | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain |
| 9ZLO | Zenodo 10.5281/zenodo.18652652 | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE |
| 9ZMU | IRRMC 10.18430/M39ZMU | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) |
| — | IRRMC 10.18430/M3.IRRMC.6753 | PILATUS 6MF | C-phycocyanin as a highly attractive model system in protein crystallography: unique crystallization properties and packing-diversity screening | ||||
| — | Zenodo 10.5281/zenodo.6347466 | Diamond Light Source I19-2 | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source | |||
| — | Zenodo 10.5281/zenodo.1036416 | Diamond Light Source I19-1 | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 | |||
| — | Zenodo 10.5281/zenodo.20135265 | Diamond Light Source I19-2 | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | |||
| — | Zenodo 10.5281/zenodo.20041091 | Diamond Light Source I19-2 | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor |
The last rows have no PDB code. Four are small-molecule / chemical-crystallography datasets, kept because they exercise short wavelengths, CdTe sensors and fine slicing; one is a protein dataset whose IRRMC record names no PDB entry. They have no deposited macromolecular values, so those columns are blank, and their titles are the repository record titles verbatim.
Detector: image file vs PDB entry
For 45 datasets both the image file and the PDB entry name a detector that can be read as a (model, generation, size). 12 of those 45 disagree - 3 on the model or the size, and 9 only because the PDB entry omits the detector generation. The table above uses the file value in every case.
| PDB | PDB entry says | Image file says | Difference |
|---|---|---|---|
| 6JGJ | DECTRIS PILATUS3 6M | PILATUS3 300K, S/N 3-0226 | model / size |
| 6YQF | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0119 | generation only |
| 7ATG | DECTRIS PILATUS3 S 6M | PILATUS 6M-F, S/N 60-0117-F | generation only |
| 7PH1 | DECTRIS PILATUS 2M | PILATUS3 2M, S/N 24-0124 | generation only |
| 7QIS | DECTRIS PILATUS 2M | PILATUS3 2M, S/N 24-0124 | generation only |
| 7YZX | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0119 | generation only |
| 8R5R | DECTRIS PILATUS 6M | Dectris EIGER2 CdTe 16M | model / size |
| 8XTE | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0124 | generation only |
| 9O0H | DECTRIS EIGER X 16M | Dectris EIGER2 Si 16M, S/N D021324 | generation only |
| 9VX7 | DECTRIS EIGER X 9M | PILATUS3 6M, S/N 60-0133 | model / size |
| 9YZK | DECTRIS PILATUS 2M | PILATUS3 S_2M, SN 24-0173 | generation only |
| 9Z44 | DECTRIS EIGER X 9M | Dectris EIGER2 Si 9M, S/N E-18-0131 | generation only |
The detector could not be read from the file for 8XTG (header reads PILATUS XXX, S/N XX-XXX).
Deposited models and structure factors
46 of the 51 datasets have a released PDB entry, and RCSB reports released structure factors
(status_code_sf = REL) for all of them. A merged result from this pipeline can therefore be checked
against the deposited model or against the deposited intensities.
Datasets with no PDB entry
| Dataset | Repository record | Why there is no PDB code |
|---|---|---|
8agq |
IRRMC project page Phyco_JCSG_a3 | IRRMC's own project record for this archive names no PDB entry |
cuhf2 |
Zenodo record 10.5281/zenodo.6347466 | a small-molecule dataset, not a PDB deposition |
dnba |
Zenodo record 10.5281/zenodo.1036416 | a small-molecule dataset, not a PDB deposition |
metformin |
Zenodo record 10.5281/zenodo.20135265 | a small-molecule dataset, not a PDB deposition |
nidppe |
Zenodo record 10.5281/zenodo.20041091 | a small-molecule dataset, not a PDB deposition |
Licences
Each dataset carries the licence of its own deposition, stated on the record page linked above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each record states. None of these data are redistributed with Jungfraujoch; this page only records where they came from.