mx/Jungfraujoch
3
2
Fork 0
Code Issues Pull Requests Actions 3 Packages Projects Releases 81 Wiki Activity
Files
9cf987cd4e7d6663a64ef22300d5e2ee36d473ec
Jungfraujoch/tools/battery/open.json
T
leonarski_fandClaude Opus 5.5 0bbe086b24 battery: symmetry evidence from POINTLESS and ZANUDA for 18 open-arm sets 
For every open-arm set where rugnux and the deposition differ in symmetry (sym_over, sym_screw,
screw_undetermined, accepted alternatives) and the sets the twin review flagged, an independent
assessment by established programs is now kept beside the manifest in
tools/battery/symmetry/<id>/: a summary.md and the trimmed POINTLESS and ZANUDA logs. Each row
names its directory in "symmetry_evidence". Nothing reads this for scoring, and no accepted or
rejected answer changes.

symmetry_evidence.py makes the evidence for one set. It re-runs the battery run's binary with the
unmerged export (p.hkl must equal the run's) and runs POINTLESS on the observations. It merges
them with AIMLESS in the deposited group and the model's setting, then runs ZANUDA with the
deposited model on three free sets, each chosen per lattice-holohedry orbit. It runs POINTLESS and
ZANUDA again on the depositor's structure factors, and tabulates the axial reflections of both
data sets for screw questions. ZANUDA's preference can move with the free set (6toc), which is why
there are three.

What the programs found, reported neutrally: an exact pseudo-symmetry, a twin or another effect
can produce any of these results, and the aim is only which answers the battery accepts.
6oww: ZANUDA prefers P 43 21 2 to P 21 on all four data sets, with lower R-free. 6toc and 8xtg:
ZANUDA prefers the higher group, but R-free is mixed (6toc) or favours the deposited group
(8xtg). 6pxb and 8xte: ZANUDA keeps the deposited P 32, and the deposited model in the higher
group refines far worse. 3r6o, 4bwl, 2wnq, 8c3e: the deposited model gives the higher group no
support. 5ebi: ZANUDA cannot reproduce the deposited fit. Screw sets: see each summary.

Run on rc175 fcbe920 battery run 20261012-0139 with CCP4 9.0.014 (POINTLESS 1.14.2, AIMLESS
0.8.2, ZANUDA 1.097 / REFMAC 5.8.0431).

Co-Authored-By: Claude Opus 5.5 (1M context) <noreply@anthropic.com>
Claude-Session: https://claude.ai/code/session_01EizBKhTqrAYago9KJG3dA3
2026-10-12 16:02:01 +02:00

210 lines
54 KiB
JSON
Raw Blame History

{"arm": "open", "sets": [
{"id": "11if", "input": "11if/BopeA_18500_a_B2-PEF_11if/data/PSL-1503_13949_master.h5", "wavelength": 0.9786, "ref": {"sg": "P 43", "sgno": 78, "cell": [51.14, 51.14, 71.92, 90.0, 90.0, 90.0], "dmin": 1.51}, "tags": ["h5", "tetragonal"], "tiers": {"smoke": "Eiger NXmx from another facility, 4-fold screw"}},
{"id": "36gk", "input": "36gk/CLS-0074_5-3_36GK/data/CLS-0074_5-3_master.h5", "wavelength": 0.95371, "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [120.58, 189.49, 199.69, 90.0, 90.0, 90.0], "dmin": 2.28}, "tags": ["h5", "orthorhombic"]},
{"id": "3inp", "input": "3inp/IDP02542_3inp/data/idp02542b.001", "wavelength": 0.97872, "ref": {"sg": "F 41 3 2", "sgno": 210, "cell": [224.08, 224.08, 224.08, 90.0, 90.0, 90.0], "dmin": 2.05}, "tags": ["marCCD", "cubic"], "tiers": {"ci": "marCCD, face-centred cubic F4132"}},
{"id": "3ky7", "input": "3ky7/IDP90258_3ky7/data/idp90258f.001", "wavelength": 0.97856, "ref": {"sg": "P 43 3 2", "sgno": 212, "cell": [125.176, 125.176, 125.176, 90.0, 90.0, 90.0], "dmin": 2.35}, "tags": ["marCCD", "cubic"]},
{"id": "3mc4", "input": "3mc4/series/206918e4_x0001.img", "wavelength": 1.54178, "ref": {"sg": "H 3", "sgno": 146, "cell": [104.03, 104.03, 105.54, 90.0, 90.0, 120.0], "dmin": 1.95}, "tags": ["smv", "trigonal", "home-source"]},
{"id": "3meb", "input": "3meb/series/202097g3_x0001.img", "wavelength": 1.54178, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [58.58, 101.15, 81.53, 90.0, 90.62, 90.0], "dmin": 1.9}, "tags": ["smv", "monoclinic", "home-source"]},
{"id": "3p85", "input": "3p85/series/217175d10_x0001.img", "wavelength": 1.54178, "ref": {"sg": "P 63 2 2", "sgno": 182, "cell": [127.29, 127.29, 72.9, 90.0, 90.0, 120.0], "dmin": 1.9}, "tags": ["smv", "hexagonal", "home-source"]},
{"id": "3r6o", "input": "3r6o/series/219594b8_x0001.img", "wavelength": 1.54178, "ref": {"sg": "I 41", "sgno": 80, "cell": [90.68, 90.68, 76.13, 90.0, 90.0, 90.0], "dmin": 1.95}, "symmetry_evidence": "symmetry/3r6o", "tags": ["smv", "tetragonal", "home-source"]},
{"id": "5cc8", "input": "5cc8/data/263060g10_x0001.img", "wavelength": 1.54178, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [87.14, 93.76, 72.49, 90.0, 90.0, 90.0], "dmin": 1.75}, "symmetry_evidence": "symmetry/5cc8", "tags": ["smv", "orthorhombic", "home-source", "tncs"]},
{"id": "5ebi", "input": "5ebi/dna-rna-chimera_Ba_high_2_001.img", "wavelength": 0.82657, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [35.72, 44.1, 35.72, 90.0, 119.98, 90.0], "dmin": 1.09}, "pinned": true, "symmetry_evidence": "symmetry/5ebi", "tags": ["marCCD", "monoclinic", "twin"]},
{"id": "5epe", "input": "5epe/030805_5epe/data/E1_7_set.001", "wavelength": 0.97856, "ref": {"sg": "F 2 3", "sgno": 196, "cell": [157.536, 157.536, 157.536, 90.0, 90.0, 90.0], "dmin": 1.9}, "tags": ["marCCD", "cubic"]},
{"id": "5f6m", "input": "5f6m/crystal3_00001.cbf", "wavelength": 1.03317, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [54.81, 58.51, 67.42, 90.0, 90.0, 90.0], "dmin": 1.1}, "tags": ["cbf", "orthorhombic", "diffuse"]},
{"id": "5j23", "input": "5j23/012132_5j23/data/XZ2_set.001", "wavelength": 0.97856, "ref": {"sg": "H 3", "sgno": 146, "cell": [175.822, 175.822, 136.839, 90.0, 90.0, 120.0], "dmin": 2.3}, "tags": ["marCCD", "trigonal", "twin"]},
{"id": "5jvn", "input": "5jvn/5jvn/data/PPDK-AV2820_w1_3_0001.cbf", "wavelength": 0.97625, "ref": {"sg": "P 6 2 2", "sgno": 177, "cell": [249.43, 249.43, 84.06, 90.0, 90.0, 120.0], "dmin": 2.9}, "tags": ["cbf", "hexagonal"]},
{"id": "5lzl", "input": "5lzl/pcalad/alad-levoil6_M3S15_1_0001.cbf", "wavelength": 1.04346, "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [205.561, 205.561, 199.171, 90.0, 90.0, 120.0], "dmin": 3.47}, "tags": ["cbf", "trigonal"]},
{"id": "5m17", "input": "5m17/BxGH99_WTDD_HA00AG2801_2_0001.cbf", "wavelength": 0.9795, "ref": {"sg": "I 4", "sgno": 79, "cell": [108.576, 108.576, 67.746, 90.0, 90.0, 90.0], "dmin": 1.03}, "tags": ["cbf", "tetragonal"]},
{"id": "5nw5", "input": "5nw5/5NW5_1_00001.cbf", "wavelength": 0.91863, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [92.14, 169.8, 390.16, 90.0, 90.0, 90.0], "dmin": 6.502}, "tags": ["cbf", "orthorhombic", "low-resolution"]},
{"id": "5reo", "input": "5reo/cbf/Mpro-x0752_1_0001.cbf", "wavelength": 0.9126, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [112.39, 52.59, 44.38, 90.0, 103.04, 90.0], "dmin": 1.88}, "tags": ["cbf", "monoclinic"], "tiers": {"smoke": "fastest set (10 s): miniCBF, monoclinic"}},
{"id": "5src", "input": "5src/5src/data/FRS004_15_1_00001.cbf", "wavelength": 0.88557, "ref": {"sg": "P 43", "sgno": 78, "cell": [88.68, 88.68, 39.23, 90.0, 90.0, 90.0], "dmin": 1.05}, "tags": ["cbf", "tetragonal"]},
{"id": "5uth", "input": "5uth/data/287007e1_0001.img", "wavelength": 1.54178, "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [69.28, 69.28, 153.8, 90.0, 90.0, 120.0], "dmin": 1.95}, "tags": ["smv", "trigonal", "home-source"]},
{"id": "5vml", "input": "5vml/data/271705c8_x_0001.img", "wavelength": 1.54178, "ref": {"sg": "P 42 21 2", "sgno": 94, "cell": [66.31, 66.31, 115.26, 90.0, 90.0, 90.0], "dmin": 1.7}, "tags": ["smv", "tetragonal", "home-source"]},
{"id": "6cee", "input": "6cee/data/Rachel_AV6_screen_0001.img", "wavelength": 1.54178, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [40.72, 44.11, 55.91, 90.0, 90.0, 90.0], "dmin": 1.55}, "tags": ["smv", "orthorhombic", "home-source"]},
{"id": "6fid", "input": "6fid/Trypsin_x1_align_2_0001.cbf", "wavelength": 2.0664, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [59.947, 64.107, 69.694, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["cbf", "orthorhombic"]},
{"id": "6fvz", "input": "6fvz/maox215_6fvz/data/maox215_w1_1_0001.cbf", "wavelength": 0.8729, "ref": {"sg": "C 2 2 2", "sgno": 21, "cell": [131.182, 222.753, 86.482, 90.0, 90.0, 90.0], "dmin": 1.8}, "tags": ["cbf", "orthorhombic"]},
{"id": "6fwc", "input": "6fwc/maox225_6fwc/data/maox225_1_00001.cbf", "wavelength": 1.00004, "ref": {"sg": "C 2 2 2", "sgno": 21, "cell": [131.728, 222.051, 86.293, 90.0, 90.0, 90.0], "dmin": 1.7}, "tags": ["cbf", "orthorhombic"]},
{"id": "6h2p_native", "input": "6h2p/ProlMut1MnCAC_6h2p/data/Prol_Mut1_Mn_X1_nat_1_0002.cbf", "wavelength": 0.9184, "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [103.453, 107.075, 216.543, 90.0, 90.0, 90.0], "dmin": 1.479}, "tags": ["cbf", "orthorhombic", "two-wavelength"]},
{"id": "6h2p_1p89A", "input": "6h2p/ProlMut1MnCAC_6h2p/data/Prol_Mut1_Mn_X_pk1_2_0001.cbf", "wavelength": 1.89317, "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [103.453, 107.075, 216.543, 90.0, 90.0, 90.0], "dmin": null}, "tags": ["cbf", "orthorhombic", "long-wavelength", "two-wavelength"]},
{"id": "6h5t", "input": "6h5t/6h5t/data/SH3-1_x2_1_001.img", "wavelength": 0.895, "ref": {"sg": "I 4 2 2", "sgno": 97, "cell": [86.792, 86.792, 141.768, 90.0, 90.0, 90.0], "dmin": 1.689}, "tags": ["marCCD", "tetragonal"]},
{"id": "6hv2", "input": "6hv2/6hv2/data/coll_1_master.h5", "wavelength": 0.99987, "ref": {"sg": "P 61 2 2", "sgno": 178, "cell": [68.928, 68.928, 133.563, 90.0, 90.0, 120.0], "dmin": 1.709}, "tags": ["h5", "hexagonal"], "tiers": {"ci": "HDF5, hexagonal P6122"}},
{"id": "6hwj", "input": "6hwj/bg3006_2_0001.cbf", "wavelength": 1.0332, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [59.812, 96.07, 80.252, 90.0, 106.69, 90.0], "dmin": 1.979}, "tags": ["cbf", "monoclinic"]},
{"id": "6i3j", "input": "6i3j/6i3j/data/BF19_go_1_0001.img", "wavelength": 0.91841, "ref": {"sg": "F 2 2 2", "sgno": 22, "cell": [134.382, 203.846, 226.744, 90.0, 90.0, 90.0], "dmin": 2.59}, "tags": ["marCCD", "orthorhombic"]},
{"id": "6iu5", "input": "6iu5/6iu5_VIT1_MBD_Zn/peak/peak_000001.cbf", "wavelength": 1.282, "ref": {"sg": "P 31", "sgno": 144, "cell": [84.942, 84.942, 98.19, 90.0, 90.0, 120.0], "dmin": 2.25}, "pinned": true, "tags": ["cbf", "trigonal", "twin"], "tiers": {"ci": "merohedrally twinnable P31, zinc anomalous peak"}},
{"id": "6iu6", "input": "6iu6/6iu6_VIT1_MBD_Ni/peak/peak_000001.cbf", "wavelength": 1.485, "ref": {"sg": "P 31", "sgno": 144, "cell": [84.744, 84.744, 97.398, 90.0, 90.0, 120.0], "dmin": 2.9}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
{"id": "6iu8", "input": "6iu8/6iu8_VIT1_MBD_Co/low/low_000001.cbf", "wavelength": 1.648, "ref": {"sg": "P 31", "sgno": 144, "cell": [85.503, 85.503, 98.355, 90.0, 90.0, 120.0], "dmin": 2.7}, "tags": ["cbf", "trigonal"]},
{"id": "6iu9", "input": "6iu9/6iu9_VIT1_MBD_Fe/peak/data01_000001.cbf", "wavelength": 1.7401, "ref": {"sg": "P 31", "sgno": 144, "cell": [85.321, 85.321, 97.573, 90.0, 90.0, 120.0], "dmin": 3.0}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
{"id": "6jgi", "input": "6jgi/6jgi/data/00001.img", "wavelength": 0.75, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.857, 62.403, 69.172, 90.0, 90.0, 90.0], "dmin": 0.85}, "tags": ["marCCD", "orthorhombic"], "tiers": {"ci": "marCCD, orthorhombic P212121 at 0.75 A"}},
{"id": "6jgj", "input": "6jgj/6jgj/data/000001.cbf", "wavelength": 0.35, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.87, 62.34, 68.85, 90.0, 90.0, 90.0], "dmin": 0.77}, "tags": ["cbf", "orthorhombic", "cdte"]},
{"id": "6moj", "input": "6moj/A9_1_00001.cbf", "wavelength": 0.97741, "ref": {"sg": "I 41 2 2", "sgno": 98, "cell": [130.418, 130.418, 293.453, 90.0, 90.0, 90.0], "dmin": 2.431}, "tags": ["cbf", "tetragonal"], "tiers": {"ci": "body-centred tetragonal I4122"}},
{"id": "6o2h", "input": "6o2h/lys_nitr_10_1_0001.cbf", "wavelength": 0.9768, "ref": {"sg": "P 1", "sgno": 1, "cell": [27.424, 32.134, 34.513, 88.657, 108.46, 111.877], "dmin": 1.212}, "tags": ["cbf", "triclinic", "diffuse"]},
{"id": "6oel", "input": "6oel/1449-8_3_001.img", "wavelength": 0.99994, "ref": {"sg": "F 41 3 2", "sgno": 210, "cell": [328.1, 328.1, 328.1, 90.0, 90.0, 90.0], "dmin": 3.1}, "tags": ["SMV", "cubic"], "tiers": {"smoke": "SMV reader (ADSC), cubic F4132"}},
{"id": "6p8p", "input": "6p8p/14_12_1_0001.cbf", "wavelength": 0.9792, "ref": {"sg": "P 4", "sgno": 75, "cell": [97.525, 97.525, 60.134, 90.0, 90.0, 90.0], "dmin": 1.635}, "tags": ["cbf", "tetragonal"]},
{"id": "6pb3", "input": "6pb3/14_16_1_000001.cbf", "wavelength": 0.97918, "ref": {"sg": "P 6", "sgno": 168, "cell": [100.436, 100.436, 48.86, 90.0, 90.0, 120.0], "dmin": 2.048}, "tags": ["cbf", "hexagonal"]},
{"id": "6pxb", "input": "6pxb/TJB1_3_rachel_1_0001.cbf", "wavelength": 0.9792, "pinned": true, "ref": {"sg": "P 32", "sgno": 145, "cell": [64.021, 64.021, 119.447, 90.0, 90.0, 120.0], "dmin": 1.747}, "ref_alternatives": [{"sg": "P 32 1 2", "sgno": 153, "why": "The deposition merged in point group 3 (its 55502 unique reflections to 1.747 A are what Laue class -3 holds, twice what -3 1 m would) and refined six chains in P 32. The intensities read point group 312 instead: the three added two-folds correlate at 0.98-0.99, at or above the three-folds nobody disputes (0.98), against 0.37-0.40 for the 321 and 622 operators, POINTLESS on our P1 merge picks P -3 1 m (likelihood 1.000), and the reflections centric in 312 but not in 3 are distributed as centric (+435 nats), which a twin law cannot produce. Against that, the deposited chains pair under the added two-fold at 0.3-0.7 A, more than coordinate error at 1.75 A, and the model tells the two indexings apart (R 0.22 against 0.25), so the two-fold may be a near-exact non-crystallographic one; ZANUDA settles on P 32 2 1, whose operators these data do not support. Neither answer is established, so both are accepted; P 31 1 2, which the data cannot separate from P 32 1 2, is accepted as its hand"}], "symmetry_evidence": "symmetry/6pxb", "tags": ["cbf", "trigonal"]},
{"id": "6pxc", "input": "6pxc/TJB6_1_Rachel_1_0001.cbf", "wavelength": 0.9791, "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [44.19, 64.827, 87.239, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf", "orthorhombic"], "tiers": {"ci": "body-centred orthorhombic I222"}},
{"id": "6r72", "input": "6r72/V-CK63-8-ld_1_master.h5", "wavelength": 0.98011, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [117.805, 110.754, 155.615, 90.0, 93.23, 90.0], "dmin": 3.95}, "pinned": true, "tags": ["h5", "monoclinic"]},
{"id": "6rlr", "input": "6rlr/_b4_1_master.h5", "wavelength": 0.97949, "ref": {"sg": "P 1", "sgno": 1, "cell": [39.986, 39.998, 63.643, 80.39, 76.29, 68.15], "dmin": 2.0}, "tags": ["h5", "triclinic", "twin"]},
{"id": "6toc", "input": "6toc/zenodo/dts_1_00001.cbf", "wavelength": 1.00004, "ref": {"sg": "P 42", "sgno": 77, "cell": [31.523, 31.523, 81.599, 90.0, 90.0, 90.0], "dmin": 1.853}, "ref_alternatives": [{"sg": "P 42 2 2", "sgno": 93, "why": "Our reduction and an independent POINTLESS run on our own P1 merge both read point group 422, and the deposited asymmetric unit's two chains are related by the very two-fold the higher group adds, to 0.16 A CA RMSD over 43 residues - coordinate error at 1.85 A. Merging in P 42 2 2 costs 0.0006 in R_meas for 1.75x the multiplicity and correlates better with the deposited model (0.9802 vs 0.9764). The refinement test is NOT unanimous: ZANUDA 1.097 refines P 42 2 2 to R-free 0.2561 against P 42's 0.2636 at half the parameters and reports the deposited assignment incorrect, while an independent Refmac 5.8.0431 comparison on a symmetry-consistent free set puts P 42 ahead by 0.004-0.020 depending on cycle count - less than the spread between refinement protocols. Neither answer is established: a pseudo-symmetry too exact for any test we have remains a live explanation, and so does the deposited assignment. Either is accepted"}], "symmetry_evidence": "symmetry/6toc", "tags": ["cbf", "tetragonal", "twin"]},
{"id": "6ttn", "input": "6ttn/6ttn/data/H6H_33_01_hyo_full_1_0001.cbf", "wavelength": 0.9184, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [39.894, 79.841, 104.701, 90.0, 90.0, 90.0], "dmin": 1.12}, "tags": ["cbf", "orthorhombic"]},
{"id": "6u7g", "input": "6u7g/6u7g/data/SNB02_11_8_1_master.h5", "wavelength": 1.03318, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [99.555, 98.682, 147.525, 90.0, 104.6, 90.0], "dmin": 2.35}, "pinned": true, "tags": ["h5", "monoclinic"]},
{"id": "6ukf", "input": "6ukf/6ukf/data/XDC-7_Pn6_000001.cbf", "wavelength": 0.8, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [61.018, 37.317, 69.027, 90.0, 109.768, 90.0], "dmin": 1.0}, "tags": ["cbf", "monoclinic"]},
{"id": "6v2r", "input": "6v2r/data/cbx7.248483.hv6_screen_0001.img", "wavelength": 1.54178, "ref": {"sg": "P 41 21 2", "sgno": 92, "cell": [40.193, 40.193, 83.127, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["smv", "tetragonal", "home-source"], "tiers": {"ci": "home source SMV, strong anomalous signal"}},
{"id": "6vww", "input": "6vww/IDP51000_6vww/data/m4H11g_00001.cbf", "wavelength": 0.97918, "ref": {"sg": "P 63", "sgno": 173, "cell": [150.539, 150.539, 111.31, 90.0, 90.0, 120.0], "dmin": 2.2}, "tags": ["cbf", "hexagonal", "twin"], "tiers": {"smoke": "merohedral twin, P63"}},
{"id": "6w4h", "input": "6w4h/IDP51000_6W4H/data/idp51000-201-a_1_2_3.001", "wavelength": 0.97872, "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [167.74, 167.74, 51.942, 90.0, 90.0, 120.0], "dmin": 1.8}, "tags": ["marCCD", "trigonal"]},
{"id": "6wzo", "input": "6wzo/9_1_1_000001.cbf", "wavelength": 0.97918, "ref": {"sg": "P 1", "sgno": 1, "cell": [43.718, 50.061, 69.337, 106.499, 90.094, 97.145], "dmin": 1.42}, "tags": ["cbf", "triclinic"]},
{"id": "6yqf", "input": "6yqf/6yqf/data/SYCE2TEX12-8_1_0001.cbf", "wavelength": 0.96878, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [42.67, 59.68, 156.49, 90.0, 90.0, 90.0], "dmin": 3.327}, "tags": ["cbf", "orthorhombic"]},
{"id": "6z8o", "input": "6z8o/HASE01-gaKr1_w1_1_1_master.h5", "wavelength": 0.9677, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [63.716, 97.022, 121.318, 90.0, 104.656, 90.0], "dmin": 2.2}, "tags": ["h5", "monoclinic"]},
{"id": "6ze4", "input": "6ze4/806/o8_1_0001.cbf", "wavelength": 0.9184, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [93.56, 109.88, 116.11, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf", "orthorhombic"], "tiers": {"smoke": "known hard: P212121 under-called as P21 since rc168"}},
{"id": "7arr", "input": "7arr/PF4N_04D_w1_1_00001.cbf", "wavelength": 0.97626, "ref": {"sg": "P 1", "sgno": 1, "cell": [30.937, 32.068, 43.087, 114.16, 91.88, 109.86], "dmin": 1.1}, "tags": ["cbf", "triclinic"]},
{"id": "7atg", "input": "7atg/7atg/data/put-2-2.0s_5_00001.cbf", "wavelength": 0.72932, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [17.97, 31.02, 43.86, 90.0, 90.0, 90.0], "dmin": 0.6}, "tags": ["cbf", "orthorhombic"]},
{"id": "7bgt", "input": "7bgt/MPMV2243_3_001.img", "wavelength": 0.82657, "ref": {"sg": "P 1", "sgno": 1, "cell": [29.296, 67.618, 69.716, 76.845, 83.875, 83.645], "dmin": 1.93}, "tags": ["marCCD", "triclinic"]},
{"id": "7brr", "input": "7brr/7brr/data/3C_2_1_master.h5", "wavelength": 0.97919, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [55.45, 99.02, 59.583, 90.0, 108.54, 90.0], "dmin": 1.35}, "tags": ["h5", "monoclinic"]},
{"id": "7dkp", "input": "7dkp/7dkp/data/LOX1-sree-p1a9-1p2_w1_1_1_master.h5", "wavelength": 0.9677, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [49.84, 169.451, 49.842, 90.0, 93.51, 90.0], "dmin": 1.45}, "tags": ["h5", "monoclinic"]},
{"id": "7k1l", "input": "7k1l/IDP52015_7k1l/data/cs1C2eg_00001.cbf", "wavelength": 0.97913, "ref": {"sg": "P 63", "sgno": 173, "cell": [150.83, 150.83, 110.73, 90.0, 90.0, 120.0], "dmin": 2.25}, "symmetry_evidence": "symmetry/7k1l", "tags": ["cbf", "hexagonal"], "tiers": {"smoke": "known hard: screw axis (P6 vs P63)"}},
{"id": "7kcn", "input": "7kcn/7kcn/data/ttr_hiuase_1_D1_33_00001.cbf", "wavelength": 1.45901, "ref": {"sg": "P 41 2 2", "sgno": 91, "cell": [67.03, 67.03, 116.89, 90.0, 90.0, 90.0], "dmin": 1.46}, "tags": ["cbf", "tetragonal"]},
{"id": "7l6j", "input": "7l6j/7l6j/data/idp97824-102sm-a_1_1_7.001", "wavelength": 0.97872, "ref": {"sg": "I 41 3 2", "sgno": 214, "cell": [171.693, 171.693, 171.693, 90.0, 90.0, 90.0], "dmin": 1.78}, "tags": ["marCCD", "cubic"]},
{"id": "7l84", "input": "7l84/301_helical_1_0001.cbf", "wavelength": 1.892, "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [79.344, 79.344, 37.81, 90.0, 90.0, 90.0], "dmin": 1.7}, "tags": ["cbf", "tetragonal"]},
{"id": "7mzt", "input": "7mzt/7mzt/data/BVG2_Pn3_000001.cbf", "wavelength": 1.0, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [113.619, 96.989, 108.33, 90.0, 90.0, 90.0], "dmin": 4.07}, "symmetry_evidence": "symmetry/7mzt", "tags": ["cbf", "orthorhombic"]},
{"id": "7n0i", "input": "7n0i/8_2_1_00001.cbf", "wavelength": 1.00004, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [75.846, 131.557, 140.048, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["cbf", "orthorhombic", "tncs"]},
{"id": "7n2s", "input": "7n2s/1449-4_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [83.211, 52.789, 106.291, 90.0, 98.278, 90.0], "dmin": 2.37}, "tags": ["cbf", "monoclinic"]},
{"id": "7orr", "input": "7orr/7orr/data/Nsp10-VT00022_1_master.h5", "wavelength": 0.97879, "ref": {"sg": "I 21 3", "sgno": 199, "cell": [105.88, 105.88, 105.88, 90.0, 90.0, 90.0], "dmin": 1.79}, "symmetry_evidence": "symmetry/7orr", "tags": ["h5", "cubic"]},
{"id": "7os3", "input": "7os3/pos2_1/pos2_1_00001.cbf", "wavelength": 2.0664, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [78.15, 91.05, 105.84, 90.0, 90.0, 90.0], "dmin": 2.177}, "tags": ["cbf", "orthorhombic"]},
{"id": "7ph1", "input": "7ph1/7ph1/data/9_1_0001.cbf", "wavelength": 0.9184, "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [74.975, 81.289, 124.248, 90.0, 90.0, 90.0], "dmin": 1.18}, "tags": ["cbf", "orthorhombic"]},
{"id": "7pq7", "input": "7pq7/7pq7/data/1436_p52_A3_1_1_00001.cbf", "wavelength": 0.9789, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [120.88, 51.73, 75.54, 90.0, 125.14, 90.0], "dmin": 1.55}, "tags": ["cbf", "monoclinic"]},
{"id": "7qij", "input": "7qij/907/dg046_2_data_1_00001.cbf", "wavelength": 0.97625, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [143.46, 324.92, 369.38, 90.0, 90.0, 90.0], "dmin": 4.1}, "tags": ["cbf", "orthorhombic"]},
{"id": "7qis", "input": "7qis/7qis/data/Chymo_Dfe_x1_2_0001.cbf", "wavelength": 0.9184, "ref": {"sg": "P 61", "sgno": 169, "cell": [100.269, 100.269, 206.215, 90.0, 90.0, 120.0], "dmin": 1.83}, "tags": ["cbf", "hexagonal"]},
{"id": "7ris", "input": "7ris/7ris/data/GLVase_Ca_we21108b7b_1_2_2.001_master.h5", "wavelength": 1.03329, "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [44.54, 44.54, 189.95, 90.0, 90.0, 120.0], "dmin": 1.72}, "pinned": true, "tags": ["h5", "trigonal"]},
{"id": "7rji", "input": "7rji/7rji/data/DD3_00000.cbf", "wavelength": 1.45859, "ref": {"sg": "H 3 2", "sgno": 155, "cell": [83.036, 83.036, 124.83, 90.0, 90.0, 120.0], "dmin": 1.71}, "tags": ["cbf", "trigonal"]},
{"id": "7t5t", "input": "7t5t/A1_2_00001.cbf", "wavelength": 0.97892, "ref": {"sg": "P 42 21 2", "sgno": 94, "cell": [95.309, 95.309, 104.915, 90.0, 90.0, 90.0], "dmin": 1.35}, "pinned": true, "tags": ["cbf", "tetragonal"]},
{"id": "7tcd", "input": "7tcd/7tcd/data/col_1_master.h5", "wavelength": 0.99987, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [138.504, 47.902, 78.068, 90.0, 107.56, 90.0], "dmin": 1.7}, "tags": ["h5", "monoclinic"]},
{"id": "7yzx", "input": "7yzx/7yzx/data/783-1_1_0001.cbf", "wavelength": 0.96864, "ref": {"sg": "P 63 2 2", "sgno": 182, "cell": [169.42, 169.42, 141.83, 90.0, 90.0, 120.0], "dmin": 1.9}, "tags": ["cbf", "hexagonal"]},
{"id": "8a1a", "input": "8a1a/L1F11v1_8a1a/data/L1-F11-v1_9ly1_D06_01_2_master.h5", "wavelength": 1.0, "ref": {"sg": "P 65", "sgno": 170, "cell": [191.866, 191.866, 122.409, 90.0, 90.0, 120.0], "dmin": 2.05}, "tags": ["h5", "hexagonal"]},
{"id": "8agq", "input": "8agq/8agq_zip_8AGQ/data/coll_1_00001.cbf", "wavelength": 1.0, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [89.948, 55.447, 54.787, 90.0, 113.55, 90.0], "dmin": 1.093}, "tags": ["cbf", "monoclinic"]},
{"id": "8dqb", "input": "8dqb/KloxA_17380_a_B1-Apo_I23_Form_8dqb/data/PSL-1405_653_master.h5", "wavelength": 0.97856, "ref": {"sg": "I 2 3", "sgno": 197, "cell": [164.124, 164.124, 164.124, 90.0, 90.0, 90.0], "dmin": 2.5}, "tags": ["h5", "cubic"]},
{"id": "8dyz", "input": "8dyz/lys_1_2_0001.cbf", "wavelength": 0.9768, "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [79.632, 79.632, 38.296, 90.0, 90.0, 90.0], "dmin": 1.272}, "tags": ["cbf", "tetragonal", "diffuse"]},
{"id": "8dz7", "input": "8dz7/lys_rt_2_38_0001.cbf", "wavelength": 0.976, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [30.486, 56.401, 73.852, 90.0, 90.0, 90.0], "dmin": 1.34}, "tags": ["cbf", "orthorhombic", "diffuse"]},
{"id": "8egn", "input": "8egn/PsaeA_00137_b_B5-az13643701_8egn/data/FKC8_4_0001.cbf", "wavelength": 1.1807, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [71.69, 75.16, 109.79, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["cbf", "orthorhombic"]},
{"id": "8iya", "input": "8iya/8iya/data/11_1_master.h5", "wavelength": 0.97918, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [102.747, 50.077, 109.248, 90.0, 91.754, 90.0], "dmin": 2.43}, "tags": ["h5", "monoclinic"]},
{"id": "8k1g", "input": "8k1g/8k1g/data/KP02_0001.cbf", "wavelength": 0.97942, "ref": {"sg": "I 4 2 2", "sgno": 97, "cell": [182.01, 182.01, 80.71, 90.0, 90.0, 90.0], "dmin": 2.09}, "tags": ["cbf", "tetragonal"]},
{"id": "8oic", "input": "8oic/8oic/data/_b20_1_master.h5", "wavelength": 0.9795, "ref": {"sg": "P 1", "sgno": 1, "cell": [73.055, 94.665, 120.589, 105.081, 89.959, 93.826], "dmin": 2.8}, "tags": ["h5", "triclinic"]},
{"id": "8owm", "input": "8owm/p13x4_1_00001.cbf.gz", "wavelength": 0.97625, "ref": {"sg": "P 1", "sgno": 1, "cell": [95.544, 95.629, 95.841, 90.416, 93.59, 117.775], "dmin": 1.7}, "tags": ["cbf", "triclinic"]},
{"id": "8pqd", "input": "8pqd/8pqd/data/11AT05_w1_1_1_master.h5", "wavelength": 0.9677, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [59.39, 59.37, 192.89, 90.0, 90.0, 90.0], "dmin": 1.5}, "tags": ["h5", "orthorhombic"]},
{"id": "8qaw", "input": "8qaw/p18x3/p18x3_1_00001.cbf.gz", "wavelength": 0.97625, "ref": {"sg": "H 3", "sgno": 146, "cell": [137.68, 137.68, 265.907, 90.0, 90.0, 120.0], "dmin": 1.55}, "tags": ["cbf", "trigonal", "long-axis"], "tiers": {"ci": "large: 3600 frames of cbf.gz, rhombohedral H3, 266 A axis"}},
{"id": "8qj5", "input": "8qj5/8qj5/data/Lcsbc3_1_2_00001.cbf", "wavelength": 1.0, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [57.61, 100.63, 77.93, 90.0, 96.06, 90.0], "dmin": 1.63}, "tags": ["cbf", "monoclinic"]},
{"id": "8qq7", "input": "8qq7/cbf/SpNox-Sp49-B3-B_088_1_0001.cbf", "wavelength": 0.966, "ref": {"sg": "P 64 2 2", "sgno": 181, "cell": [145.967, 145.967, 153.619, 90.0, 90.0, 120.0], "dmin": 3.62}, "tags": ["cbf", "hexagonal"]},
{"id": "8r5r", "input": "8r5r/8r5r/data/D5-33805_1_1_master.h5", "wavelength": 0.8856, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [91.74, 132.91, 137.5, 90.0, 90.0, 90.0], "dmin": 3.08}, "tags": ["h5", "orthorhombic"]},
{"id": "8rud", "input": "8rud/p08x03_1_00001.cbf.gz", "wavelength": 0.97626, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [78.066, 91.386, 114.547, 90.0, 96.9, 90.0], "dmin": 2.1}, "tags": ["cbf", "monoclinic"]},
{"id": "8s38", "input": "8s38/MX733_2_00001.cbf", "wavelength": 0.97626, "ref": {"sg": "I 21 21 21", "sgno": 24, "cell": [95.368, 163.1, 219.023, 90.0, 90.0, 90.0], "dmin": 1.89}, "symmetry_evidence": "symmetry/8s38", "tags": ["cbf", "orthorhombic"]},
{"id": "8sa8", "input": "8sa8/KlaeA_00906_a_B1-PLP_8sa8/data/PSL-0412_255_master.h5", "wavelength": 0.97949, "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [87.887, 131.544, 165.363, 90.0, 104.48, 90.0], "dmin": 1.3}, "tags": ["h5", "monoclinic"]},
{"id": "8sqo", "input": "8sqo/BrabA_00028_a_A1-Mg_8sqo/data/PSL-1801_942_master.h5", "wavelength": 0.97949, "ref": {"sg": "P 4 3 2", "sgno": 207, "cell": [112.91, 112.91, 112.91, 90.0, 90.0, 90.0], "dmin": 1.55}, "tags": ["h5", "cubic"]},
{"id": "8sqq", "input": "8sqq/BrabA_00028_a_A1-Apo_8sqq/data/PSL-1810_965_master.h5", "wavelength": 0.97949, "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [171.52, 171.52, 171.52, 90.0, 90.0, 90.0], "dmin": 2.25}, "tags": ["h5", "cubic"]},
{"id": "8sqt", "input": "8sqt/BrabA_00028_a_A1-Fe_8sqt/data/PSL-1812_971_master.h5", "wavelength": 0.97949, "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [170.72, 170.72, 170.72, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["h5", "cubic"]},
{"id": "8t7r", "input": "8t7r/8t7r/data/GREEN-04_Pn5_000001.cbf", "wavelength": 1.0, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [357.076, 259.582, 255.361, 90.0, 133.13, 90.0], "dmin": 3.84}, "tags": ["cbf", "monoclinic"]},
{"id": "8tha", "input": "8tha/1TEL_double_helix_8tha/data/A3_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 64", "sgno": 172, "cell": [69.16, 69.16, 29.13, 90.0, 90.0, 120.0], "dmin": 1.68}, "tags": ["cbf", "hexagonal"]},
{"id": "8tyy", "input": "8tyy/CPS_2_1_000001.cbf", "wavelength": 0.97918, "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [214.891, 214.891, 214.891, 90.0, 90.0, 90.0], "dmin": 1.68}, "tags": ["cbf", "cubic"]},
{"id": "8u0i", "input": "8u0i/8u0i/data/dI-2-05a_4_00001.cbf", "wavelength": 1.00004, "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [50.317, 50.317, 90.596, 90.0, 90.0, 90.0], "dmin": 1.541}, "tags": ["cbf", "tetragonal"], "tiers": {"ci": "miniCBF, tetragonal P43212"}},
{"id": "8v4o", "input": "8v4o/CaalA_00629_a_FS11-AMP_8v4o/data/PSL-1602_2180_master.h5", "wavelength": 0.97949, "ref": {"sg": "P 61 2 2", "sgno": 178, "cell": [139.46, 139.46, 544.99, 90.0, 90.0, 120.0], "dmin": 2.7}, "tags": ["h5", "hexagonal"]},
{"id": "8xbp", "input": "8xbp/8xbp/data/puck2872_3_1_master.h5", "wavelength": 0.97856, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [148.29, 50.78, 60.21, 90.0, 92.33, 90.0], "dmin": 1.99}, "ref_override": {"cell": [148.736, 51.777, 60.181, 90.0, 92.36, 90.0]}, "ref_override_why": "the uploaded sweep is a different crystal from the one the deposited cell describes: master data_collection_date 2023-06-21, deposited _diffrn_detector.pdbx_collection_date 2023-06-23, and the deposited b = 50.78 is 2.0% from the b these images give. The override is the cell DIALS 3.29 indexes de novo on this master, b = 51.777(11); the deposited space group and d_min are kept", "tags": ["h5", "monoclinic"]},
{"id": "8xte", "input": "8xte/1101/G2_1_00001.cbf", "wavelength": 0.97853, "ref": {"sg": "P 32", "sgno": 145, "cell": [208.77, 208.77, 67.22, 90.0, 90.0, 120.0], "dmin": 1.99}, "ref_alternatives": [{"sg": "P 31 2 1", "sgno": 152, "why": "The evidence favours the higher group here. The twin-immune centric zone of the added two-folds - reflections the higher group makes centric, which are their own twin mates and so cannot be made to read centric by a merohedral twin law - gives <|E^2-1|> = 0.946 +/- 0.012 against a centric expectation of 0.968 and an acentric 0.736, at +707 nats. Re-refinement on a shared free set with the twin law removed from both sides favours P 3_2 2 1 (0.2177/0.2322) over P 3_2 (0.2460/0.2612), and the deposited entry's published R values reproduce only with an undeclared twin law h,-h-k,-l at alpha = 0.50, which is itself a 321-symmetric target. No refinement R can close the question in principle, because a merohedral twin at exactly alpha = 0.5 and true 321 predict identical intensities; the case rests on the centric zone. Both answers are accepted, ours being the better supported"}], "symmetry_evidence": "symmetry/8xte", "tags": ["cbf", "trigonal"]},
{"id": "8xtf", "input": "8xtf/1102/puck03_12_1_master.h5", "wavelength": 0.97918, "ref": {"sg": "H 3 2", "sgno": 155, "cell": [211.75, 211.75, 67.42, 90.0, 90.0, 120.0], "dmin": 2.13}, "tags": ["h5", "trigonal"]},
{"id": "8xtg", "input": "8xtg/1100/mpag15_1_00001.cbf", "wavelength": 0.97853, "ref": {"sg": "P 32", "sgno": 145, "cell": [199.54, 199.54, 67.15, 90.0, 90.0, 120.0], "dmin": 2.0}, "ref_alternatives": [{"sg": "P 31 2 1", "sgno": 152, "why": "The evidence favours the DEPOSITION here, and this row must not be read as the 8xte one. Every correlation-based instrument we have - our own operator correlations, POINTLESS (0.85 on our P1 merge) - reads point group 321, but our own twin-immune centric-zone test, the only one that separates real symmetry from pseudo-symmetry, read <|E^2-1|> = 0.869 at -44.9 nats against the promotion when it assumed an untwinned zone; read at the fraction of the crystal's other twin laws (rc174) it now favours the promotion, with an L-test twin fraction of 0.20-0.26. Whether this crystal is partially twinned or purely pseudo-symmetric is not established. Both answers are accepted, the deposition being the better supported"}], "symmetry_evidence": "symmetry/8xtg", "tags": ["cbf", "trigonal"]},
{"id": "8y74", "input": "8y74/1_1/1_1_master.h5", "wavelength": 0.97918, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [125.782, 76.553, 87.143, 90.0, 92.449, 90.0], "dmin": 1.9}, "tags": ["h5", "monoclinic"]},
{"id": "8ys9", "input": "8ys9/8YS9_xray-data_8ys9/data/SDS_09_18112_master.h5", "wavelength": 0.97957, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [71.04, 77.68, 83.16, 90.0, 90.0, 90.0], "dmin": 1.46}, "tags": ["h5", "orthorhombic"]},
{"id": "9b22", "input": "9b22/KlpnC_20447_a_B1-AR6-AMP_9b22/data/PSL-1011_1580_master.h5", "wavelength": 0.97856, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [39.826, 92.659, 57.716, 90.0, 91.68, 90.0], "dmin": 1.3}, "tags": ["h5", "monoclinic"], "tiers": {"ci": "HDF5, monoclinic P21 at 1.1 A"}},
{"id": "9bn8", "input": "9bn8/EscoA_17938_a_AE1-UMA-A1AQS_9bn8/data/PSL-0401_8296_master.h5", "wavelength": 0.97856, "ref": {"sg": "P 41", "sgno": 76, "cell": [65.488, 65.488, 134.764, 90.0, 90.0, 90.0], "dmin": 1.35}, "tags": ["h5", "tetragonal"]},
{"id": "9c18", "input": "9c18/BLVRB-2_5217_master.h5", "wavelength": 0.9201, "ref": {"sg": "P 1", "sgno": 1, "cell": [41.94, 41.977, 60.212, 84.11, 87.24, 63.66], "dmin": 1.9}, "tags": ["h5", "triclinic"]},
{"id": "9chw", "input": "9chw/D1.001", "wavelength": 0.97872, "ref": {"sg": "P 61", "sgno": 169, "cell": [98.686, 98.686, 82.062, 90.0, 90.0, 120.0], "dmin": 2.16}, "tags": ["marCCD", "hexagonal"]},
{"id": "9crw", "input": "9crw/data_9crw/data/Kip3-475-22-2_master.h5", "wavelength": 0.95299, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [83.96, 104.57, 118.78, 90.0, 93.37, 90.0], "dmin": 2.49}, "tags": ["h5", "monoclinic"]},
{"id": "9e2t", "input": "9e2t/ga026f4b-1_5_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 1", "sgno": 1, "cell": [75.499, 78.082, 101.219, 94.63, 103.39, 114.55], "dmin": 2.28}, "tags": ["cbf", "triclinic"]},
{"id": "9ea5", "input": "9ea5/K4_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [65.868, 73.064, 98.399, 90.0, 108.725, 90.0], "dmin": 2.0}, "tags": ["cbf", "monoclinic"]},
{"id": "9fcg", "input": "9fcg/IBCH-15-p02x06_2_00001.cbf.gz", "wavelength": 0.97626, "ref": {"sg": "P 4", "sgno": 75, "cell": [87.79, 87.79, 35.633, 90.0, 90.0, 90.0], "dmin": 1.54}, "tags": ["cbf", "tetragonal"], "tiers": {"smoke": "cbf.gz reader, pure 4-fold"}},
{"id": "9fhc", "input": "9fhc/te/te312_2_001.img", "wavelength": 1.0, "ref": {"sg": "I 2 3", "sgno": 197, "cell": [227.46, 227.46, 227.46, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["marCCD", "cubic"]},
{"id": "9gdj", "input": "9gdj/slh34_w1_1_1_master.h5", "wavelength": 0.8856, "ref": {"sg": "P 41 21 2", "sgno": 92, "cell": [123.92, 123.92, 126.44, 90.0, 90.0, 90.0], "dmin": 1.47}, "tags": ["h5", "tetragonal", "cdte"], "tiers": {"ci": "CdTe detector (HDF5), 1.4 A, about 100 s"}},
{"id": "9gjx", "input": "9gjx/BlNTR_9gjx/data/SC6_1_master.h5", "wavelength": 0.9795, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [76.776, 115.807, 103.807, 90.0, 110.29, 90.0], "dmin": 2.4}, "tags": ["h5", "monoclinic"]},
{"id": "9gqg", "input": "9gqg/MX-2555/FKBP51-MSP500-A-5522-11_1_3094759/FKBP51-MSP500-A-5522-11_1_1_master.h5", "wavelength": 0.87313, "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [48.157, 48.157, 188.036, 90.0, 90.0, 120.0], "dmin": 2.0}, "tags": ["h5", "trigonal"]},
{"id": "9hnc", "input": "9hnc/asp_7_00001.cbf", "wavelength": 0.72931, "ref": {"sg": "P 1 2 1", "sgno": 3, "cell": [123.764, 123.645, 187.679, 90.0, 90.063, 90.0], "dmin": 1.879}, "symmetry_evidence": "symmetry/9hnc", "tags": ["cbf", "monoclinic"]},
{"id": "9hs7", "input": "9hs7/9hs7/data/B28X1_1_0001.cbf", "wavelength": 0.97926, "ref": {"sg": "P 65", "sgno": 170, "cell": [65.44, 65.44, 88.77, 90.0, 90.0, 120.0], "dmin": 1.698}, "tags": ["cbf", "hexagonal"]},
{"id": "9i0a", "input": "9i0a/carm1END468_9i0a_tar_9I0A/data/X151B1_1_master.h5", "wavelength": 0.97857, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [75.237, 98.676, 208.551, 90.0, 90.0, 90.0], "dmin": 2.22}, "tags": ["h5", "orthorhombic"]},
{"id": "9i80", "input": "9i80/20230422-PX1-LecA_RO5-5315-1/LecA-RO5_1_master.h5", "wavelength": 0.97856, "ref": {"sg": "P 41", "sgno": 76, "cell": [81.214, 81.214, 165.029, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["h5", "tetragonal", "twin"]},
{"id": "9ig7", "input": "9ig7/9IG7/data/KOD-P596-G2_3_00001.cbf", "wavelength": 0.97626, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [111.472, 153.471, 69.03, 90.0, 90.0, 90.0], "dmin": 2.6}, "tags": ["cbf", "orthorhombic"]},
{"id": "9ih9", "input": "9ih9/run_01_05_datacollection_9IH9/data/design-Xinjian-P1Thro-4_1_5_1_master.h5", "wavelength": 0.9677, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [78.758, 133.933, 82.32, 90.0, 101.356, 90.0], "dmin": 1.7}, "tags": ["h5", "monoclinic"]},
{"id": "9jq9", "input": "9jq9/pfplrxdata_9JQ9/data/lp13_001.cbf", "wavelength": 1.3477, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [48.551, 50.499, 78.571, 90.0, 90.0, 90.0], "dmin": 1.9}, "tags": ["cbf", "orthorhombic", "home-source"]},
{"id": "9jzo", "input": "9jzo/JS_35P2_C3-002_diffraction_files_9JZO/data/JS_35P2_C3-002_0001.cbf", "wavelength": 0.97942, "ref": {"sg": "P 1", "sgno": 1, "cell": [41.63, 43.1, 54.2, 112.97, 90.11, 118.18], "dmin": 1.4}, "tags": ["cbf", "triclinic"], "tiers": {"smoke": "triclinic P1", "ci": "triclinic P1"}},
{"id": "9khr", "input": "9khr/PfPlrx-DTT-9KHR/data-PfPlrx-DTT-9KHR/ods1467-lp13D1-01001.mccd", "wavelength": 0.97893, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [48.704, 50.31, 78.018, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["marCCD", "orthorhombic"], "tiers": {"smoke": "marCCD reader (.mccd), fast", "ci": "marCCD reader (.mccd)"}},
{"id": "9mh4", "input": "9mh4/KlaeA_00150_a_B1_9mh4/data/PSL-0501_2719_master.h5", "wavelength": 0.97856, "ref": {"sg": "P 21 3", "sgno": 198, "cell": [138.65, 138.65, 138.65, 90.0, 90.0, 90.0], "dmin": 3.05}, "tags": ["h5", "cubic"]},
{"id": "9min", "input": "9min/1151/A8_31_00001.cbf", "wavelength": 1.00003, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [95.45, 98.54, 155.74, 90.0, 90.0, 90.0], "dmin": 2.05}, "tags": ["cbf", "orthorhombic"], "tiers": {"smoke": "known hard: halved axis"}},
{"id": "9o0h", "input": "9o0h/3TEL-GG-TNK1-UBA_9o0h/data/E1_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [55.15, 65.54, 112.9, 90.0, 90.0, 90.0], "dmin": 2.24}, "tags": ["cbf", "orthorhombic"]},
{"id": "9p7q", "input": "9p7q/9p7q_9P7Q/data/SAMDC_MTA_273_40_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [96.978, 45.018, 72.061, 90.0, 105.109, 90.0], "dmin": 2.21}, "tags": ["cbf", "monoclinic"]},
{"id": "9pbb", "input": "9pbb/9pbb_9PBB/data/SAMDC_MTA_293_30_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [97.418, 45.876, 72.248, 90.0, 104.971, 90.0], "dmin": 2.17}, "pinned": true, "tags": ["cbf", "monoclinic"]},
{"id": "9q41", "input": "9q41/apoSPDS_1_master.h5", "wavelength": 0.8857, "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [118.568, 133.704, 82.369, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["h5", "orthorhombic"]},
{"id": "9q66", "input": "9q66/PREP_JP417_D8a_12694_master.h5", "wavelength": 0.91976, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [105.853, 67.294, 158.019, 90.0, 99.109, 90.0], "dmin": 2.01}, "tags": ["h5", "monoclinic"]},
{"id": "9qw8", "input": "9qw8/MX-2555/run_03_datacollection [2023-09-08 22:19:51]/FKBP12BRD4-5519-6-BD1-PPU688_w1_1_1_master.h5", "wavelength": 0.8856, "ref": {"sg": "P 1", "sgno": 1, "cell": [35.648, 35.65, 100.919, 86.458, 84.218, 72.475], "dmin": 1.8}, "tags": ["h5", "triclinic"]},
{"id": "9rci", "input": "9rci/FEN1-CD029134_A09-3_AD049A-10_1_master.h5", "wavelength": 0.9801, "ref": {"sg": "P 1", "sgno": 1, "cell": [35.869, 39.297, 100.916, 98.3, 90.32, 90.09], "dmin": 1.662}, "ref_alternatives": [{"cell": [35.869, 39.297, 199.976, 87.087, 90.341, 90.09], "why": "The deposited cell is the (0,1/2,1/2)-centred sublattice of the supercell we report, to 0.17%, and both descriptions of this lattice are defensible. The Patterson has an off-origin peak at 62.5% of the origin, so a real translational NCS relates the two halves of our cell: describing the crystal by the doubled cell with the near-translation left in the content, or by its sublattice with the near-translation absorbed into the lattice, is a choice, not a measurement. The alternative cell is the deposited one doubled along c with the centring removed (c' = b + 2c), computed from the deposited cell alone - not from our output"}], "tags": ["h5", "triclinic", "tncs"]},
{"id": "9rcs", "input": "9rcs/760_B7_x1_1_master.h5", "wavelength": 0.61992, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [70.01, 78.8, 82.34, 90.0, 88.64, 90.0], "dmin": 3.012}, "tags": ["h5", "monoclinic", "cdte"]},
{"id": "9rp9", "input": "9rp9/data_9RP9/data/TAR148-TAR148_X2_1_master.h5", "wavelength": 0.97856, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [73.48, 59.78, 91.67, 90.0, 100.85, 90.0], "dmin": 2.1}, "tags": ["h5", "monoclinic"]},
{"id": "9sl0", "input": "9sl0/wt-1_9sl0/data/design-Yan-HLA-WT-1_1_5_1_master.h5", "wavelength": 0.87313, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [60.181, 80.201, 111.589, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["h5", "orthorhombic"], "tiers": {"ci": "HDF5, orthorhombic P212121"}},
{"id": "9t6s", "input": "9t6s/CadC-AF6586_1_5_1_master.h5", "wavelength": 0.8856, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [63.004, 64.574, 102.705, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["h5", "orthorhombic", "tncs"]},
{"id": "9upt", "input": "9upt/Raw data 1A/C12_7_00001.img", "wavelength": 0.99984, "ref": {"sg": "P 6", "sgno": 168, "cell": [158.27, 158.27, 53.962, 90.0, 90.0, 120.0], "dmin": 2.369}, "tags": ["SMV", "hexagonal"]},
{"id": "9vyb", "input": "9vyb/Antitoxin Phd_9vyb/data/G7-5_4187_master.h5", "wavelength": 1.00003, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [44.37, 47.76, 48.35, 90.0, 90.0, 90.0], "dmin": 2.12}, "tags": ["h5", "orthorhombic"]},
{"id": "9w3y", "input": "9w3y/9w3y/data/collect_01_00001_master.h5", "wavelength": 1.007, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [60.75, 69.98, 94.24, 90.0, 90.0, 90.0], "dmin": 1.5}, "tags": ["h5", "orthorhombic"]},
{"id": "9yl4", "input": "9yl4/data_MJ4720/UWO0004_06_0001.cbf", "wavelength": 0.9795, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [95.837, 111.339, 402.967, 90.0, 90.0, 90.0], "dmin": 3.7}, "pinned": true, "tags": ["cbf", "orthorhombic"]},
{"id": "9yzk", "input": "9yzk/CC1_21_TGGGAAGATACTGGATGAGGT_empty_9yzk/data/run_29_00001.cbf", "wavelength": 1.00002, "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [75.836, 163.022, 192.278, 90.0, 98.614, 90.0], "dmin": 5.1}, "tags": ["cbf", "monoclinic"], "tiers": {"smoke": "I2/C2 setting choice at low resolution"}},
{"id": "9z44", "input": "9z44/CC1_10_CCCGGCCGG_Cclamp_9z44/data/run_41_00001.cbf", "wavelength": 1.00005, "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [73.491, 127.653, 141.183, 90.0, 91.984, 90.0], "dmin": 7.2}, "tags": ["cbf", "monoclinic"]},
{"id": "9z72", "input": "9z72/A7_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [59.173, 59.173, 426.203, 90.0, 90.0, 120.0], "dmin": 2.38}, "tags": ["cbf", "trigonal", "long-axis"], "tiers": {"smoke": "long axis c=426 A, at the FFT ceiling"}},
{"id": "9zlo", "input": "9zlo/ASP0887_09_0114_master.h5", "wavelength": 0.95365, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [38.39, 89.98, 106.97, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["h5", "orthorhombic"]},
{"id": "9zm0", "input": "9zm0/Atg23ANNS_9zm0_9ZM0/data/SeAtg23_B_10_2115_master.h5", "wavelength": 0.97988, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [50.409, 30.101, 91.244, 90.0, 97.146, 90.0], "dmin": 2.1}, "tags": ["h5", "monoclinic"]},
{"id": "9zmu", "input": "9zmu/BrmeA_18154_a_B2-Apo_9zmu/data/PSL-0613_7518_master.h5", "wavelength": 0.97856, "ref": {"sg": "P 65 2 2", "sgno": 179, "cell": [47.81, 47.81, 492.58, 90.0, 90.0, 120.0], "dmin": 1.98}, "tags": ["h5", "hexagonal"]},
{"id": "cuhf2", "input": "cuhf2/03_CuHF2pyz2PF6b_P_O/CuHF2pyz2PF6b_P_O_01.nxs", "wavelength": 0.4859, "pinned": true, "tags": ["nxs", "small-molecule"]},
{"id": "cytidine", "input": "cytidine/20151020-Cytidine-2th-30/fixed-omega--180-phi-scan01_00001.cbf", "wavelength": 0.68966, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [13.98, 14.788, 5.119, 90.0, 90.0, 90.0], "dmin": null}, "cod": "2001311", "tags": ["cbf", "orthorhombic", "small-molecule"]},
{"id": "dnba", "input": "dnba/35dnba_30K_2_04_00001.cbf", "wavelength": 0.6889, "ref": {"sg": "C 1 2/c 1", "sgno": 15, "cell": [20.2635, 8.7575, 9.6697, 90.0, 109.941, 90.0], "dmin": 0.48}, "cod": "4510615", "tags": ["cbf", "monoclinic", "small-molecule"]},
{"id": "lalanine", "input": "lalanine/pgw240050_01_00001.cbf", "wavelength": 0.6889, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [5.791, 5.944, 12.269, 90.0, 90.0, 90.0], "dmin": null}, "cod": "2311261", "tags": ["cbf", "orthorhombic", "small-molecule"], "tiers": {"smoke": "small molecule, miniCBF"}},
{"id": "metformin", "input": "metformin/013_Mmetformin_01_master.h5", "wavelength": 0.4859, "ref": {"sg": "P 1 21/c 1", "sgno": 14, "cell": [7.9104, 13.8794, 7.931, 90.0, 114.606, 90.0], "dmin": 0.45}, "cod": "2108029", "tags": ["h5", "monoclinic", "small-molecule"], "tiers": {"smoke": "small molecule, Diamond I19 NXmx master"}},
{"id": "nidppe", "input": "nidppe/001_NiDppeCl2_01_master.h5", "wavelength": 0.4859, "ref": {"sg": "P 1 21/c 1", "sgno": 14, "cell": [11.2779, 13.3386, 15.8739, 90.0, 98.7953, 90.0], "dmin": 0.77}, "cod": "2012031", "tags": ["h5", "monoclinic", "small-molecule"]},
{"id": "5mln", "input": "5mln/5mln/data/CmADHx6_w1_2_0001.cbf", "wavelength": 0.8729, "ref": {"sg": "P 21 2 21", "sgno": 18, "cell": [74.178, 80.425, 80.52, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf"]},
{"id": "5t39", "input": "5t39/10mMfuc-12h.001", "wavelength": 0.97872, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [50.222, 41.27, 58.504, 90.0, 98.58, 90.0], "dmin": 1.1004}, "tags": ["marccd"]},
{"id": "6cdl", "input": "6cdl/nnnn_6cdl/data/wt_32-14A_p6n6.0001", "wavelength": 1.0, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [58.26, 85.91, 46.051, 90.0, 90.0, 90.0], "dmin": 1.25}, "tags": ["marccd"]},
{"id": "6f3p", "input": "6f3p/6f3p/data/saha16_1_1.0002", "wavelength": 1.0, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [142.9, 85.74, 112.01, 90.0, 122.2, 90.0], "dmin": 1.35}, "tags": ["marccd"]},
{"id": "6g1f", "input": "6g1f/home/data/dls180217/mx13587-30/mat/DpgA-7-HA00AX9676/DpgA-7-HA00AX9676_1_0001.cbf", "wavelength": 0.97955, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [329.28, 83.9, 133.42, 90.0, 111.58, 90.0], "dmin": 2.248}, "tags": ["cbf"]},
{"id": "6jgh", "input": "6jgh/6jgh/data/a_00001.img", "wavelength": 0.75, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.641, 62.506, 68.179, 90.0, 90.0, 90.0], "dmin": 0.94}, "tags": ["marccd"]},
{"id": "6nen", "input": "6nen/Pm1tr_2_1_001.img", "wavelength": 0.9537, "ref": {"sg": "P 3 1 2", "sgno": 149, "cell": [105.501, 105.501, 35.132, 90.0, 90.0, 120.0], "dmin": 2.151}, "tags": ["smv"]},
{"id": "6qaj", "input": "6qaj/95_8_8_8_1_0001.cbf", "wavelength": 1.28189, "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [59.774, 169.332, 374.508, 90.0, 90.0, 90.0], "dmin": 2.901}, "tags": ["cbf"]},
{"id": "6s1u", "input": "6s1u/new_4_0001.img", "wavelength": 0.91841, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [51.603, 29.413, 85.533, 90.0, 103.75, 90.0], "dmin": 1.9}, "tags": ["marccd"]},
{"id": "6w75", "input": "6w75/IDP51000_6W75/data/idp51000-410-a_1_1_1.001", "wavelength": 0.97872, "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [166.245, 166.245, 98.279, 90.0, 90.0, 120.0], "dmin": 1.951}, "tags": ["marccd"]},
{"id": "6zqr", "input": "6zqr/ib23a11_M2S3_1_001.img", "wavelength": 0.9795, "ref": {"sg": "P 4", "sgno": 75, "cell": [113.6, 113.6, 44.08, 90.0, 90.0, 90.0], "dmin": 1.93}, "tags": ["smv"]},
{"id": "6zqy", "input": "6zqy/ib22b32_MS_1_001.img", "wavelength": 0.9702, "ref": {"sg": "P 4", "sgno": 75, "cell": [119.29, 119.29, 44.21, 90.0, 90.0, 90.0], "dmin": 1.85}, "tags": ["smv"]},
{"id": "6zr0", "input": "6zr0/ib23a23_dc_1_0001.cbf", "wavelength": 0.9795, "ref": {"sg": "P 4", "sgno": 75, "cell": [119.219, 119.219, 44.18, 90.0, 90.0, 90.0], "dmin": 1.94}, "tags": ["cbf"]},
{"id": "7ou1", "input": "7ou1/omega_1_0001.img", "wavelength": 0.895, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [77.923, 91.308, 114.164, 90.0, 97.111, 90.0], "dmin": 1.65}, "tags": ["marccd"]},
{"id": "7raa", "input": "7raa/A6_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [66.372, 66.372, 298.302, 90.0, 90.0, 90.0], "dmin": 2.69}, "tags": ["cbf"]},
{"id": "9fcf", "input": "9fcf/IBCH-05-p03x03_3_00001.cbf.gz", "wavelength": 0.97626, "ref": {"sg": "P 4", "sgno": 75, "cell": [91.301, 91.301, 35.836, 90.0, 90.0, 90.0], "dmin": 2.36}, "tags": ["cbf"]},
{"id": "9h0q", "input": "9h0q/Bc2lCnter-pma127_2_master.h5", "wavelength": 0.97857, "ref": {"sg": "H 3 2", "sgno": 155, "cell": [169.506, 169.506, 344.036, 90.0, 90.0, 120.0], "dmin": 2.55}, "tags": ["h5"]},
{"id": "5ky6", "input": "5ky6/C11_1_001.img", "wavelength": 0.91841, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [84.511, 57.253, 164.016, 90.0, 102.57, 90.0], "dmin": 1.941}, "symmetry_evidence": "symmetry/5ky6", "tags": ["marccd"]},
{"id": "6z9g", "input": "6z9g/HASE01-ga1o2_w1_2_1_master.h5", "wavelength": 0.9677, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [120.306, 93.815, 126.951, 90.0, 105.201, 90.0], "dmin": 1.76}, "tags": ["h5", "tncs"]},
{"id": "8c3e", "input": "8c3e/LCB2_raw_data/lcb2_8_newt_003_0001.cbf", "wavelength": 1.54184, "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [57.817, 57.817, 41.54, 90.0, 90.0, 120.0], "dmin": 2.1}, "symmetry_evidence": "symmetry/8c3e", "tags": ["cbf", "trigonal", "home-source", "twin"]},
{"id": "4bwl", "input": "4bwl/y137a_sial5m_MS_1_001.img", "wavelength": 0.9795, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [55.97, 143.22, 83.41, 90, 109.51, 90], "dmin": 2.0}, "symmetry_evidence": "symmetry/4bwl", "tags": ["smv", "monoclinic", "twin", "pseudo-merohedral"]},
{"id": "2wnq", "input": "2wnq/I2-3_data_MS_1_001.img", "wavelength": 0.9702, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [54.63, 142.77, 84.487, 90, 108.99, 90], "dmin": 1.8}, "symmetry_evidence": "symmetry/2wnq", "tags": ["smv", "monoclinic", "twin", "pseudo-merohedral"]},
{"id": "2xfw", "input": "2xfw/E192N_alone_MS_1_001.img", "wavelength": 0.9796, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [78.11, 116.53, 83.74, 90, 117.95, 90], "dmin": 1.65}, "tags": ["smv", "monoclinic", "twin", "pseudo-merohedral"]},
{"id": "2wnn", "input": "2wnn/wt_pyr_pos3_MS_3_001.img", "wavelength": 0.92, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [54.693, 142.456, 83.626, 90, 109.16, 90], "dmin": 1.65}, "tags": ["smv", "monoclinic", "twin", "pseudo-merohedral"]},
{"id": "2wnz", "input": "2wnz/E192_pyr_MS_1_001.img", "wavelength": 0.9796, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [56.921, 143.041, 83.918, 90, 109.79, 90], "dmin": 1.85}, "tags": ["smv", "monoclinic", "pseudo-symmetry"]},
{"id": "6oww", "input": "6oww/data/t1_1_00001.cbf", "wavelength": 1.3857, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [85.832, 86.015, 214.34, 90.0, 89.91, 90.0], "dmin": 3.84}, "ref_alternatives": [{"sg": "P 41 21 2", "sgno": 92, "why": "OPEN QUESTION, both accepted. The deposited 8-chain P 1 21 1 model itself obeys a 4-fold (0.13-0.16 A) and a 2-fold (0.10 A) with consistent translations, and the model's |Fc|^2 correlate across the added 422 operators at 1.00/0.98/0.97 - the deposition is likely under-called, and our data support point group 422. Not established: no refinement in P 41 21 2 has been compared with the deposited P 1 21 1, so a pseudo-symmetry too exact for these tests remains a live explanation, as does the deposited assignment (cf. 6toc)"}], "symmetry_evidence": "symmetry/6oww", "tags": ["cbf", "monoclinic", "pseudo-symmetry"]},
{"id": "6p8j", "input": "6p8j/13_12_2_000001.cbf", "wavelength": 0.9792, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [46.484, 152.166, 88.255, 90.0, 90.12, 90.0], "dmin": 1.47}, "symmetry_evidence": "symmetry/6p8j", "tags": ["cbf", "monoclinic", "pseudo-symmetry"]},
{"id": "9qvv", "input": "9qvv/CHRD_HEP_M/CHRD_404_7_1.nxs", "wavelength": 0.9762, "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [120.142, 123.8, 123.787, 90.0, 90.0, 90.0], "dmin": 2.72}, "tags": ["nxs", "orthorhombic", "pseudo-symmetry"]},
{"id": "5ojv", "input": "5ojv/bg3047_w1_1_0001.cbf", "wavelength": 0.97625, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [87.792, 158.242, 87.589, 90.0, 90.0, 90.0], "dmin": 2.062}, "tags": ["cbf", "orthorhombic", "pseudo-symmetry"]},
{"id": "9qw2", "input": "9qw2/HepPhosHep_Data_for_9QW2/hw28c25_dc1_1_0001.cbf", "wavelength": 0.9762, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [55.439, 108.179, 55.65, 90.0, 90.9, 90.0], "dmin": 1.92}, "tags": ["cbf", "monoclinic", "pseudo-symmetry"]},
{"id": "7q6j", "input": "7q6j/3_001_00001.cbf", "wavelength": 1.0332, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [72.71, 115.88, 116.18, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["cbf", "orthorhombic", "pseudo-symmetry"]},
{"id": "6rym", "input": "6rym/6RYM/jmp47a2_1_001.img", "wavelength": 1.488, "ref": {"sg": "P 43", "sgno": 78, "cell": [50.225, 50.225, 51.925, 90.0, 90.0, 90.0], "dmin": 1.46}, "tags": ["smv", "tetragonal"], "pinned": true},
{"id": "7bgu", "input": "7bgu/mpmv_01001.mccd", "wavelength": 0.815, "ref": {"sg": "P 1", "sgno": 1, "cell": [29.068, 67.893, 69.739, 77.07, 83.34, 83.18], "dmin": 2.433}, "tags": ["marCCD", "triclinic"], "pinned": true},
{"id": "8v4j", "input": "8v4j/data/CB1_3_3_001.img", "wavelength": 1.075, "ref": {"sg": "P 42 21 2", "sgno": 94, "cell": [60.972, 60.972, 92.429, 90.0, 90.0, 90.0], "dmin": 1.31}, "tags": ["smv", "tetragonal"]},
{"id": "8v2t", "input": "8v2t/data/MJ504_2_3_00001.cbf", "wavelength": 1.1, "ref": {"sg": "P 42 21 2", "sgno": 94, "cell": [60.906, 60.906, 92.728, 90.0, 90.0, 90.0], "dmin": 1.402}, "tags": ["cbf", "tetragonal"]},
{"id": "5jk4", "input": "5jk4/dioxyhipeg/dioxyhipeg_1_001.img", "wavelength": 0.933, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [37.729, 77.856, 56.287, 90.0, 102.08, 90.0], "dmin": 1.1}, "tags": ["smv", "monoclinic"], "pinned": true},
{"id": "6cs9", "input": "6cs9/568/HBD2D7_2_1_001.img", "wavelength": 0.9537, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [32.871, 25.538, 40.17, 90.0, 98.64, 90.0], "dmin": 1.85}, "tags": ["smv", "monoclinic"]},
{"id": "9lxl", "input": "9lxl/6/1_T10Y-FFp-PNPI_6_master.h5", "wavelength": 0.97919, "ref": {"sg": "P 41 21 2", "sgno": 92, "cell": [76.757, 76.757, 225.338, 90.0, 90.0, 90.0], "dmin": 2.191}, "tags": ["h5", "tetragonal"]},
{"id": "9s02", "input": "9s02/PYCR1-D11_1_master.h5", "wavelength": 0.97625, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [163.674, 88.042, 116.731, 90.0, 90.0, 90.0], "dmin": 1.65}, "tags": ["h5", "orthorhombic"], "tiers": {"ci": "HDF5, orthorhombic P21212"}},
{"id": "6gvk", "input": "6gvk/212_3_0001.cbf", "wavelength": 0.97915, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [105.58, 59.52, 42.4, 90.0, 113.5, 90.0], "dmin": 1.55}, "tags": ["cbf", "monoclinic"], "pinned": true, "tiers": {"ci": "C-centred monoclinic C2"}},
{"id": "4mtk", "input": "4mtk/sbgrid235/lambda_1.0A_1_00001.cbf", "wavelength": 1.0, "ref": {"sg": "P 61", "sgno": 169, "cell": [168.275, 168.275, 652.849, 90.0, 90.0, 120.0], "dmin": 3.322}, "tags": ["cbf", "hexagonal", "large-cell", "long-axis"]},
{"id": "4nwv", "input": "4nwv/sbgrid9/formal.001", "wavelength": 1.12706, "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [402.197, 369.862, 410.511, 90.0, 90.0, 90.0], "dmin": 3.25}, "tags": ["marCCD", "orthorhombic", "large-cell", "virus"]},
{"id": "7d98", "input": "7d98/xrda13/data/cbnrf006_01_00011.cbf", "wavelength": 1.9, "ref": {"sg": "P 61 2 2", "sgno": 178, "cell": [105.819, 105.819, 602.516, 90.0, 90.0, 120.0], "dmin": 3.6}, "tags": ["cbf", "hexagonal", "large-cell", "long-axis", "long-wavelength"], "pinned": true},
{"id": "9v16", "input": "9v16/xrd-00338/9V16/data01_master.h5", "wavelength": 0.9, "ref": {"sg": "P 41 21 2", "sgno": 92, "cell": [185.604, 185.604, 451.242, 90.0, 90.0, 90.0], "dmin": 3.45}, "tags": ["h5", "tetragonal", "large-cell", "long-axis"]},
{"id": "4p8r", "input": "4p8r/data/4p8r/series/gzn0-7.001", "wavelength": 0.97872, "ref": {"sg": "P 65 2 2", "sgno": 179, "cell": [86.7, 86.7, 701.37, 90.0, 90.0, 120.0], "dmin": 2.2}, "tags": ["marCCD", "hexagonal", "large-cell", "long-axis"]}
]}
Reference in New Issue View Git Blame Copy Permalink