mx/Jungfraujoch
3
2 Fork 0
Code Issues Pull Requests Actions Packages Projects Releases 87 Wiki Activity
Files
3a7bb28ed276ecd9b8a53eb629a4cdd3f081bfeb
Jungfraujoch/tools/battery/open.json
T
leonarski_fandClaude Opus 5.5 cf7d35d554 docs: EXTERNAL_TEST_DATA lists every open-arm battery set, with corrected values and counts 
Twelve open-arm sets were missing from the page: 2WNN, 2WNQ, 2WNZ, 2XFW, 4BWL (the Zenodo
pathological-data series, 10.5281/zenodo.54568, with its Sci. Rep. 2018 paper), 5OJV, 6P8J
(SBGrid), 6OWW, 7Q6J, 8C3E, 9QVV (Zenodo) and 9QW2 (Keele). Their rows carry the RCSB
deposited values, the detector read from the files and a DOI verified against DataCite.
A new section describes the twinned and pseudo-symmetric rows (the C 2 2 21 vs P 21 question
of the series, 8C3E's merohedral twin and open screw, the 3MC4/3R6O reference_mismatch notes),
and 6OWW's accepted alternative joins the section on rows where reduction and deposition disagree.

Corrections to what was already there:
- d_min of 6JGJ (0.78), 7L84 (1.70) and 9YZK (5.10) are now the entries' refinement resolution
  like every other row; open.json's 6jgj dmin follows (report-only on the open arm).
- nine titles that had been shortened or paraphrased are now the RCSB titles verbatim.
- 9VX7 was on the page but never in the battery: it is now listed as not in the battery, why.
- the 6r72 battery row runs the low-dose collection, not the helical one; the page said both
  were rows and listed the low-dose one as a dataset without a PDB entry.
- 6H2P is two battery rows (6h2p_native, 6h2p_1p89A); the page now says so.
- the five XRDa DOIs are registered with JaLC, not DataCite.
- "five" primitive no-screw negative controls are twelve; 6PXB is an accepted alternative, not
  unscored; the stale "seven rows have no PDB code" paragraph is replaced.
- the collection counts (repository, facility, crystal system, structure factors) are recomputed;
  several were already wrong before this change (Diamond 20 for 14, CLSI 4 for 3, ...).

The stills page notes that pal90's beamline is CXIDB's (NCI) while 6IRK records CSI.

Co-Authored-By: Claude Opus 5.5 <noreply@anthropic.com>
Claude-Session: https://claude.ai/code/session_015CeEGgpKdfkCTJb3YNMJcu
2026-10-23 12:01:13 +02:00

210 lines
55 KiB
JSON
Raw Blame History

{"arm": "open", "sets": [
{"id": "11if", "input": "11if/BopeA_18500_a_B2-PEF_11if/data/PSL-1503_13949_master.h5", "wavelength": 0.9786, "ref": {"sg": "P 43", "sgno": 78, "cell": [51.14, 51.14, 71.92, 90.0, 90.0, 90.0], "dmin": 1.51}, "tags": ["h5", "tetragonal"], "tiers": {"smoke": "Eiger NXmx from another facility, 4-fold screw"}},
{"id": "36gk", "input": "36gk/CLS-0074_5-3_36GK/data/CLS-0074_5-3_master.h5", "wavelength": 0.95371, "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [120.58, 189.49, 199.69, 90.0, 90.0, 90.0], "dmin": 2.28}, "tags": ["h5", "orthorhombic"]},
{"id": "3inp", "input": "3inp/IDP02542_3inp/data/idp02542b.001", "wavelength": 0.97872, "ref": {"sg": "F 41 3 2", "sgno": 210, "cell": [224.08, 224.08, 224.08, 90.0, 90.0, 90.0], "dmin": 2.05}, "tags": ["marCCD", "cubic"], "tiers": {"ci": "marCCD, face-centred cubic F4132"}},
{"id": "3ky7", "input": "3ky7/IDP90258_3ky7/data/idp90258f.001", "wavelength": 0.97856, "ref": {"sg": "P 43 3 2", "sgno": 212, "cell": [125.176, 125.176, 125.176, 90.0, 90.0, 90.0], "dmin": 2.35}, "tags": ["marCCD", "cubic"]},
{"id": "3mc4", "input": "3mc4/series/206918e4_x0001.img", "wavelength": 1.54178, "ref": {"sg": "H 3", "sgno": 146, "cell": [104.03, 104.03, 105.54, 90.0, 90.0, 120.0], "dmin": 1.95}, "reference_mismatch": "the frames are a crystal twinned ~30% (law k,h,-l, confirmed with XDS on the same frames); the deposited data are an untwinned crystal of the same form", "tags": ["smv", "trigonal", "home-source"]},
{"id": "3meb", "input": "3meb/series/202097g3_x0001.img", "wavelength": 1.54178, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [58.58, 101.15, 81.53, 90.0, 90.62, 90.0], "dmin": 1.9}, "tags": ["smv", "monoclinic", "home-source"]},
{"id": "3p85", "input": "3p85/series/217175d10_x0001.img", "wavelength": 1.54178, "ref": {"sg": "P 63 2 2", "sgno": 182, "cell": [127.29, 127.29, 72.9, 90.0, 90.0, 120.0], "dmin": 1.9}, "tags": ["smv", "hexagonal", "home-source"]},
{"id": "3r6o", "input": "3r6o/series/219594b8_x0001.img", "wavelength": 1.54178, "ref": {"sg": "I 41", "sgno": 80, "cell": [90.68, 90.68, 76.13, 90.0, 90.0, 90.0], "dmin": 1.95}, "symmetry_evidence": "symmetry/3r6o", "reference_mismatch": "the frames are a crystal twinned ~30% (law k,h,-l, confirmed with XDS on the same frames); the deposited data are an untwinned crystal of the same form", "tags": ["smv", "tetragonal", "home-source"]},
{"id": "5cc8", "input": "5cc8/data/263060g10_x0001.img", "wavelength": 1.54178, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [87.14, 93.76, 72.49, 90.0, 90.0, 90.0], "dmin": 1.75}, "symmetry_evidence": "symmetry/5cc8", "tags": ["smv", "orthorhombic", "home-source", "tncs"]},
{"id": "5ebi", "input": "5ebi/dna-rna-chimera_Ba_high_2_001.img", "wavelength": 0.82657, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [35.72, 44.1, 35.72, 90.0, 119.98, 90.0], "dmin": 1.09}, "pinned": true, "symmetry_evidence": "symmetry/5ebi", "tags": ["marCCD", "monoclinic", "twin"]},
{"id": "5epe", "input": "5epe/030805_5epe/data/E1_7_set.001", "wavelength": 0.97856, "ref": {"sg": "F 2 3", "sgno": 196, "cell": [157.536, 157.536, 157.536, 90.0, 90.0, 90.0], "dmin": 1.9}, "tags": ["marCCD", "cubic"]},
{"id": "5f6m", "input": "5f6m/crystal3_00001.cbf", "wavelength": 1.03317, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [54.81, 58.51, 67.42, 90.0, 90.0, 90.0], "dmin": 1.1}, "tags": ["cbf", "orthorhombic", "diffuse"]},
{"id": "5j23", "input": "5j23/012132_5j23/data/XZ2_set.001", "wavelength": 0.97856, "ref": {"sg": "H 3", "sgno": 146, "cell": [175.822, 175.822, 136.839, 90.0, 90.0, 120.0], "dmin": 2.3}, "tags": ["marCCD", "trigonal", "twin"]},
{"id": "5jvn", "input": "5jvn/5jvn/data/PPDK-AV2820_w1_3_0001.cbf", "wavelength": 0.97625, "ref": {"sg": "P 6 2 2", "sgno": 177, "cell": [249.43, 249.43, 84.06, 90.0, 90.0, 120.0], "dmin": 2.9}, "tags": ["cbf", "hexagonal"]},
{"id": "5lzl", "input": "5lzl/pcalad/alad-levoil6_M3S15_1_0001.cbf", "wavelength": 1.04346, "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [205.561, 205.561, 199.171, 90.0, 90.0, 120.0], "dmin": 3.47}, "tags": ["cbf", "trigonal"]},
{"id": "5m17", "input": "5m17/BxGH99_WTDD_HA00AG2801_2_0001.cbf", "wavelength": 0.9795, "ref": {"sg": "I 4", "sgno": 79, "cell": [108.576, 108.576, 67.746, 90.0, 90.0, 90.0], "dmin": 1.03}, "tags": ["cbf", "tetragonal"]},
{"id": "5nw5", "input": "5nw5/5NW5_1_00001.cbf", "wavelength": 0.91863, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [92.14, 169.8, 390.16, 90.0, 90.0, 90.0], "dmin": 6.502}, "tags": ["cbf", "orthorhombic", "low-resolution"]},
{"id": "5reo", "input": "5reo/cbf/Mpro-x0752_1_0001.cbf", "wavelength": 0.9126, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [112.39, 52.59, 44.38, 90.0, 103.04, 90.0], "dmin": 1.88}, "tags": ["cbf", "monoclinic"], "tiers": {"smoke": "fastest set (10 s): miniCBF, monoclinic"}},
{"id": "5src", "input": "5src/5src/data/FRS004_15_1_00001.cbf", "wavelength": 0.88557, "ref": {"sg": "P 43", "sgno": 78, "cell": [88.68, 88.68, 39.23, 90.0, 90.0, 90.0], "dmin": 1.05}, "tags": ["cbf", "tetragonal"]},
{"id": "5uth", "input": "5uth/data/287007e1_0001.img", "wavelength": 1.54178, "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [69.28, 69.28, 153.8, 90.0, 90.0, 120.0], "dmin": 1.95}, "tags": ["smv", "trigonal", "home-source"]},
{"id": "5vml", "input": "5vml/data/271705c8_x_0001.img", "wavelength": 1.54178, "ref": {"sg": "P 42 21 2", "sgno": 94, "cell": [66.31, 66.31, 115.26, 90.0, 90.0, 90.0], "dmin": 1.7}, "tags": ["smv", "tetragonal", "home-source"]},
{"id": "6cee", "input": "6cee/data/Rachel_AV6_screen_0001.img", "wavelength": 1.54178, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [40.72, 44.11, 55.91, 90.0, 90.0, 90.0], "dmin": 1.55}, "tags": ["smv", "orthorhombic", "home-source"]},
{"id": "6fid", "input": "6fid/Trypsin_x1_align_2_0001.cbf", "wavelength": 2.0664, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [59.947, 64.107, 69.694, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["cbf", "orthorhombic"]},
{"id": "6fvz", "input": "6fvz/maox215_6fvz/data/maox215_w1_1_0001.cbf", "wavelength": 0.8729, "ref": {"sg": "C 2 2 2", "sgno": 21, "cell": [131.182, 222.753, 86.482, 90.0, 90.0, 90.0], "dmin": 1.8}, "tags": ["cbf", "orthorhombic"]},
{"id": "6fwc", "input": "6fwc/maox225_6fwc/data/maox225_1_00001.cbf", "wavelength": 1.00004, "ref": {"sg": "C 2 2 2", "sgno": 21, "cell": [131.728, 222.051, 86.293, 90.0, 90.0, 90.0], "dmin": 1.7}, "tags": ["cbf", "orthorhombic"]},
{"id": "6h2p_native", "input": "6h2p/ProlMut1MnCAC_6h2p/data/Prol_Mut1_Mn_X1_nat_1_0002.cbf", "wavelength": 0.9184, "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [103.453, 107.075, 216.543, 90.0, 90.0, 90.0], "dmin": 1.479}, "tags": ["cbf", "orthorhombic", "two-wavelength"]},
{"id": "6h2p_1p89A", "input": "6h2p/ProlMut1MnCAC_6h2p/data/Prol_Mut1_Mn_X_pk1_2_0001.cbf", "wavelength": 1.89317, "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [103.453, 107.075, 216.543, 90.0, 90.0, 90.0], "dmin": null}, "tags": ["cbf", "orthorhombic", "long-wavelength", "two-wavelength"]},
{"id": "6h5t", "input": "6h5t/6h5t/data/SH3-1_x2_1_001.img", "wavelength": 0.895, "ref": {"sg": "I 4 2 2", "sgno": 97, "cell": [86.792, 86.792, 141.768, 90.0, 90.0, 90.0], "dmin": 1.689}, "tags": ["marCCD", "tetragonal"]},
{"id": "6hv2", "input": "6hv2/6hv2/data/coll_1_master.h5", "wavelength": 0.99987, "ref": {"sg": "P 61 2 2", "sgno": 178, "cell": [68.928, 68.928, 133.563, 90.0, 90.0, 120.0], "dmin": 1.709}, "tags": ["h5", "hexagonal"], "tiers": {"ci": "HDF5, hexagonal P6122"}},
{"id": "6hwj", "input": "6hwj/bg3006_2_0001.cbf", "wavelength": 1.0332, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [59.812, 96.07, 80.252, 90.0, 106.69, 90.0], "dmin": 1.979}, "tags": ["cbf", "monoclinic"]},
{"id": "6i3j", "input": "6i3j/6i3j/data/BF19_go_1_0001.img", "wavelength": 0.91841, "ref": {"sg": "F 2 2 2", "sgno": 22, "cell": [134.382, 203.846, 226.744, 90.0, 90.0, 90.0], "dmin": 2.59}, "tags": ["marCCD", "orthorhombic"]},
{"id": "6iu5", "input": "6iu5/6iu5_VIT1_MBD_Zn/peak/peak_000001.cbf", "wavelength": 1.282, "ref": {"sg": "P 31", "sgno": 144, "cell": [84.942, 84.942, 98.19, 90.0, 90.0, 120.0], "dmin": 2.25}, "pinned": true, "tags": ["cbf", "trigonal", "twin"], "tiers": {"ci": "merohedrally twinnable P31, zinc anomalous peak"}},
{"id": "6iu6", "input": "6iu6/6iu6_VIT1_MBD_Ni/peak/peak_000001.cbf", "wavelength": 1.485, "ref": {"sg": "P 31", "sgno": 144, "cell": [84.744, 84.744, 97.398, 90.0, 90.0, 120.0], "dmin": 2.9}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
{"id": "6iu8", "input": "6iu8/6iu8_VIT1_MBD_Co/low/low_000001.cbf", "wavelength": 1.648, "ref": {"sg": "P 31", "sgno": 144, "cell": [85.503, 85.503, 98.355, 90.0, 90.0, 120.0], "dmin": 2.7}, "tags": ["cbf", "trigonal"]},
{"id": "6iu9", "input": "6iu9/6iu9_VIT1_MBD_Fe/peak/data01_000001.cbf", "wavelength": 1.7401, "ref": {"sg": "P 31", "sgno": 144, "cell": [85.321, 85.321, 97.573, 90.0, 90.0, 120.0], "dmin": 3.0}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
{"id": "6jgi", "input": "6jgi/6jgi/data/00001.img", "wavelength": 0.75, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.857, 62.403, 69.172, 90.0, 90.0, 90.0], "dmin": 0.85}, "tags": ["marCCD", "orthorhombic"], "tiers": {"ci": "marCCD, orthorhombic P212121 at 0.75 A"}},
{"id": "6jgj", "input": "6jgj/6jgj/data/000001.cbf", "wavelength": 0.35, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.87, 62.34, 68.85, 90.0, 90.0, 90.0], "dmin": 0.78}, "tags": ["cbf", "orthorhombic", "cdte"]},
{"id": "6moj", "input": "6moj/A9_1_00001.cbf", "wavelength": 0.97741, "ref": {"sg": "I 41 2 2", "sgno": 98, "cell": [130.418, 130.418, 293.453, 90.0, 90.0, 90.0], "dmin": 2.431}, "tags": ["cbf", "tetragonal"], "tiers": {"ci": "body-centred tetragonal I4122"}},
{"id": "6o2h", "input": "6o2h/lys_nitr_10_1_0001.cbf", "wavelength": 0.9768, "ref": {"sg": "P 1", "sgno": 1, "cell": [27.424, 32.134, 34.513, 88.657, 108.46, 111.877], "dmin": 1.212}, "tags": ["cbf", "triclinic", "diffuse"]},
{"id": "6oel", "input": "6oel/1449-8_3_001.img", "wavelength": 0.99994, "ref": {"sg": "F 41 3 2", "sgno": 210, "cell": [328.1, 328.1, 328.1, 90.0, 90.0, 90.0], "dmin": 3.1}, "tags": ["SMV", "cubic"], "tiers": {"smoke": "SMV reader (ADSC), cubic F4132"}},
{"id": "6p8p", "input": "6p8p/14_12_1_0001.cbf", "wavelength": 0.9792, "ref": {"sg": "P 4", "sgno": 75, "cell": [97.525, 97.525, 60.134, 90.0, 90.0, 90.0], "dmin": 1.635}, "tags": ["cbf", "tetragonal"]},
{"id": "6pb3", "input": "6pb3/14_16_1_000001.cbf", "wavelength": 0.97918, "ref": {"sg": "P 6", "sgno": 168, "cell": [100.436, 100.436, 48.86, 90.0, 90.0, 120.0], "dmin": 2.048}, "tags": ["cbf", "hexagonal"]},
{"id": "6pxb", "input": "6pxb/TJB1_3_rachel_1_0001.cbf", "wavelength": 0.9792, "pinned": true, "ref": {"sg": "P 32", "sgno": 145, "cell": [64.021, 64.021, 119.447, 90.0, 90.0, 120.0], "dmin": 1.747}, "ref_alternatives": [{"sg": "P 32 1 2", "sgno": 153, "why": "The deposition merged in point group 3 (its 55502 unique reflections to 1.747 A are what Laue class -3 holds, twice what -3 1 m would) and refined six chains in P 32. The intensities read point group 312 instead: the three added two-folds correlate at 0.98-0.99, at or above the three-folds nobody disputes (0.98), against 0.37-0.40 for the 321 and 622 operators, POINTLESS on our P1 merge picks P -3 1 m (likelihood 1.000), and the reflections centric in 312 but not in 3 are distributed as centric (+435 nats), which a twin law cannot produce. Against that, the deposited chains pair under the added two-fold at 0.3-0.7 A, more than coordinate error at 1.75 A, and the model tells the two indexings apart (R 0.22 against 0.25), so the two-fold may be a near-exact non-crystallographic one; ZANUDA 1.097 with the deposited model keeps P 32 on our data (three free sets) and the depositor's; the model refined in P 32 1 2 reaches R-free 0.49-0.53 against 0.33-0.37. Neither answer is established, so both are accepted; P 31 1 2, which the data cannot separate from P 32 1 2, is accepted as its hand"}], "symmetry_evidence": "symmetry/6pxb", "tags": ["cbf", "trigonal"]},
{"id": "6pxc", "input": "6pxc/TJB6_1_Rachel_1_0001.cbf", "wavelength": 0.9791, "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [44.19, 64.827, 87.239, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf", "orthorhombic"], "tiers": {"ci": "body-centred orthorhombic I222"}},
{"id": "6r72", "input": "6r72/V-CK63-8-ld_1_master.h5", "wavelength": 0.98011, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [117.805, 110.754, 155.615, 90.0, 93.23, 90.0], "dmin": 3.95}, "pinned": true, "tags": ["h5", "monoclinic"]},
{"id": "6rlr", "input": "6rlr/_b4_1_master.h5", "wavelength": 0.97949, "ref": {"sg": "P 1", "sgno": 1, "cell": [39.986, 39.998, 63.643, 80.39, 76.29, 68.15], "dmin": 2.0}, "tags": ["h5", "triclinic", "twin"]},
{"id": "6toc", "input": "6toc/zenodo/dts_1_00001.cbf", "wavelength": 1.00004, "ref": {"sg": "P 42", "sgno": 77, "cell": [31.523, 31.523, 81.599, 90.0, 90.0, 90.0], "dmin": 1.853}, "ref_alternatives": [{"sg": "P 42 2 2", "sgno": 93, "why": "Our reduction and an independent POINTLESS run on our own P1 merge both read point group 422, and the deposited asymmetric unit's two chains are related by the very two-fold the higher group adds, to 0.16 A CA RMSD over 43 residues - coordinate error at 1.85 A. Merging in P 42 2 2 costs 0.0006 in R_meas for 1.75x the multiplicity and correlates better with the deposited model (0.9802 vs 0.9764). The refinement test is NOT unanimous: ZANUDA 1.097 prefers P 42 2 2 on all four data sets tried (ours with three free sets, the depositor's), but R-free favours P 42 2 2 once by 0.008 and P 42 three times by 0.015-0.018, while an independent Refmac 5.8.0431 comparison on a symmetry-consistent free set puts P 42 ahead by 0.004-0.020 depending on cycle count - less than the spread between refinement protocols. Neither answer is established: a pseudo-symmetry too exact for any test we have remains a live explanation, and so does the deposited assignment. Either is accepted"}], "symmetry_evidence": "symmetry/6toc", "tags": ["cbf", "tetragonal", "twin"]},
{"id": "6ttn", "input": "6ttn/6ttn/data/H6H_33_01_hyo_full_1_0001.cbf", "wavelength": 0.9184, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [39.894, 79.841, 104.701, 90.0, 90.0, 90.0], "dmin": 1.12}, "tags": ["cbf", "orthorhombic"]},
{"id": "6u7g", "input": "6u7g/6u7g/data/SNB02_11_8_1_master.h5", "wavelength": 1.03318, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [99.555, 98.682, 147.525, 90.0, 104.6, 90.0], "dmin": 2.35}, "pinned": true, "tags": ["h5", "monoclinic"]},
{"id": "6ukf", "input": "6ukf/6ukf/data/XDC-7_Pn6_000001.cbf", "wavelength": 0.8, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [61.018, 37.317, 69.027, 90.0, 109.768, 90.0], "dmin": 1.0}, "tags": ["cbf", "monoclinic"]},
{"id": "6v2r", "input": "6v2r/data/cbx7.248483.hv6_screen_0001.img", "wavelength": 1.54178, "ref": {"sg": "P 41 21 2", "sgno": 92, "cell": [40.193, 40.193, 83.127, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["smv", "tetragonal", "home-source"], "tiers": {"ci": "home source SMV, strong anomalous signal"}},
{"id": "6vww", "input": "6vww/IDP51000_6vww/data/m4H11g_00001.cbf", "wavelength": 0.97918, "ref": {"sg": "P 63", "sgno": 173, "cell": [150.539, 150.539, 111.31, 90.0, 90.0, 120.0], "dmin": 2.2}, "tags": ["cbf", "hexagonal", "twin"], "tiers": {"smoke": "merohedral twin, P63"}},
{"id": "6w4h", "input": "6w4h/IDP51000_6W4H/data/idp51000-201-a_1_2_3.001", "wavelength": 0.97872, "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [167.74, 167.74, 51.942, 90.0, 90.0, 120.0], "dmin": 1.8}, "tags": ["marCCD", "trigonal"]},
{"id": "6wzo", "input": "6wzo/9_1_1_000001.cbf", "wavelength": 0.97918, "ref": {"sg": "P 1", "sgno": 1, "cell": [43.718, 50.061, 69.337, 106.499, 90.094, 97.145], "dmin": 1.42}, "tags": ["cbf", "triclinic"]},
{"id": "6yqf", "input": "6yqf/6yqf/data/SYCE2TEX12-8_1_0001.cbf", "wavelength": 0.96878, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [42.67, 59.68, 156.49, 90.0, 90.0, 90.0], "dmin": 3.327}, "tags": ["cbf", "orthorhombic"]},
{"id": "6z8o", "input": "6z8o/HASE01-gaKr1_w1_1_1_master.h5", "wavelength": 0.9677, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [63.716, 97.022, 121.318, 90.0, 104.656, 90.0], "dmin": 2.2}, "tags": ["h5", "monoclinic"]},
{"id": "6ze4", "input": "6ze4/806/o8_1_0001.cbf", "wavelength": 0.9184, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [93.56, 109.88, 116.11, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf", "orthorhombic"], "tiers": {"smoke": "known hard: P212121 under-called as P21 since rc168"}},
{"id": "7arr", "input": "7arr/PF4N_04D_w1_1_00001.cbf", "wavelength": 0.97626, "ref": {"sg": "P 1", "sgno": 1, "cell": [30.937, 32.068, 43.087, 114.16, 91.88, 109.86], "dmin": 1.1}, "tags": ["cbf", "triclinic"]},
{"id": "7atg", "input": "7atg/7atg/data/put-2-2.0s_5_00001.cbf", "wavelength": 0.72932, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [17.97, 31.02, 43.86, 90.0, 90.0, 90.0], "dmin": 0.6}, "tags": ["cbf", "orthorhombic"]},
{"id": "7bgt", "input": "7bgt/MPMV2243_3_001.img", "wavelength": 0.82657, "ref": {"sg": "P 1", "sgno": 1, "cell": [29.296, 67.618, 69.716, 76.845, 83.875, 83.645], "dmin": 1.93}, "tags": ["marCCD", "triclinic"]},
{"id": "7brr", "input": "7brr/7brr/data/3C_2_1_master.h5", "wavelength": 0.97919, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [55.45, 99.02, 59.583, 90.0, 108.54, 90.0], "dmin": 1.35}, "tags": ["h5", "monoclinic"]},
{"id": "7dkp", "input": "7dkp/7dkp/data/LOX1-sree-p1a9-1p2_w1_1_1_master.h5", "wavelength": 0.9677, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [49.84, 169.451, 49.842, 90.0, 93.51, 90.0], "dmin": 1.45}, "tags": ["h5", "monoclinic"]},
{"id": "7k1l", "input": "7k1l/IDP52015_7k1l/data/cs1C2eg_00001.cbf", "wavelength": 0.97913, "ref": {"sg": "P 63", "sgno": 173, "cell": [150.83, 150.83, 110.73, 90.0, 90.0, 120.0], "dmin": 2.25}, "symmetry_evidence": "symmetry/7k1l", "tags": ["cbf", "hexagonal"], "tiers": {"smoke": "known hard: screw axis (P6 vs P63)"}},
{"id": "7kcn", "input": "7kcn/7kcn/data/ttr_hiuase_1_D1_33_00001.cbf", "wavelength": 1.45901, "ref": {"sg": "P 41 2 2", "sgno": 91, "cell": [67.03, 67.03, 116.89, 90.0, 90.0, 90.0], "dmin": 1.46}, "tags": ["cbf", "tetragonal"]},
{"id": "7l6j", "input": "7l6j/7l6j/data/idp97824-102sm-a_1_1_7.001", "wavelength": 0.97872, "ref": {"sg": "I 41 3 2", "sgno": 214, "cell": [171.693, 171.693, 171.693, 90.0, 90.0, 90.0], "dmin": 1.78}, "tags": ["marCCD", "cubic"]},
{"id": "7l84", "input": "7l84/301_helical_1_0001.cbf", "wavelength": 1.892, "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [79.344, 79.344, 37.81, 90.0, 90.0, 90.0], "dmin": 1.7}, "tags": ["cbf", "tetragonal"]},
{"id": "7mzt", "input": "7mzt/7mzt/data/BVG2_Pn3_000001.cbf", "wavelength": 1.0, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [113.619, 96.989, 108.33, 90.0, 90.0, 90.0], "dmin": 4.07}, "symmetry_evidence": "symmetry/7mzt", "tags": ["cbf", "orthorhombic"]},
{"id": "7n0i", "input": "7n0i/8_2_1_00001.cbf", "wavelength": 1.00004, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [75.846, 131.557, 140.048, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["cbf", "orthorhombic", "tncs"]},
{"id": "7n2s", "input": "7n2s/1449-4_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [83.211, 52.789, 106.291, 90.0, 98.278, 90.0], "dmin": 2.37}, "tags": ["cbf", "monoclinic"]},
{"id": "7orr", "input": "7orr/7orr/data/Nsp10-VT00022_1_master.h5", "wavelength": 0.97879, "ref": {"sg": "I 21 3", "sgno": 199, "cell": [105.88, 105.88, 105.88, 90.0, 90.0, 90.0], "dmin": 1.79}, "symmetry_evidence": "symmetry/7orr", "tags": ["h5", "cubic"]},
{"id": "7os3", "input": "7os3/pos2_1/pos2_1_00001.cbf", "wavelength": 2.0664, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [78.15, 91.05, 105.84, 90.0, 90.0, 90.0], "dmin": 2.177}, "tags": ["cbf", "orthorhombic"]},
{"id": "7ph1", "input": "7ph1/7ph1/data/9_1_0001.cbf", "wavelength": 0.9184, "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [74.975, 81.289, 124.248, 90.0, 90.0, 90.0], "dmin": 1.18}, "tags": ["cbf", "orthorhombic"]},
{"id": "7pq7", "input": "7pq7/7pq7/data/1436_p52_A3_1_1_00001.cbf", "wavelength": 0.9789, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [120.88, 51.73, 75.54, 90.0, 125.14, 90.0], "dmin": 1.55}, "tags": ["cbf", "monoclinic"]},
{"id": "7qij", "input": "7qij/907/dg046_2_data_1_00001.cbf", "wavelength": 0.97625, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [143.46, 324.92, 369.38, 90.0, 90.0, 90.0], "dmin": 4.1}, "tags": ["cbf", "orthorhombic"]},
{"id": "7qis", "input": "7qis/7qis/data/Chymo_Dfe_x1_2_0001.cbf", "wavelength": 0.9184, "ref": {"sg": "P 61", "sgno": 169, "cell": [100.269, 100.269, 206.215, 90.0, 90.0, 120.0], "dmin": 1.83}, "tags": ["cbf", "hexagonal"]},
{"id": "7ris", "input": "7ris/7ris/data/GLVase_Ca_we21108b7b_1_2_2.001_master.h5", "wavelength": 1.03329, "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [44.54, 44.54, 189.95, 90.0, 90.0, 120.0], "dmin": 1.72}, "pinned": true, "tags": ["h5", "trigonal"]},
{"id": "7rji", "input": "7rji/7rji/data/DD3_00000.cbf", "wavelength": 1.45859, "ref": {"sg": "H 3 2", "sgno": 155, "cell": [83.036, 83.036, 124.83, 90.0, 90.0, 120.0], "dmin": 1.71}, "tags": ["cbf", "trigonal"]},
{"id": "7t5t", "input": "7t5t/A1_2_00001.cbf", "wavelength": 0.97892, "ref": {"sg": "P 42 21 2", "sgno": 94, "cell": [95.309, 95.309, 104.915, 90.0, 90.0, 90.0], "dmin": 1.35}, "pinned": true, "tags": ["cbf", "tetragonal"]},
{"id": "7tcd", "input": "7tcd/7tcd/data/col_1_master.h5", "wavelength": 0.99987, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [138.504, 47.902, 78.068, 90.0, 107.56, 90.0], "dmin": 1.7}, "tags": ["h5", "monoclinic"]},
{"id": "7yzx", "input": "7yzx/7yzx/data/783-1_1_0001.cbf", "wavelength": 0.96864, "ref": {"sg": "P 63 2 2", "sgno": 182, "cell": [169.42, 169.42, 141.83, 90.0, 90.0, 120.0], "dmin": 1.9}, "tags": ["cbf", "hexagonal"]},
{"id": "8a1a", "input": "8a1a/L1F11v1_8a1a/data/L1-F11-v1_9ly1_D06_01_2_master.h5", "wavelength": 1.0, "ref": {"sg": "P 65", "sgno": 170, "cell": [191.866, 191.866, 122.409, 90.0, 90.0, 120.0], "dmin": 2.05}, "tags": ["h5", "hexagonal"]},
{"id": "8agq", "input": "8agq/8agq_zip_8AGQ/data/coll_1_00001.cbf", "wavelength": 1.0, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [89.948, 55.447, 54.787, 90.0, 113.55, 90.0], "dmin": 1.093}, "tags": ["cbf", "monoclinic"]},
{"id": "8dqb", "input": "8dqb/KloxA_17380_a_B1-Apo_I23_Form_8dqb/data/PSL-1405_653_master.h5", "wavelength": 0.97856, "ref": {"sg": "I 2 3", "sgno": 197, "cell": [164.124, 164.124, 164.124, 90.0, 90.0, 90.0], "dmin": 2.5}, "tags": ["h5", "cubic"]},
{"id": "8dyz", "input": "8dyz/lys_1_2_0001.cbf", "wavelength": 0.9768, "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [79.632, 79.632, 38.296, 90.0, 90.0, 90.0], "dmin": 1.272}, "tags": ["cbf", "tetragonal", "diffuse"]},
{"id": "8dz7", "input": "8dz7/lys_rt_2_38_0001.cbf", "wavelength": 0.976, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [30.486, 56.401, 73.852, 90.0, 90.0, 90.0], "dmin": 1.34}, "tags": ["cbf", "orthorhombic", "diffuse"]},
{"id": "8egn", "input": "8egn/PsaeA_00137_b_B5-az13643701_8egn/data/FKC8_4_0001.cbf", "wavelength": 1.1807, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [71.69, 75.16, 109.79, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["cbf", "orthorhombic"]},
{"id": "8iya", "input": "8iya/8iya/data/11_1_master.h5", "wavelength": 0.97918, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [102.747, 50.077, 109.248, 90.0, 91.754, 90.0], "dmin": 2.43}, "tags": ["h5", "monoclinic"]},
{"id": "8k1g", "input": "8k1g/8k1g/data/KP02_0001.cbf", "wavelength": 0.97942, "ref": {"sg": "I 4 2 2", "sgno": 97, "cell": [182.01, 182.01, 80.71, 90.0, 90.0, 90.0], "dmin": 2.09}, "tags": ["cbf", "tetragonal"]},
{"id": "8oic", "input": "8oic/8oic/data/_b20_1_master.h5", "wavelength": 0.9795, "ref": {"sg": "P 1", "sgno": 1, "cell": [73.055, 94.665, 120.589, 105.081, 89.959, 93.826], "dmin": 2.8}, "tags": ["h5", "triclinic"]},
{"id": "8owm", "input": "8owm/p13x4_1_00001.cbf.gz", "wavelength": 0.97625, "ref": {"sg": "P 1", "sgno": 1, "cell": [95.544, 95.629, 95.841, 90.416, 93.59, 117.775], "dmin": 1.7}, "tags": ["cbf", "triclinic"]},
{"id": "8pqd", "input": "8pqd/8pqd/data/11AT05_w1_1_1_master.h5", "wavelength": 0.9677, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [59.39, 59.37, 192.89, 90.0, 90.0, 90.0], "dmin": 1.5}, "tags": ["h5", "orthorhombic"]},
{"id": "8qaw", "input": "8qaw/p18x3/p18x3_1_00001.cbf.gz", "wavelength": 0.97625, "ref": {"sg": "H 3", "sgno": 146, "cell": [137.68, 137.68, 265.907, 90.0, 90.0, 120.0], "dmin": 1.55}, "tags": ["cbf", "trigonal", "long-axis"], "tiers": {"ci": "large: 3600 frames of cbf.gz, rhombohedral H3, 266 A axis"}},
{"id": "8qj5", "input": "8qj5/8qj5/data/Lcsbc3_1_2_00001.cbf", "wavelength": 1.0, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [57.61, 100.63, 77.93, 90.0, 96.06, 90.0], "dmin": 1.63}, "tags": ["cbf", "monoclinic"]},
{"id": "8qq7", "input": "8qq7/cbf/SpNox-Sp49-B3-B_088_1_0001.cbf", "wavelength": 0.966, "ref": {"sg": "P 64 2 2", "sgno": 181, "cell": [145.967, 145.967, 153.619, 90.0, 90.0, 120.0], "dmin": 3.62}, "tags": ["cbf", "hexagonal"]},
{"id": "8r5r", "input": "8r5r/8r5r/data/D5-33805_1_1_master.h5", "wavelength": 0.8856, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [91.74, 132.91, 137.5, 90.0, 90.0, 90.0], "dmin": 3.08}, "tags": ["h5", "orthorhombic"]},
{"id": "8rud", "input": "8rud/p08x03_1_00001.cbf.gz", "wavelength": 0.97626, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [78.066, 91.386, 114.547, 90.0, 96.9, 90.0], "dmin": 2.1}, "tags": ["cbf", "monoclinic"]},
{"id": "8s38", "input": "8s38/MX733_2_00001.cbf", "wavelength": 0.97626, "ref": {"sg": "I 21 21 21", "sgno": 24, "cell": [95.368, 163.1, 219.023, 90.0, 90.0, 90.0], "dmin": 1.89}, "symmetry_evidence": "symmetry/8s38", "tags": ["cbf", "orthorhombic"]},
{"id": "8sa8", "input": "8sa8/KlaeA_00906_a_B1-PLP_8sa8/data/PSL-0412_255_master.h5", "wavelength": 0.97949, "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [87.887, 131.544, 165.363, 90.0, 104.48, 90.0], "dmin": 1.3}, "tags": ["h5", "monoclinic"]},
{"id": "8sqo", "input": "8sqo/BrabA_00028_a_A1-Mg_8sqo/data/PSL-1801_942_master.h5", "wavelength": 0.97949, "ref": {"sg": "P 4 3 2", "sgno": 207, "cell": [112.91, 112.91, 112.91, 90.0, 90.0, 90.0], "dmin": 1.55}, "tags": ["h5", "cubic"]},
{"id": "8sqq", "input": "8sqq/BrabA_00028_a_A1-Apo_8sqq/data/PSL-1810_965_master.h5", "wavelength": 0.97949, "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [171.52, 171.52, 171.52, 90.0, 90.0, 90.0], "dmin": 2.25}, "tags": ["h5", "cubic"]},
{"id": "8sqt", "input": "8sqt/BrabA_00028_a_A1-Fe_8sqt/data/PSL-1812_971_master.h5", "wavelength": 0.97949, "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [170.72, 170.72, 170.72, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["h5", "cubic"]},
{"id": "8t7r", "input": "8t7r/8t7r/data/GREEN-04_Pn5_000001.cbf", "wavelength": 1.0, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [357.076, 259.582, 255.361, 90.0, 133.13, 90.0], "dmin": 3.84}, "tags": ["cbf", "monoclinic"]},
{"id": "8tha", "input": "8tha/1TEL_double_helix_8tha/data/A3_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 64", "sgno": 172, "cell": [69.16, 69.16, 29.13, 90.0, 90.0, 120.0], "dmin": 1.68}, "tags": ["cbf", "hexagonal"]},
{"id": "8tyy", "input": "8tyy/CPS_2_1_000001.cbf", "wavelength": 0.97918, "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [214.891, 214.891, 214.891, 90.0, 90.0, 90.0], "dmin": 1.68}, "tags": ["cbf", "cubic"]},
{"id": "8u0i", "input": "8u0i/8u0i/data/dI-2-05a_4_00001.cbf", "wavelength": 1.00004, "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [50.317, 50.317, 90.596, 90.0, 90.0, 90.0], "dmin": 1.541}, "tags": ["cbf", "tetragonal"], "tiers": {"ci": "miniCBF, tetragonal P43212"}},
{"id": "8v4o", "input": "8v4o/CaalA_00629_a_FS11-AMP_8v4o/data/PSL-1602_2180_master.h5", "wavelength": 0.97949, "ref": {"sg": "P 61 2 2", "sgno": 178, "cell": [139.46, 139.46, 544.99, 90.0, 90.0, 120.0], "dmin": 2.7}, "tags": ["h5", "hexagonal"]},
{"id": "8xbp", "input": "8xbp/8xbp/data/puck2872_3_1_master.h5", "wavelength": 0.97856, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [148.29, 50.78, 60.21, 90.0, 92.33, 90.0], "dmin": 1.99}, "ref_override": {"cell": [148.736, 51.777, 60.181, 90.0, 92.36, 90.0]}, "ref_override_why": "the uploaded sweep is a different crystal from the one the deposited cell describes: master data_collection_date 2023-06-21, deposited _diffrn_detector.pdbx_collection_date 2023-06-23, and the deposited b = 50.78 is 2.0% from the b these images give. The override is the cell DIALS 3.29 indexes de novo on this master, b = 51.777(11); the deposited space group and d_min are kept", "tags": ["h5", "monoclinic"]},
{"id": "8xte", "input": "8xte/1101/G2_1_00001.cbf", "wavelength": 0.97853, "ref": {"sg": "P 32", "sgno": 145, "cell": [208.77, 208.77, 67.22, 90.0, 90.0, 120.0], "dmin": 1.99}, "ref_alternatives": [{"sg": "P 31 2 1", "sgno": 152, "why": "The evidence favours the higher group here. The twin-immune centric zone of the added two-folds - reflections the higher group makes centric, which are their own twin mates and so cannot be made to read centric by a merohedral twin law - gives <|E^2-1|> = 0.946 +/- 0.012 against a centric expectation of 0.968 and an acentric 0.736, at +707 nats. Re-refinement on a shared free set with the twin law removed from both sides favours P 3_2 2 1 (0.2177/0.2322) over P 3_2 (0.2460/0.2612), and the deposited entry's published R values reproduce only with an undeclared twin law h,-h-k,-l at alpha = 0.50, which is itself a 321-symmetric target. No refinement R can close the question in principle, because a merohedral twin at exactly alpha = 0.5 and true 321 predict identical intensities; the case rests on the centric zone. ZANUDA 1.097 keeps P 32: the deposited chains are 6.1 A from the 321 symmetry and refine to R-free 0.54-0.57 in P 32 2 1; the deposited model gives the higher group no support. Both answers are accepted, neither established"}], "symmetry_evidence": "symmetry/8xte", "tags": ["cbf", "trigonal"]},
{"id": "8xtf", "input": "8xtf/1102/puck03_12_1_master.h5", "wavelength": 0.97918, "ref": {"sg": "H 3 2", "sgno": 155, "cell": [211.75, 211.75, 67.42, 90.0, 90.0, 120.0], "dmin": 2.13}, "tags": ["h5", "trigonal"]},
{"id": "8xtg", "input": "8xtg/1100/mpag15_1_00001.cbf", "wavelength": 0.97853, "ref": {"sg": "P 32", "sgno": 145, "cell": [199.54, 199.54, 67.15, 90.0, 90.0, 120.0], "dmin": 2.0}, "ref_alternatives": [{"sg": "P 31 2 1", "sgno": 152, "why": "The evidence favours the DEPOSITION here, and this row must not be read as the 8xte one. Every correlation-based instrument we have - our own operator correlations, POINTLESS (0.85 on our P1 merge) - reads point group 321, but our own twin-immune centric-zone test, the only one that separates real symmetry from pseudo-symmetry, read <|E^2-1|> = 0.869 at -44.9 nats against the promotion when it assumed an untwinned zone; read at the fraction of the crystal's other twin laws (rc174) it now favours the promotion, with an L-test twin fraction of 0.20-0.26. Whether this crystal is partially twinned or purely pseudo-symmetric is not established. ZANUDA 1.097 prefers P 32 2 1 on all four data sets (model within 1.2 A of it), while R-free favours P 32 by 0.006-0.019 on each. Both answers are accepted, the deposition being the better supported"}], "symmetry_evidence": "symmetry/8xtg", "tags": ["cbf", "trigonal"]},
{"id": "8y74", "input": "8y74/1_1/1_1_master.h5", "wavelength": 0.97918, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [125.782, 76.553, 87.143, 90.0, 92.449, 90.0], "dmin": 1.9}, "tags": ["h5", "monoclinic"]},
{"id": "8ys9", "input": "8ys9/8YS9_xray-data_8ys9/data/SDS_09_18112_master.h5", "wavelength": 0.97957, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [71.04, 77.68, 83.16, 90.0, 90.0, 90.0], "dmin": 1.46}, "tags": ["h5", "orthorhombic"]},
{"id": "9b22", "input": "9b22/KlpnC_20447_a_B1-AR6-AMP_9b22/data/PSL-1011_1580_master.h5", "wavelength": 0.97856, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [39.826, 92.659, 57.716, 90.0, 91.68, 90.0], "dmin": 1.3}, "tags": ["h5", "monoclinic"], "tiers": {"ci": "HDF5, monoclinic P21 at 1.1 A"}},
{"id": "9bn8", "input": "9bn8/EscoA_17938_a_AE1-UMA-A1AQS_9bn8/data/PSL-0401_8296_master.h5", "wavelength": 0.97856, "ref": {"sg": "P 41", "sgno": 76, "cell": [65.488, 65.488, 134.764, 90.0, 90.0, 90.0], "dmin": 1.35}, "tags": ["h5", "tetragonal"]},
{"id": "9c18", "input": "9c18/BLVRB-2_5217_master.h5", "wavelength": 0.9201, "ref": {"sg": "P 1", "sgno": 1, "cell": [41.94, 41.977, 60.212, 84.11, 87.24, 63.66], "dmin": 1.9}, "tags": ["h5", "triclinic"]},
{"id": "9chw", "input": "9chw/D1.001", "wavelength": 0.97872, "ref": {"sg": "P 61", "sgno": 169, "cell": [98.686, 98.686, 82.062, 90.0, 90.0, 120.0], "dmin": 2.16}, "tags": ["marCCD", "hexagonal"]},
{"id": "9crw", "input": "9crw/data_9crw/data/Kip3-475-22-2_master.h5", "wavelength": 0.95299, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [83.96, 104.57, 118.78, 90.0, 93.37, 90.0], "dmin": 2.49}, "tags": ["h5", "monoclinic"]},
{"id": "9e2t", "input": "9e2t/ga026f4b-1_5_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 1", "sgno": 1, "cell": [75.499, 78.082, 101.219, 94.63, 103.39, 114.55], "dmin": 2.28}, "tags": ["cbf", "triclinic"]},
{"id": "9ea5", "input": "9ea5/K4_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [65.868, 73.064, 98.399, 90.0, 108.725, 90.0], "dmin": 2.0}, "tags": ["cbf", "monoclinic"]},
{"id": "9fcg", "input": "9fcg/IBCH-15-p02x06_2_00001.cbf.gz", "wavelength": 0.97626, "ref": {"sg": "P 4", "sgno": 75, "cell": [87.79, 87.79, 35.633, 90.0, 90.0, 90.0], "dmin": 1.54}, "tags": ["cbf", "tetragonal"], "tiers": {"smoke": "cbf.gz reader, pure 4-fold"}},
{"id": "9fhc", "input": "9fhc/te/te312_2_001.img", "wavelength": 1.0, "ref": {"sg": "I 2 3", "sgno": 197, "cell": [227.46, 227.46, 227.46, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["marCCD", "cubic"]},
{"id": "9gdj", "input": "9gdj/slh34_w1_1_1_master.h5", "wavelength": 0.8856, "ref": {"sg": "P 41 21 2", "sgno": 92, "cell": [123.92, 123.92, 126.44, 90.0, 90.0, 90.0], "dmin": 1.47}, "tags": ["h5", "tetragonal", "cdte"], "tiers": {"ci": "CdTe detector (HDF5), 1.4 A, about 100 s"}},
{"id": "9gjx", "input": "9gjx/BlNTR_9gjx/data/SC6_1_master.h5", "wavelength": 0.9795, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [76.776, 115.807, 103.807, 90.0, 110.29, 90.0], "dmin": 2.4}, "tags": ["h5", "monoclinic"]},
{"id": "9gqg", "input": "9gqg/MX-2555/FKBP51-MSP500-A-5522-11_1_3094759/FKBP51-MSP500-A-5522-11_1_1_master.h5", "wavelength": 0.87313, "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [48.157, 48.157, 188.036, 90.0, 90.0, 120.0], "dmin": 2.0}, "tags": ["h5", "trigonal"]},
{"id": "9hnc", "input": "9hnc/asp_7_00001.cbf", "wavelength": 0.72931, "ref": {"sg": "P 1 2 1", "sgno": 3, "cell": [123.764, 123.645, 187.679, 90.0, 90.063, 90.0], "dmin": 1.879}, "symmetry_evidence": "symmetry/9hnc", "tags": ["cbf", "monoclinic"]},
{"id": "9hs7", "input": "9hs7/9hs7/data/B28X1_1_0001.cbf", "wavelength": 0.97926, "ref": {"sg": "P 65", "sgno": 170, "cell": [65.44, 65.44, 88.77, 90.0, 90.0, 120.0], "dmin": 1.698}, "tags": ["cbf", "hexagonal"]},
{"id": "9i0a", "input": "9i0a/carm1END468_9i0a_tar_9I0A/data/X151B1_1_master.h5", "wavelength": 0.97857, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [75.237, 98.676, 208.551, 90.0, 90.0, 90.0], "dmin": 2.22}, "tags": ["h5", "orthorhombic"]},
{"id": "9i80", "input": "9i80/20230422-PX1-LecA_RO5-5315-1/LecA-RO5_1_master.h5", "wavelength": 0.97856, "ref": {"sg": "P 41", "sgno": 76, "cell": [81.214, 81.214, 165.029, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["h5", "tetragonal", "twin"]},
{"id": "9ig7", "input": "9ig7/9IG7/data/KOD-P596-G2_3_00001.cbf", "wavelength": 0.97626, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [111.472, 153.471, 69.03, 90.0, 90.0, 90.0], "dmin": 2.6}, "tags": ["cbf", "orthorhombic"]},
{"id": "9ih9", "input": "9ih9/run_01_05_datacollection_9IH9/data/design-Xinjian-P1Thro-4_1_5_1_master.h5", "wavelength": 0.9677, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [78.758, 133.933, 82.32, 90.0, 101.356, 90.0], "dmin": 1.7}, "tags": ["h5", "monoclinic"]},
{"id": "9jq9", "input": "9jq9/pfplrxdata_9JQ9/data/lp13_001.cbf", "wavelength": 1.3477, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [48.551, 50.499, 78.571, 90.0, 90.0, 90.0], "dmin": 1.9}, "tags": ["cbf", "orthorhombic", "home-source"]},
{"id": "9jzo", "input": "9jzo/JS_35P2_C3-002_diffraction_files_9JZO/data/JS_35P2_C3-002_0001.cbf", "wavelength": 0.97942, "ref": {"sg": "P 1", "sgno": 1, "cell": [41.63, 43.1, 54.2, 112.97, 90.11, 118.18], "dmin": 1.4}, "tags": ["cbf", "triclinic"], "tiers": {"smoke": "triclinic P1", "ci": "triclinic P1"}},
{"id": "9khr", "input": "9khr/PfPlrx-DTT-9KHR/data-PfPlrx-DTT-9KHR/ods1467-lp13D1-01001.mccd", "wavelength": 0.97893, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [48.704, 50.31, 78.018, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["marCCD", "orthorhombic"], "tiers": {"smoke": "marCCD reader (.mccd), fast", "ci": "marCCD reader (.mccd)"}},
{"id": "9mh4", "input": "9mh4/KlaeA_00150_a_B1_9mh4/data/PSL-0501_2719_master.h5", "wavelength": 0.97856, "ref": {"sg": "P 21 3", "sgno": 198, "cell": [138.65, 138.65, 138.65, 90.0, 90.0, 90.0], "dmin": 3.05}, "tags": ["h5", "cubic"]},
{"id": "9min", "input": "9min/1151/A8_31_00001.cbf", "wavelength": 1.00003, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [95.45, 98.54, 155.74, 90.0, 90.0, 90.0], "dmin": 2.05}, "tags": ["cbf", "orthorhombic"], "tiers": {"smoke": "known hard: halved axis"}},
{"id": "9o0h", "input": "9o0h/3TEL-GG-TNK1-UBA_9o0h/data/E1_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [55.15, 65.54, 112.9, 90.0, 90.0, 90.0], "dmin": 2.24}, "tags": ["cbf", "orthorhombic"]},
{"id": "9p7q", "input": "9p7q/9p7q_9P7Q/data/SAMDC_MTA_273_40_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [96.978, 45.018, 72.061, 90.0, 105.109, 90.0], "dmin": 2.21}, "tags": ["cbf", "monoclinic"]},
{"id": "9pbb", "input": "9pbb/9pbb_9PBB/data/SAMDC_MTA_293_30_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [97.418, 45.876, 72.248, 90.0, 104.971, 90.0], "dmin": 2.17}, "pinned": true, "tags": ["cbf", "monoclinic"]},
{"id": "9q41", "input": "9q41/apoSPDS_1_master.h5", "wavelength": 0.8857, "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [118.568, 133.704, 82.369, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["h5", "orthorhombic"]},
{"id": "9q66", "input": "9q66/PREP_JP417_D8a_12694_master.h5", "wavelength": 0.91976, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [105.853, 67.294, 158.019, 90.0, 99.109, 90.0], "dmin": 2.01}, "tags": ["h5", "monoclinic"]},
{"id": "9qw8", "input": "9qw8/MX-2555/run_03_datacollection [2023-09-08 22:19:51]/FKBP12BRD4-5519-6-BD1-PPU688_w1_1_1_master.h5", "wavelength": 0.8856, "ref": {"sg": "P 1", "sgno": 1, "cell": [35.648, 35.65, 100.919, 86.458, 84.218, 72.475], "dmin": 1.8}, "tags": ["h5", "triclinic"]},
{"id": "9rci", "input": "9rci/FEN1-CD029134_A09-3_AD049A-10_1_master.h5", "wavelength": 0.9801, "ref": {"sg": "P 1", "sgno": 1, "cell": [35.869, 39.297, 100.916, 98.3, 90.32, 90.09], "dmin": 1.662}, "ref_alternatives": [{"cell": [35.869, 39.297, 199.976, 87.087, 90.341, 90.09], "why": "The deposited cell is the (0,1/2,1/2)-centred sublattice of the supercell we report, to 0.17%, and both descriptions of this lattice are defensible. The Patterson has an off-origin peak at 62.5% of the origin, so a real translational NCS relates the two halves of our cell: describing the crystal by the doubled cell with the near-translation left in the content, or by its sublattice with the near-translation absorbed into the lattice, is a choice, not a measurement. The alternative cell is the deposited one doubled along c with the centring removed (c' = b + 2c), computed from the deposited cell alone - not from our output"}], "tags": ["h5", "triclinic", "tncs"]},
{"id": "9rcs", "input": "9rcs/760_B7_x1_1_master.h5", "wavelength": 0.61992, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [70.01, 78.8, 82.34, 90.0, 88.64, 90.0], "dmin": 3.012}, "tags": ["h5", "monoclinic", "cdte"]},
{"id": "9rp9", "input": "9rp9/data_9RP9/data/TAR148-TAR148_X2_1_master.h5", "wavelength": 0.97856, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [73.48, 59.78, 91.67, 90.0, 100.85, 90.0], "dmin": 2.1}, "tags": ["h5", "monoclinic"]},
{"id": "9sl0", "input": "9sl0/wt-1_9sl0/data/design-Yan-HLA-WT-1_1_5_1_master.h5", "wavelength": 0.87313, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [60.181, 80.201, 111.589, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["h5", "orthorhombic"], "tiers": {"ci": "HDF5, orthorhombic P212121"}},
{"id": "9t6s", "input": "9t6s/CadC-AF6586_1_5_1_master.h5", "wavelength": 0.8856, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [63.004, 64.574, 102.705, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["h5", "orthorhombic", "tncs"]},
{"id": "9upt", "input": "9upt/Raw data 1A/C12_7_00001.img", "wavelength": 0.99984, "ref": {"sg": "P 6", "sgno": 168, "cell": [158.27, 158.27, 53.962, 90.0, 90.0, 120.0], "dmin": 2.369}, "tags": ["SMV", "hexagonal"]},
{"id": "9vyb", "input": "9vyb/Antitoxin Phd_9vyb/data/G7-5_4187_master.h5", "wavelength": 1.00003, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [44.37, 47.76, 48.35, 90.0, 90.0, 90.0], "dmin": 2.12}, "tags": ["h5", "orthorhombic"]},
{"id": "9w3y", "input": "9w3y/9w3y/data/collect_01_00001_master.h5", "wavelength": 1.007, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [60.75, 69.98, 94.24, 90.0, 90.0, 90.0], "dmin": 1.5}, "tags": ["h5", "orthorhombic"]},
{"id": "9yl4", "input": "9yl4/data_MJ4720/UWO0004_06_0001.cbf", "wavelength": 0.9795, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [95.837, 111.339, 402.967, 90.0, 90.0, 90.0], "dmin": 3.7}, "pinned": true, "tags": ["cbf", "orthorhombic"]},
{"id": "9yzk", "input": "9yzk/CC1_21_TGGGAAGATACTGGATGAGGT_empty_9yzk/data/run_29_00001.cbf", "wavelength": 1.00002, "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [75.836, 163.022, 192.278, 90.0, 98.614, 90.0], "dmin": 5.1}, "tags": ["cbf", "monoclinic"], "tiers": {"smoke": "I2/C2 setting choice at low resolution"}},
{"id": "9z44", "input": "9z44/CC1_10_CCCGGCCGG_Cclamp_9z44/data/run_41_00001.cbf", "wavelength": 1.00005, "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [73.491, 127.653, 141.183, 90.0, 91.984, 90.0], "dmin": 7.2}, "tags": ["cbf", "monoclinic"]},
{"id": "9z72", "input": "9z72/A7_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [59.173, 59.173, 426.203, 90.0, 90.0, 120.0], "dmin": 2.38}, "tags": ["cbf", "trigonal", "long-axis"], "tiers": {"smoke": "long axis c=426 A, at the FFT ceiling"}},
{"id": "9zlo", "input": "9zlo/ASP0887_09_0114_master.h5", "wavelength": 0.95365, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [38.39, 89.98, 106.97, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["h5", "orthorhombic"]},
{"id": "9zm0", "input": "9zm0/Atg23ANNS_9zm0_9ZM0/data/SeAtg23_B_10_2115_master.h5", "wavelength": 0.97988, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [50.409, 30.101, 91.244, 90.0, 97.146, 90.0], "dmin": 2.1}, "tags": ["h5", "monoclinic"]},
{"id": "9zmu", "input": "9zmu/BrmeA_18154_a_B2-Apo_9zmu/data/PSL-0613_7518_master.h5", "wavelength": 0.97856, "ref": {"sg": "P 65 2 2", "sgno": 179, "cell": [47.81, 47.81, 492.58, 90.0, 90.0, 120.0], "dmin": 1.98}, "tags": ["h5", "hexagonal"]},
{"id": "cuhf2", "input": "cuhf2/03_CuHF2pyz2PF6b_P_O/CuHF2pyz2PF6b_P_O_01.nxs", "wavelength": 0.4859, "pinned": true, "tags": ["nxs", "small-molecule"]},
{"id": "cytidine", "input": "cytidine/20151020-Cytidine-2th-30/fixed-omega--180-phi-scan01_00001.cbf", "wavelength": 0.68966, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [13.98, 14.788, 5.119, 90.0, 90.0, 90.0], "dmin": null}, "cod": "2001311", "tags": ["cbf", "orthorhombic", "small-molecule"]},
{"id": "dnba", "input": "dnba/35dnba_30K_2_04_00001.cbf", "wavelength": 0.6889, "ref": {"sg": "C 1 2/c 1", "sgno": 15, "cell": [20.2635, 8.7575, 9.6697, 90.0, 109.941, 90.0], "dmin": 0.48}, "cod": "4510615", "tags": ["cbf", "monoclinic", "small-molecule"]},
{"id": "lalanine", "input": "lalanine/pgw240050_01_00001.cbf", "wavelength": 0.6889, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [5.791, 5.944, 12.269, 90.0, 90.0, 90.0], "dmin": null}, "cod": "2311261", "tags": ["cbf", "orthorhombic", "small-molecule"], "tiers": {"smoke": "small molecule, miniCBF"}},
{"id": "metformin", "input": "metformin/013_Mmetformin_01_master.h5", "wavelength": 0.4859, "ref": {"sg": "P 1 21/c 1", "sgno": 14, "cell": [7.9104, 13.8794, 7.931, 90.0, 114.606, 90.0], "dmin": 0.45}, "cod": "2108029", "tags": ["h5", "monoclinic", "small-molecule"], "tiers": {"smoke": "small molecule, Diamond I19 NXmx master"}},
{"id": "nidppe", "input": "nidppe/001_NiDppeCl2_01_master.h5", "wavelength": 0.4859, "ref": {"sg": "P 1 21/c 1", "sgno": 14, "cell": [11.2779, 13.3386, 15.8739, 90.0, 98.7953, 90.0], "dmin": 0.77}, "cod": "2012031", "tags": ["h5", "monoclinic", "small-molecule"]},
{"id": "5mln", "input": "5mln/5mln/data/CmADHx6_w1_2_0001.cbf", "wavelength": 0.8729, "ref": {"sg": "P 21 2 21", "sgno": 18, "cell": [74.178, 80.425, 80.52, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf"]},
{"id": "5t39", "input": "5t39/10mMfuc-12h.001", "wavelength": 0.97872, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [50.222, 41.27, 58.504, 90.0, 98.58, 90.0], "dmin": 1.1004}, "tags": ["marccd"]},
{"id": "6cdl", "input": "6cdl/nnnn_6cdl/data/wt_32-14A_p6n6.0001", "wavelength": 1.0, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [58.26, 85.91, 46.051, 90.0, 90.0, 90.0], "dmin": 1.25}, "tags": ["marccd"]},
{"id": "6f3p", "input": "6f3p/6f3p/data/saha16_1_1.0002", "wavelength": 1.0, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [142.9, 85.74, 112.01, 90.0, 122.2, 90.0], "dmin": 1.35}, "tags": ["marccd"]},
{"id": "6g1f", "input": "6g1f/home/data/dls180217/mx13587-30/mat/DpgA-7-HA00AX9676/DpgA-7-HA00AX9676_1_0001.cbf", "wavelength": 0.97955, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [329.28, 83.9, 133.42, 90.0, 111.58, 90.0], "dmin": 2.248}, "tags": ["cbf"]},
{"id": "6jgh", "input": "6jgh/6jgh/data/a_00001.img", "wavelength": 0.75, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.641, 62.506, 68.179, 90.0, 90.0, 90.0], "dmin": 0.94}, "tags": ["marccd"]},
{"id": "6nen", "input": "6nen/Pm1tr_2_1_001.img", "wavelength": 0.9537, "ref": {"sg": "P 3 1 2", "sgno": 149, "cell": [105.501, 105.501, 35.132, 90.0, 90.0, 120.0], "dmin": 2.151}, "tags": ["smv"]},
{"id": "6qaj", "input": "6qaj/95_8_8_8_1_0001.cbf", "wavelength": 1.28189, "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [59.774, 169.332, 374.508, 90.0, 90.0, 90.0], "dmin": 2.901}, "tags": ["cbf"]},
{"id": "6s1u", "input": "6s1u/new_4_0001.img", "wavelength": 0.91841, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [51.603, 29.413, 85.533, 90.0, 103.75, 90.0], "dmin": 1.9}, "tags": ["marccd"]},
{"id": "6w75", "input": "6w75/IDP51000_6W75/data/idp51000-410-a_1_1_1.001", "wavelength": 0.97872, "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [166.245, 166.245, 98.279, 90.0, 90.0, 120.0], "dmin": 1.951}, "tags": ["marccd"]},
{"id": "6zqr", "input": "6zqr/ib23a11_M2S3_1_001.img", "wavelength": 0.9795, "ref": {"sg": "P 4", "sgno": 75, "cell": [113.6, 113.6, 44.08, 90.0, 90.0, 90.0], "dmin": 1.93}, "tags": ["smv"]},
{"id": "6zqy", "input": "6zqy/ib22b32_MS_1_001.img", "wavelength": 0.9702, "ref": {"sg": "P 4", "sgno": 75, "cell": [119.29, 119.29, 44.21, 90.0, 90.0, 90.0], "dmin": 1.85}, "tags": ["smv"]},
{"id": "6zr0", "input": "6zr0/ib23a23_dc_1_0001.cbf", "wavelength": 0.9795, "ref": {"sg": "P 4", "sgno": 75, "cell": [119.219, 119.219, 44.18, 90.0, 90.0, 90.0], "dmin": 1.94}, "tags": ["cbf"]},
{"id": "7ou1", "input": "7ou1/omega_1_0001.img", "wavelength": 0.895, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [77.923, 91.308, 114.164, 90.0, 97.111, 90.0], "dmin": 1.65}, "tags": ["marccd"]},
{"id": "7raa", "input": "7raa/A6_1_00001.cbf", "wavelength": 0.97946, "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [66.372, 66.372, 298.302, 90.0, 90.0, 90.0], "dmin": 2.69}, "tags": ["cbf"]},
{"id": "9fcf", "input": "9fcf/IBCH-05-p03x03_3_00001.cbf.gz", "wavelength": 0.97626, "ref": {"sg": "P 4", "sgno": 75, "cell": [91.301, 91.301, 35.836, 90.0, 90.0, 90.0], "dmin": 2.36}, "tags": ["cbf"]},
{"id": "9h0q", "input": "9h0q/Bc2lCnter-pma127_2_master.h5", "wavelength": 0.97857, "ref": {"sg": "H 3 2", "sgno": 155, "cell": [169.506, 169.506, 344.036, 90.0, 90.0, 120.0], "dmin": 2.55}, "tags": ["h5"]},
{"id": "5ky6", "input": "5ky6/C11_1_001.img", "wavelength": 0.91841, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [84.511, 57.253, 164.016, 90.0, 102.57, 90.0], "dmin": 1.941}, "symmetry_evidence": "symmetry/5ky6", "tags": ["marccd"]},
{"id": "6z9g", "input": "6z9g/HASE01-ga1o2_w1_2_1_master.h5", "wavelength": 0.9677, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [120.306, 93.815, 126.951, 90.0, 105.201, 90.0], "dmin": 1.76}, "tags": ["h5", "tncs"]},
{"id": "8c3e", "input": "8c3e/LCB2_raw_data/lcb2_8_newt_003_0001.cbf", "wavelength": 1.54184, "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [57.817, 57.817, 41.54, 90.0, 90.0, 120.0], "dmin": 2.1}, "symmetry_evidence": "symmetry/8c3e", "tags": ["cbf", "trigonal", "home-source", "twin"]},
{"id": "4bwl", "input": "4bwl/y137a_sial5m_MS_1_001.img", "wavelength": 0.9795, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [55.97, 143.22, 83.41, 90, 109.51, 90], "dmin": 2.0}, "symmetry_evidence": "symmetry/4bwl", "tags": ["smv", "monoclinic", "twin", "pseudo-merohedral"]},
{"id": "2wnq", "input": "2wnq/I2-3_data_MS_1_001.img", "wavelength": 0.9702, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [54.63, 142.77, 84.487, 90, 108.99, 90], "dmin": 1.8}, "symmetry_evidence": "symmetry/2wnq", "tags": ["smv", "monoclinic", "twin", "pseudo-merohedral"]},
{"id": "2xfw", "input": "2xfw/E192N_alone_MS_1_001.img", "wavelength": 0.9796, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [78.11, 116.53, 83.74, 90, 117.95, 90], "dmin": 1.65}, "tags": ["smv", "monoclinic", "twin", "pseudo-merohedral"]},
{"id": "2wnn", "input": "2wnn/wt_pyr_pos3_MS_3_001.img", "wavelength": 0.92, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [54.693, 142.456, 83.626, 90, 109.16, 90], "dmin": 1.65}, "tags": ["smv", "monoclinic", "twin", "pseudo-merohedral"]},
{"id": "2wnz", "input": "2wnz/E192_pyr_MS_1_001.img", "wavelength": 0.9796, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [56.921, 143.041, 83.918, 90, 109.79, 90], "dmin": 1.85}, "tags": ["smv", "monoclinic", "pseudo-symmetry"]},
{"id": "6oww", "input": "6oww/data/t1_1_00001.cbf", "wavelength": 1.3857, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [85.832, 86.015, 214.34, 90.0, 89.91, 90.0], "dmin": 3.84}, "ref_alternatives": [{"sg": "P 41 21 2", "sgno": 92, "why": "OPEN QUESTION, both accepted. The deposited 8-chain P 1 21 1 model obeys a 4-fold (0.13-0.16 A) and a 2-fold (0.10 A), and its |Fc|^2 correlate across the added 422 operators at 1.00/0.98/0.97. POINTLESS reads 4/mmm on our observations (0.98) and on the depositor's amplitudes (0.999). ZANUDA 1.097 with the deposited model prefers P 43 21 2 on our data (three free sets, R-free 0.414-0.430 against 0.435-0.447) and on the depositor's (0.333 against 0.359). A higher symmetry is consistent with our data and the model; the model's hand is P 43 21 2. An exact pseudo-symmetry may explain this (evidence: tools/battery/symmetry/6oww)"}], "symmetry_evidence": "symmetry/6oww", "tags": ["cbf", "monoclinic", "pseudo-symmetry"]},
{"id": "6p8j", "input": "6p8j/13_12_2_000001.cbf", "wavelength": 0.9792, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [46.484, 152.166, 88.255, 90.0, 90.12, 90.0], "dmin": 1.47}, "symmetry_evidence": "symmetry/6p8j", "tags": ["cbf", "monoclinic", "pseudo-symmetry"]},
{"id": "9qvv", "input": "9qvv/CHRD_HEP_M/CHRD_404_7_1.nxs", "wavelength": 0.9762, "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [120.142, 123.8, 123.787, 90.0, 90.0, 90.0], "dmin": 2.72}, "tags": ["nxs", "orthorhombic", "pseudo-symmetry"]},
{"id": "5ojv", "input": "5ojv/bg3047_w1_1_0001.cbf", "wavelength": 0.97625, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [87.792, 158.242, 87.589, 90.0, 90.0, 90.0], "dmin": 2.062}, "tags": ["cbf", "orthorhombic", "pseudo-symmetry"]},
{"id": "9qw2", "input": "9qw2/HepPhosHep_Data_for_9QW2/hw28c25_dc1_1_0001.cbf", "wavelength": 0.9762, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [55.439, 108.179, 55.65, 90.0, 90.9, 90.0], "dmin": 1.92}, "tags": ["cbf", "monoclinic", "pseudo-symmetry"]},
{"id": "7q6j", "input": "7q6j/3_001_00001.cbf", "wavelength": 1.0332, "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [72.71, 115.88, 116.18, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["cbf", "orthorhombic", "pseudo-symmetry"]},
{"id": "6rym", "input": "6rym/6RYM/jmp47a2_1_001.img", "wavelength": 1.488, "ref": {"sg": "P 43", "sgno": 78, "cell": [50.225, 50.225, 51.925, 90.0, 90.0, 90.0], "dmin": 1.46}, "tags": ["smv", "tetragonal"], "pinned": true},
{"id": "7bgu", "input": "7bgu/mpmv_01001.mccd", "wavelength": 0.815, "ref": {"sg": "P 1", "sgno": 1, "cell": [29.068, 67.893, 69.739, 77.07, 83.34, 83.18], "dmin": 2.433}, "tags": ["marCCD", "triclinic"], "pinned": true},
{"id": "8v4j", "input": "8v4j/data/CB1_3_3_001.img", "wavelength": 1.075, "ref": {"sg": "P 42 21 2", "sgno": 94, "cell": [60.972, 60.972, 92.429, 90.0, 90.0, 90.0], "dmin": 1.31}, "tags": ["smv", "tetragonal"]},
{"id": "8v2t", "input": "8v2t/data/MJ504_2_3_00001.cbf", "wavelength": 1.1, "ref": {"sg": "P 42 21 2", "sgno": 94, "cell": [60.906, 60.906, 92.728, 90.0, 90.0, 90.0], "dmin": 1.402}, "tags": ["cbf", "tetragonal"]},
{"id": "5jk4", "input": "5jk4/dioxyhipeg/dioxyhipeg_1_001.img", "wavelength": 0.933, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [37.729, 77.856, 56.287, 90.0, 102.08, 90.0], "dmin": 1.1}, "tags": ["smv", "monoclinic"], "pinned": true},
{"id": "6cs9", "input": "6cs9/568/HBD2D7_2_1_001.img", "wavelength": 0.9537, "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [32.871, 25.538, 40.17, 90.0, 98.64, 90.0], "dmin": 1.85}, "tags": ["smv", "monoclinic"]},
{"id": "9lxl", "input": "9lxl/6/1_T10Y-FFp-PNPI_6_master.h5", "wavelength": 0.97919, "ref": {"sg": "P 41 21 2", "sgno": 92, "cell": [76.757, 76.757, 225.338, 90.0, 90.0, 90.0], "dmin": 2.191}, "tags": ["h5", "tetragonal"]},
{"id": "9s02", "input": "9s02/PYCR1-D11_1_master.h5", "wavelength": 0.97625, "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [163.674, 88.042, 116.731, 90.0, 90.0, 90.0], "dmin": 1.65}, "tags": ["h5", "orthorhombic"], "tiers": {"ci": "HDF5, orthorhombic P21212"}},
{"id": "6gvk", "input": "6gvk/212_3_0001.cbf", "wavelength": 0.97915, "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [105.58, 59.52, 42.4, 90.0, 113.5, 90.0], "dmin": 1.55}, "tags": ["cbf", "monoclinic"], "pinned": true, "tiers": {"ci": "C-centred monoclinic C2"}},
{"id": "4mtk", "input": "4mtk/sbgrid235/lambda_1.0A_1_00001.cbf", "wavelength": 1.0, "ref": {"sg": "P 61", "sgno": 169, "cell": [168.275, 168.275, 652.849, 90.0, 90.0, 120.0], "dmin": 3.322}, "tags": ["cbf", "hexagonal", "large-cell", "long-axis"]},
{"id": "4nwv", "input": "4nwv/sbgrid9/formal.001", "wavelength": 1.12706, "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [402.197, 369.862, 410.511, 90.0, 90.0, 90.0], "dmin": 3.25}, "tags": ["marCCD", "orthorhombic", "large-cell", "virus"], "tiers": {"ci": "virus capsid, 400 A body-centred cell, marCCD"}},
{"id": "7d98", "input": "7d98/xrda13/data/cbnrf006_01_00011.cbf", "wavelength": 1.9, "ref": {"sg": "P 61 2 2", "sgno": 178, "cell": [105.819, 105.819, 602.516, 90.0, 90.0, 120.0], "dmin": 3.6}, "tags": ["cbf", "hexagonal", "large-cell", "long-axis", "long-wavelength"], "pinned": true},
{"id": "9v16", "input": "9v16/xrd-00338/9V16/data01_master.h5", "wavelength": 0.9, "ref": {"sg": "P 41 21 2", "sgno": 92, "cell": [185.604, 185.604, 451.242, 90.0, 90.0, 90.0], "dmin": 3.45}, "tags": ["h5", "tetragonal", "large-cell", "long-axis"]},
{"id": "4p8r", "input": "4p8r/data/4p8r/series/gzn0-7.001", "wavelength": 0.97872, "ref": {"sg": "P 65 2 2", "sgno": 179, "cell": [86.7, 86.7, 701.37, 90.0, 90.0, 120.0], "dmin": 2.2}, "tags": ["marCCD", "hexagonal", "large-cell", "long-axis"]}
]}
Reference in new issue View Git Blame Copy Permalink