Adds 5ky6 5mln 5t39 6cdl 6f3p 6g1f 6jgh 6nen 6qaj 6s1u 6w75 6zqr 6zqy 6zr0 7ou1 7raa 9fcf 9h0q in the existing row form: deposited values from RCSB, the detector from the image files, DOIs resolved (6NEN's is a Crossref DOI whose landing page refuses scripted access). New notes: the five screw-free negative controls, the 5KY6 RAR set, the damaged 6ZR0 zip, the hand-downloaded 6NEN archive, two detector conflicts (5MLN, 9H0Q), third-round counts. The table rows, which were grouped by download round, are now sorted by PDB id; the round moves into a Round column, and the prose that referred to "the first 95 rows" or "the last 51 rows" refers to the round instead. Counts updated to 171 datasets / 164 PDB entries (all 18 new entries have released structure factors). Co-Authored-By: Claude Opus 5 (1M context) <noreply@anthropic.com> Claude-Session: https://claude.ai/code/session_013nW6FNRP1bBJJ8pfHiByAT
76 KiB
External test data
Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only
ever sees its own detectors is not tested. The datasets below were collected by other people,
on detectors and in file formats we do not produce ourselves, and are used here to check that
rugnux reads foreign files correctly and reduces them to sensible results. Most were collected
at other facilities; a few come from SLS beamlines, where the data are still written by someone
else's detector and someone else's acquisition system. Their authors published all of these for
exactly this kind of reuse, and this page is where we credit them.
None of these data were collected by us. If you use any of them, cite the dataset DOI in the table below; the repositories themselves are cited in ACKNOWLEDGEMENT.
Where the values come from
- Source is the repository we downloaded from and that repository's own citable DOI for the archive we took. Every DOI on this page was resolved against DataCite - or, for 6NEN, whose DOI is registered with Crossref, against Crossref - before it was written down, and the identity of each dataset was taken from the repository's record for the archive - not from our directory names.
- Beamline, resolution, space group and cell are the values deposited with the PDB entry, read from the RCSB data API. They describe the published experiment. They are not our reprocessing results; no quantity measured by Jungfraujoch appears on this page.
- Detector is read out of the image files themselves - the NXmx
/entry/instrument/detector/description, the miniCBF# Detector:header, the marCCD instrument header or the SMV key block - because the detector named in a PDB entry is often only approximate. Where the two differ, the difference is listed below the table. - Anything that could not be established from one of those sources is left blank.
- Round is the scouting round in which the dataset was added: 1 for the first 102 datasets, 2 for the 51 of the second round and 3 for the 18 of the third. Several sections below describe one round only.
Datasets
| PDB | Source | Facility / beamline | dmin (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title | Round |
|---|---|---|---|---|---|---|---|---|
| 11IF | IRRMC 10.18430/M311IF | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 | 1 |
| 36GK | IRRMC 10.18430/M336GK | CLSI 08ID-1 | 2.28 | I 2 2 2 | 120.6 189.5 199.7 90.0 90.0 90.0 | Dectris Eiger 9M | D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain | 1 |
| 3INP | IRRMC 10.18430/m33inp | APS 21-ID-F | 2.05 | F 41 3 2 | 224.1 224.1 224.1 90.0 90.0 90.0 | marCCD, 225 mm plate | 2.05 Angstrom Resolution Crystal Structure of D-ribulose-phosphate 3-epimerase from Francisella tularensis. | 2 |
| 3KY7 | IRRMC 10.18430/m33ky7 | APS 21-ID-G | 2.35 | P 43 3 2 | 125.2 125.2 125.2 90.0 90.0 90.0 | marCCD, 300 mm plate | 2.35 Angstrom resolution crystal structure of a putative tRNA (guanine-7-)-methyltransferase (trmD) from Staphylococcus aureus subsp. aureus MRSA252 | 2 |
| 5EBI | MXRDR 10.18150/9887707 | BESSY 14.2 | 1.09 | P 1 21 1 | 35.7 44.1 35.7 90.0 120.0 90.0 | marCCD, 225 mm plate | Crystal structure of a DNA-RNA chimera in complex with Ba2+ ions: a case of unusual multi-domain twinning | 2 |
| 5EPE | IRRMC 10.18430/m3159c | APS 21-ID-G | 1.90 | F 2 3 | 157.5 157.5 157.5 90.0 90.0 90.0 | Rayonix MX-300 | Crystal structure of SAM-dependent methyltransferase from Thiobacillus denitrificans in complex with S-Adenosyl-L-homocysteine | 2 |
| 5F6M | SBGrid 10.15785/sbgrid/201 | SSRL BL11-1 | 1.10 | P 21 21 21 | 54.8 58.5 67.4 90.0 90.0 90.0 | PILATUS 6M | Isotropic Trypsin Model for Comparison of Diffuse Scattering | 1 |
| 5J23 | IRRMC 10.18430/M35J23 | APS 21-ID-G | 2.30 | H 3 | 175.8 175.8 136.8 90.0 90.0 120.0 | Rayonix MX-300 | Crystal structure of NADPH-dependent glyoxylate/hydroxypyruvate reductase SMc04462 (SmGhrB) from Sinorhizobium meliloti in complex with 2'-phospho-ADP-ribose | 2 |
| 5JVN | IRRMC 10.18430/m35jvn | ESRF ID29 | 2.90 | P 6 2 2 | 249.4 249.4 84.1 90.0 90.0 120.0 | PILATUS3 6M | C3-type pyruvate phosphate dikinase: intermediate state of the swiveling-domain mechanism | 1 |
| 5KY6 | MXRDR 10.18150/repod.1494374 | BESSY 14.2 | 1.94 | P 1 21 1 | 84.5 57.3 164.0 90.0 102.6 90.0 | marCCD, 225 mm plate | Human muscle fructose-1,6-bisphosphate aldolase | 3 |
| 5LZL | Zenodo 10.5281/zenodo.54757 | Diamond I02 | 3.47 | P 31 2 1 | 205.6 205.6 199.2 90.0 90.0 120.0 | PILATUS 6M-F | Pyrobaculum calidifontis 5-aminolaevulinic acid dehydratase | 2 |
| 5M17 | Zenodo 10.5281/zenodo.4300323 | Diamond I02 | 1.03 | I 4 | 108.6 108.6 67.7 90.0 90.0 90.0 | PILATUS 6M-F | Structure of the GH99 endo-alpha-mannanase from Bacteroides xylanisolvens | 1 |
| 5MLN | IRRMC 10.18430/m35mln | ESRF ID23-2 | 1.60 | P 21 2 21 | 74.2 80.4 80.5 90.0 90.0 90.0 | PILATUS3 2M | The crystal structure of alcohol dehydrogenase 10 from Candida magnoliae | 3 |
| 5NW5 | SBGrid 10.15785/sbgrid/446 | SLS X06DA | 6.50 | P 21 21 21 | 92.1 169.8 390.2 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of the Rif1 N-terminal domain (RIF1-NTD) from Saccharomyces cerevisiae in complex with DNA | 2 |
| 5REO | Zenodo 10.5281/zenodo.3730956 | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 | 1 |
| 5SRC | IRRMC 10.18430/M35SRC | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers | 1 |
| 5T39 | SBGrid 10.15785/sbgrid/356 | APS 21-ID-F | 1.10 | P 1 21 1 | 50.2 41.3 58.5 90.0 98.6 90.0 | Rayonix MX-300 | Crystal Structure of the N-terminal domain of EvdMO1 in the presence of SAH and D-fucose | 3 |
| 6CDL | IRRMC 10.18430/m36cdl | APS 22-ID | 1.25 | P 21 21 2 | 58.3 85.9 46.1 90.0 90.0 90.0 | marCCD, 300 mm plate | HIV-1 wild type protease with GRL-03214A, 6-5-5-ring fused umbrella-like tetrahydropyranofuran as the P2-ligand, a cyclopropylaminobenzothiazole as the P2'-ligand and 3,5-difluorophenylmethyl as the P1-ligand | 3 |
| 6F3P | IRRMC 10.18430/M36F3P | APS 22-ID | 1.35 | C 1 2 1 | 142.9 85.7 112.0 90.0 122.2 90.0 | marCCD, 300 mm plate | Crystal structure of S-adenosyl-L-homocysteine hydrolase from Pseudomonas aeruginosa in complex with 3'-deoxyadenosine and K+ cation | 3 |
| 6FID | SBGrid 10.15785/sbgrid/541 | ESRF ID30B | 2.20 | P 21 21 21 | 59.9 64.1 69.7 90.0 90.0 90.0 | PILATUS3 6M | Bovine trypsin solved by S-SAD on ID30B | 1 |
| 6FVZ | IRRMC 10.18430/m36fvz | ESRF ID23-2 | 1.80 | C 2 2 2 | 131.2 222.8 86.5 90.0 90.0 90.0 | PILATUS3 X 2M | Crystal structure of human monoamine oxidase B (MAO B) in complex with an inhibitor | 1 |
| 6FWC | IRRMC 10.18430/m36fwc | ESRF MASSIF-3 | 1.70 | C 2 2 2 | 131.7 222.1 86.3 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of human monoamine oxidase B (MAO B) in complex with fluorophenyl-chromone-carboxamide | 2 |
| 6G1F | Zenodo 10.5281/zenodo.1059413 | Diamond I03 | 2.25 | C 1 2 1 | 329.3 83.9 133.4 90.0 111.6 90.0 | PILATUS3 6M | Crystal structure of D-phenylglycine aninotransferase (D-PhgAT) from Pseudomonas stutzeri with PLP internal aldimine | 3 |
| 6H2P | IRRMC 10.18430/m36h2p | BESSY 14.1 | 1.48 | C 2 2 21 | 103.5 107.1 216.5 90.0 90.0 90.0 | PILATUS 6M | Crystal Structure of Arg184Gln mutant of Human Prolidase with Mn ions and Cacodylate ligand | 2 |
| 6H5T | IRRMC 10.18430/m36h5t | BESSY 14.3 | 1.69 | I 4 2 2 | 86.8 86.8 141.8 90.0 90.0 90.0 | marCCD, 225 mm plate | Intersectin SH3A short isoform | 2 |
| 6HV2 | IRRMC 10.18430/m36hv2 | SLS X06SA | 1.71 | P 61 2 2 | 68.9 68.9 133.6 90.0 90.0 120.0 | Dectris Eiger 16M | MMP-13 in complex with the peptide IMISF | 1 |
| 6HWJ | SBGrid 10.15785/sbgrid/614 | ALBA XALOC | 1.98 | P 1 21 1 | 59.8 96.1 80.3 90.0 106.7 90.0 | PILATUS 6M | Glucosamine kinase (crystal form A) | 1 |
| 6I3J | IRRMC 10.18430/m36i3j | BESSY 14.1 | 2.59 | F 2 2 2 | 134.4 203.8 226.7 90.0 90.0 90.0 | marCCD, 225 mm plate | Bilirubin oxidase from Myrothecium verrucaria in complex with ferricyanide | 2 |
| 6IU5 | Zenodo 10.5281/zenodo.2532134 | SPring-8 BL41XU | 2.25 | P 31 | 84.9 84.9 98.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with zinc ions | 2 |
| 6IU6 | Zenodo 10.5281/zenodo.2532134 | SPring-8 BL41XU | 2.90 | P 31 | 84.7 84.7 97.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with nickel ions | 2 |
| 6IU8 | Zenodo 10.5281/zenodo.2532134 | SPring-8 BL41XU | 2.70 | P 31 | 85.5 85.5 98.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with cobalt | 1 |
| 6IU9 | Zenodo 10.5281/zenodo.2532134 | SPring-8 BL41XU | 3.00 | P 31 | 85.3 85.3 97.6 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with iron ions | 2 |
| 6JGH | IRRMC 10.18430/m36jgh | SPring-8 BL44XU | 0.94 | P 21 21 21 | 50.6 62.5 68.2 90.0 90.0 90.0 | marCCD, 300 mm plate | Crystal structure of the F99S/M153T/V163A/T203I variant of GFP at 0.94 A | 3 |
| 6JGI | IRRMC 10.18430/m36jgi | SPring-8 BL44XU | 0.85 | P 21 21 21 | 50.9 62.4 69.2 90.0 90.0 90.0 | marCCD, 300 mm plate | Crystal structure of the S65T/F99S/M153T/V163A variant of GFP at 0.85 A | 2 |
| 6JGJ | IRRMC 10.18430/m36jgj | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A | 1 |
| 6MOJ | SBGrid 10.15785/sbgrid/620 | ALS 5.0.1 | 2.43 | I 41 2 2 | 130.4 130.4 293.5 90.0 90.0 90.0 | PILATUS3 6M | Dimeric DARPin A_angle_R5 complex with EpoR | 2 |
| 6NEN | UQ eSpace 10.14264/uql.2018.843 | Australian Synchrotron MX2 | 2.15 | P 3 1 2 | 105.5 105.5 35.1 90.0 90.0 120.0 | SMV, S/N 928 | Catalytic domain of Proteus mirabilis ScsC | 3 |
| 6O2H | SBGrid 10.15785/sbgrid/747 | CHESS F1 | 1.21 | P 1 | 27.4 32.1 34.5 88.7 108.5 111.9 | PILATUS3 6M | Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset | 1 |
| 6OEL | SBGrid 10.15785/sbgrid/652 | ALS 8.2.1 | 3.10 | F 41 3 2 | 328.1 328.1 328.1 90.0 90.0 90.0 | SMV, S/N 905 | Engineered Fab bound to IL-4 receptor | 2 |
| 6P8P | SBGrid 10.15785/sbgrid/673 | APS 24-ID-C | 1.64 | P 4 | 97.5 97.5 60.1 90.0 90.0 90.0 | PILATUS 6M-F | Structure of P. aeruginosa ATCC27853 HORMA1 | 1 |
| 6PB3 | SBGrid 10.15785/sbgrid/681 | APS 24-ID-E | 2.05 | P 6 | 100.4 100.4 48.9 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of Rhizobiales Trip13 | 1 |
| 6PXB | SBGrid 10.15785/sbgrid/698 | APS 24-ID-E | 1.75 | P 32 | 64.0 64.0 119.4 90.0 90.0 120.0 | PILATUS 6M-F | N-Terminal SH2 domain of the p120RasGAP | 2 |
| 6PXC | SBGrid 10.15785/sbgrid/699 | APS 24-ID-E | 1.60 | I 2 2 2 | 44.2 64.8 87.2 90.0 90.0 90.0 | PILATUS 6M-F | N-Terminal SH2 domain of the p120RasGAP bound to a p190RhoGAP phosphotyrosine peptide | 2 |
| 6QAJ | SBGrid 10.15785/sbgrid/637 | Diamond I03 | 2.90 | C 2 2 21 | 59.8 169.3 374.5 90.0 90.0 90.0 | PILATUS3 6M | Structure of the tripartite motif of KAP1/TRIM28 | 3 |
| 6R72 | Zenodo 10.5281/zenodo.14894181 | SOLEIL PROXIMA 2 | 3.95 | P 1 21 1 | 117.8 110.8 155.6 90.0 93.2 90.0 | Dectris Eiger 9M | Crystal structure of BmrA-E504A in an outward-facing conformation | 1 |
| 6RLR | Zenodo 10.5281/zenodo.5886687 | Diamond I04 | 2.00 | P 1 | 40.0 40.0 63.6 80.4 76.3 68.2 | Eiger 16M | Crystal structure of CD9 large extracellular loop | 1 |
| 6S1U | MXRDR 10.18150/repod.0005795 | BESSY 14.2 | 1.90 | P 1 21 1 | 51.6 29.4 85.5 90.0 103.8 90.0 | marCCD, 225 mm plate | Crystal structure of dimeric M-PMV protease C7A/D26N/C106A mutant in complex with inhibitor | 3 |
| 6TOC | Zenodo 10.5281/zenodo.3571040 | SLS X06DA | 1.85 | P 42 | 31.5 31.5 81.6 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of the oligomerisation domain of the transcription factor PHOSPHATE STARVATION RESPONSE 1 from Arabidopsis (crystal form 3). | 2 |
| 6TTN | IRRMC 10.18430/m36ttn | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine | 1 |
| 6U7G | IRRMC 10.18430/m36u7g | APS 23-ID-B | 2.35 | P 1 21 1 | 99.6 98.7 147.5 90.0 104.6 90.0 | Dectris Eiger 16M | HCoV-229E RBD Class V in complex with human APN | 2 |
| 6UKF | IRRMC 10.18430/m36ukf | APS 22-ID | 1.00 | P 1 21 1 | 61.0 37.3 69.0 90.0 109.8 90.0 | Dectris Eiger 16M | HhaI endonuclease in Complex with DNA at 1 Angstrom Resolution | 1 |
| 6VWW | IRRMC 10.18430/m36vww | APS 19-ID | 2.20 | P 63 | 150.5 150.5 111.3 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2. | 2 |
| 6W4H | IRRMC 10.18430/m36w4h | APS 21-ID-F | 1.80 | P 31 2 1 | 167.7 167.7 51.9 90.0 90.0 120.0 | Rayonix MX-300 | 1.80 Angstrom Resolution Crystal Structure of NSP16 - NSP10 Complex from SARS-CoV-2 | 2 |
| 6W75 | IRRMC 10.18430/m36w75 | APS 21-ID-F | 1.95 | P 32 2 1 | 166.2 166.2 98.3 90.0 90.0 120.0 | Rayonix MX-300 | 1.95 Angstrom Resolution Crystal Structure of NSP10 - NSP16 Complex from SARS-CoV-2 | 3 |
| 6WZO | SBGrid 10.15785/sbgrid/785 | APS 24-ID-E | 1.42 | P 1 | 43.7 50.1 69.3 106.5 90.1 97.1 | Dectris Eiger 16M | Structure of SARS-CoV-2 Nucleocapsid dimerization domain, P1 form | 1 |
| 6YQF | IRRMC 10.18430/m36yqf | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly | 1 |
| 6Z8O | Zenodo 10.5281/zenodo.3873216 | ESRF ID30B | 2.20 | P 1 21 1 | 63.7 97.0 121.3 90.0 104.7 90.0 | Dectris Eiger 4M | Structure of [NiFeSe] hydrogenase G491A variant from Desulfovibrio vulgaris Hildenborough pressurized with Krypton gas - structure G491A-Kr | 2 |
| 6ZE4 | SBGrid 10.15785/sbgrid/806 | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide | 1 |
| 6ZQR | Keele University 10.21252/r2nx-0425 | Diamond I02 | 1.93 | P 4 | 113.6 113.6 44.1 90.0 90.0 90.0 | SMV, S/N 922 | Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with GlcNAc ligand bound | 3 |
| 6ZQY | Keele University 10.21252/hx7e-rd04 | Diamond I04 | 1.85 | P 4 | 119.3 119.3 44.2 90.0 90.0 90.0 | SMV, S/N 921 | Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with Neu5Ac ligand bound | 3 |
| 6ZR0 | Keele University 10.21252/zcfy-cw20 | Diamond I04 | 1.94 | P 4 | 119.2 119.2 44.2 90.0 90.0 90.0 | PILATUS 6M Prosport+ | Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with N-acetylalanine ligand bound | 3 |
| 7ARR | MXRDR 10.18150/EM87YL | PETRA III, EMBL c/o DESY P13 (MX1) | 1.10 | P 1 | 30.9 32.1 43.1 114.2 91.9 109.9 | PILATUS 6M-F | The de novo designed hybrid alpha/beta-miniprotein | 1 |
| 7ATG | IRRMC 10.18430/m37atg | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution | 1 |
| 7BGT | MXRDR 10.18150/1HQGWO | BESSY 14.2 | 1.93 | P 1 | 29.3 67.6 69.7 76.8 83.9 83.6 | marCCD, 225 mm plate | Mason-Pfizer Monkey Virus Protease mutant C7A/D26N/C106A in complex with peptidomimetic inhibitor | 2 |
| 7D1M | IRRMC 10.18430/m37brr | SSRF BL17U1 | 1.35 | P 1 21 1 | 55.5 99.0 59.6 90.0 108.5 90.0 | Dectris Eiger 16M | CRYSTAL STRUCTURE OF THE SARS-CoV-2 MAIN PROTEASE COMPLEXED WITH GC376 | 1 |
| 7DKP | IRRMC 10.18430/M37DKP | ESRF MASSIF-3 | 1.45 | P 1 21 1 | 49.8 169.5 49.8 90.0 93.5 90.0 | Dectris Eiger 4M | Crystal structure of E. coli Grx2 in complex with GSH at 1.45 A resolution | 1 |
| 7K1L | IRRMC 10.18430/m37k1l | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate | 1 |
| 7KCN | IRRMC 10.18430/m37kcn | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins | 1 |
| 7L6J | IRRMC 10.18430/m37l6j | APS 21-ID-F | 1.78 | I 41 3 2 | 171.7 171.7 171.7 90.0 90.0 90.0 | Rayonix MX-300 | Crystal Structure of the Putative Hydrolase from Stenotrophomonas maltophilia | 2 |
| 7L84 | SBGrid 10.15785/sbgrid/816 | APS 24-ID-C | 1.60 | P 43 21 2 | 79.3 79.3 37.8 90.0 90.0 90.0 | PILATUS 6M-F | Hen Egg White Lysozyme by Native S-SAD at Room Temperature | 1 |
| 7MZT | IRRMC 10.18430/m37mzt | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A | 1 |
| 7N0I | SBGrid 10.15785/sbgrid/835 | ALS 5.0.2 | 2.20 | P 21 21 21 | 75.8 131.6 140.0 90.0 90.0 90.0 | PILATUS3 6M | Structure of the SARS-CoV-2 N protein C-terminal domain bound to single-domain antibody E2 | 2 |
| 7N2S | SBGrid 10.15785/sbgrid/916 | SSRL BL12-1 | 2.37 | P 1 21 1 | 83.2 52.8 106.3 90.0 98.3 90.0 | PILATUS 6M | AS3.1-PRPF3-HLA*B27 | 2 |
| 7ORR | IRRMC 10.18430/M37ORR | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 | 1 |
| 7OS3 | MXRDR 10.18150/74YTYQ | PETRA III, EMBL c/o DESY P13 (MX1) | 2.18 | P 21 21 21 | 78.2 91.0 105.8 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Rhizobium etli inducible L-asparaginase | 1 |
| 7OU1 | MXRDR 10.18150/VQQIHQ | BESSY 14.3 | 1.65 | P 1 21 1 | 77.9 91.3 114.2 90.0 97.1 90.0 | marCCD, 225 mm plate | Crystal structure of Rhizobium etli inducible L-asparaginase ReAV (monoclinic form MP2) | 3 |
| 7PH1 | IRRMC 10.18430/M37PH1 | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid | 1 |
| 7PQ7 | IRRMC 10.18430/M3.IRRMC.6072 | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 | 1 |
| 7QIJ | SBGrid 10.15785/sbgrid/907 | PETRA III, EMBL c/o DESY P13 (MX1) | 4.10 | P 21 21 21 | 143.5 324.9 369.4 90.0 90.0 90.0 | PILATUS 6M-F | Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY | 1 |
| 7QIS | IRRMC 10.18430/M37QIS | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX | 1 |
| 7RAA | SBGrid 10.15785/sbgrid/881 | SSRL BL12-2 | 2.69 | P 43 21 2 | 66.4 66.4 298.3 90.0 90.0 90.0 | PILATUS 6M | Designed StabIL-2 seq15 | 3 |
| 7RIS | IRRMC 10.18430/M37RIS | APS 21-ID-D | 1.72 | P 32 2 1 | 44.5 44.5 189.9 90.0 90.0 120.0 | Dectris Eiger 9M | Crystal structure of RPA3624, a beta-propeller lactonase from Rhodopseudomonas palustris, with active-site bound phosphate | 1 |
| 7RJI | IRRMC 10.18430/M37RJI | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid | 1 |
| 7T5T | SBGrid 10.15785/sbgrid/864 | SSRL BL9-2 | 1.35 | P 42 21 2 | 95.3 95.3 104.9 90.0 90.0 90.0 | PILATUS 6M | Structure of Thauera sp. K11 CapP | 2 |
| 7TCD | IRRMC 10.18430/m37tcd | SLS X06SA | 1.70 | C 1 2 1 | 138.5 47.9 78.1 90.0 107.6 90.0 | Dectris Eiger 16M | LOV2-DARPIN fusion: D13 | 1 |
| 7YZX | IRRMC 10.18430/M37YZX | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. | 1 |
| 8A1A | IRRMC 10.18430/M38A1A | SLS X06SA | 2.05 | P 65 | 191.9 191.9 122.4 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct | 1 |
| 8AGQ | IRRMC 10.18430/M38AGQ | SLS X06DA | 1.09 | C 1 2 1 | 89.9 55.4 54.8 90.0 113.5 90.0 | PILATUS 2MF | Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione | 1 |
| 8DQB | IRRMC 10.18430/m38dqb | NSLS-II 19-ID | 2.50 | I 2 3 | 164.1 164.1 164.1 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of 3-dehydroquinate dehydratase I from Klebsiella oxytoca (I23 Form) | 2 |
| 8DYZ | SBGrid 10.15785/sbgrid/957 | CHESS F1 | 1.27 | P 43 21 2 | 79.6 79.6 38.3 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset | 1 |
| 8DZ7 | SBGrid 10.15785/sbgrid/958 | CHESS F1 | 1.34 | P 21 21 21 | 30.5 56.4 73.9 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset | 1 |
| 8EGN | IRRMC 10.18430/M38EGN | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 | 1 |
| 8IYA | IRRMC 10.18430/m38iya | SSRF BL02U1 | 2.43 | C 1 2 1 | 102.7 50.1 109.2 90.0 91.8 90.0 | Dectris EIGER2 Si 9M | Complex of SETDB1-derived peptide bound to UBE2E1 | 1 |
| 8K1G | IRRMC 10.18430/M38K1G | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae | 1 |
| 8OIC | IRRMC 10.18430/m38oic | Diamond I04 | 2.80 | P 1 | 73.1 94.7 120.6 105.1 90.0 93.8 | Eiger 16M | Trichomonas vaginalis riboside hydrolase (His-tagged) | 1 |
| 8OWM | MXRDR 10.18150/II5MT4 | PETRA III, EMBL c/o DESY P13 (MX1) | 1.70 | P 1 | 95.5 95.6 95.8 90.4 93.6 117.8 | Dectris Eiger 16M | Crystal structure of glutamate dehydrogenase 2 from Arabidopsis thaliana binding Ca, NAD and 2,2-dihydroxyglutarate | 1 |
| 8PQD | IRRMC 10.18430/m38pqd | ESRF MASSIF-3 | 1.50 | P 21 21 21 | 59.4 59.4 192.9 90.0 90.0 90.0 | Dectris Eiger 4M | c-KIT kinase domain in complex with avapritinib derivative 10 | 1 |
| 8QAW | MXRDR 10.18150/INUP4Q | PETRA III, EMBL c/o DESY P13 (MX1) | 1.55 | H 3 | 137.7 137.7 265.9 90.0 90.0 120.0 | Dectris Eiger 16M | Medicago truncatula HISN5 (IGPD) in complex with MN, IMD, EDO, FMT, GOL and TRS | 2 |
| 8QJ5 | IRRMC 10.18430/m38qj5 | ELETTRA 11.2C | 1.63 | P 1 21 1 | 57.6 100.6 77.9 90.0 96.1 90.0 | PILATUS 6M | Crystal structure of the Levansucrase beta from Pseudomonas syringae pv. actinidiae | 2 |
| 8QQ7 | Zenodo 10.5281/zenodo.14901515 | ESRF MASSIF-1 | 3.62 | P 64 2 2 | 146.0 146.0 153.6 90.0 90.0 120.0 | PILATUS3 2M | Structure of SpNOX: a Bacterial NADPH oxidase | 1 |
| 8R5R | IRRMC 10.18430/m38r5r | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor | 1 |
| 8RUD | MXRDR 10.18150/RBG2F9 | PETRA III, EMBL c/o DESY P13 (MX1) | 2.10 | P 1 21 1 | 78.1 91.4 114.5 90.0 96.9 90.0 | Dectris Eiger 16M | Crystal structure of Rhizobium etli L-asparaginase ReAV K138A mutant | 2 |
| 8S38 | MXRDR 10.18150/CGLBVH | PETRA III, EMBL c/o DESY P13 (MX1) | 1.89 | I 21 21 21 | 95.4 163.1 219.0 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Medicago truncatula glutamate dehydrogenase 2 in complex with citrate and NAD | 2 |
| 8SA8 | IRRMC 10.18430/M38SA8 | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) | 1 |
| 8SQO | IRRMC 10.18430/m38sqo | NSLS-II 19-ID | 1.55 | P 4 3 2 | 112.9 112.9 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (magnesium bound, F16L mutant) | 2 |
| 8SQQ | IRRMC 10.18430/M38SQQ | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) | 1 |
| 8SQT | IRRMC 10.18430/M38SQT | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) | 1 |
| 8T7R | IRRMC 10.18430/M38T7R | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 | 1 |
| 8THA | IRRMC 10.18430/m38tha | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form | 1 |
| 8TYY | SBGrid 10.15785/sbgrid/1040 | APS 24-ID-E | 1.68 | F 4 3 2 | 214.9 214.9 214.9 90.0 90.0 90.0 | Dectris Eiger 16M | Structure of a bacterial Ubl-deubiquitinase complex (form 2) | 1 |
| 8U0I | IRRMC 10.18430/m38u0i | ALS 8.2.1 | 1.54 | P 43 21 2 | 50.3 50.3 90.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of PA0012 complexed with cyclic-di-GMP from Pseudomonas aeruginosa | 1 |
| 8V4O | IRRMC 10.18430/m38v4o | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans | 1 |
| 8XBP | IRRMC 10.18430/M38XBP | SOLEIL PROXIMA 1 | 1.99 | C 1 2 1 | 148.3 50.8 60.2 90.0 92.3 90.0 | Dectris Eiger 16M | Crystal structure of AtNATA1 bound to Acetyl CoA | 1 |
| 8XTE | SBGrid 10.15785/sbgrid/1101 | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP | 1 |
| 8XTF | SBGrid 10.15785/sbgrid/1102 | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C | 1 |
| 8XTG | SBGrid 10.15785/sbgrid/1100 | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA | 1 | |
| 8Y74 | XRDa 10.51093/xrd-00227 | SSRF BL02U1 | 1.90 | C 1 2 1 | 125.8 76.6 87.1 90.0 92.4 90.0 | Dectris EIGER2 Si 9M | Crystal structure of 9-mer peptide from H9N2 avian influenza virus in complex with BF2*0201 | 2 |
| 8YS9 | IRRMC 10.18430/M38YS9 | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH | 1 |
| 9B22 | IRRMC 10.18430/m39b22 | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) | 1 |
| 9BN8 | IRRMC 10.18430/m39bn8 | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 | 1 |
| 9C18 | Zenodo 10.5281/zenodo.11405662 | NSLS-II 17-ID-1 | 1.90 | P 1 | 41.9 42.0 60.2 84.1 87.2 63.7 | Dectris EIGER1 Si 9M | Human biliverdin IX beta reductase in complex with NADP | 1 |
| 9CHW | SBGrid 10.15785/sbgrid/1124 | APS 21-ID-F | 2.16 | P 61 | 98.7 98.7 82.1 90.0 90.0 120.0 | Rayonix MX-300 | Crystal structure of human polymerase eta with incoming dAMPnPP nucleotide opposite threofuranosyl thymidine in DNA template | 2 |
| 9CRW | IRRMC 10.18430/m39crw | CLSI 08ID-1 | 2.49 | P 1 21 1 | 84.0 104.6 118.8 90.0 93.4 90.0 | Dectris Eiger 9M | Crystal structure of the Candida albicans kinesin-8 proximal tail domain | 1 |
| 9E2T | SBGrid 10.15785/sbgrid/1148 | SSRL BL12-1 | 2.28 | P 1 | 75.5 78.1 101.2 94.6 103.4 114.5 | Dectris EIGER2 Si 16M | Structure of a de novo designed interleukin-21 mimetic complex | 1 |
| 9EA5 | SBGrid 10.15785/sbgrid/1142 | SSRL BL9-2 | 2.00 | P 1 21 1 | 65.9 73.1 98.4 90.0 108.7 90.0 | PILATUS 6M | Structure of Citrobacter BubCD D104A mutant | 2 |
| 9FCF | MXRDR 10.18150/DGZKW3 | PETRA III, EMBL c/o DESY P13 (MX1) | 2.36 | P 4 | 91.3 91.3 35.8 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with ProFAR | 3 |
| 9FCG | MXRDR 10.18150/LDLSBT | PETRA III, EMBL c/o DESY P13 (MX1) | 1.54 | P 4 | 87.8 87.8 35.6 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with PrFAR | 2 |
| 9FHC | Zenodo 10.5281/zenodo.11472085 | SLS X06SA | 2.20 | I 2 3 | 227.5 227.5 227.5 90.0 90.0 90.0 | marCCD, 225 mm plate | Crystallographic structure of AcrB V612F with bound minocycline | 2 |
| 9GDJ | ESRF 10.15151/ESRF-DC-1848199439 | ESRF ID23-1 | 1.47 | P 41 21 2 | 123.9 123.9 126.4 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | C-Methyltransferase SgMT from Streptomyces griseoviridis | 2 |
| 9GJX | IRRMC 10.18430/M39GJX | Diamond I04 | 2.40 | P 1 21 1 | 76.8 115.8 103.8 90.0 110.3 90.0 | Eiger 16M | Bacillus licheniformis nitroreductase | 1 |
| 9GQG | ESRF 10.15151/ESRF-DC-1900353437 | ESRF ID30B | 2.00 | P 32 2 1 | 48.2 48.2 188.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | The FK1 domain of FKBP51 in complex with the macrocyclic SAFit analog m5(10,7)-(E)-OH | 2 |
| 9H0Q | Zenodo 10.5281/zenodo.13912326 | SOLEIL PROXIMA 2 | 2.55 | H 3 2 | 169.5 169.5 344.0 90.0 90.0 120.0 | Dectris EIGER1 Si 9M | N terminal domain of BC2L-C lectin in complex with N-(beta-L-Fucopyranosyl)-biphenyl-3-carboxamide | 3 |
| 9HNC | MXRDR 10.60884/0K7B68 | PETRA III, EMBL c/o DESY P13 (MX1) | 1.88 | P 1 2 1 | 123.8 123.6 187.7 90.0 90.1 90.0 | PILATUS 6M-F | Crystal structure of potassium-independent L-asparaginase | 1 |
| 9HS7 | IRRMC 10.18430/M39HS7 | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER | 1 |
| 9I0A | IRRMC 10.18430/M39I0A | SOLEIL PROXIMA 1 | 2.22 | P 21 21 2 | 75.2 98.7 208.6 90.0 90.0 90.0 | Dectris Eiger 16M | CARM1 in complex with arg-aDMA analog | 1 |
| 9I80 | Zenodo 10.5281/zenodo.14844040 | SOLEIL PROXIMA 1 | 1.95 | P 41 | 81.2 81.2 165.0 90.0 90.0 90.0 | Dectris Eiger 16M | LecA in complex with a tolcapone derivative glycomimetic | 2 |
| 9IG7 | IRRMC 10.18430/M39IG7 | PETRA III, EMBL c/o DESY P13 (MX1) | 2.60 | P 21 21 2 | 111.5 153.5 69.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides | 1 |
| 9IH9 | IRRMC 10.18430/M39IH9 | ESRF MASSIF-3 | 1.70 | C 1 2 1 | 78.8 133.9 82.3 90.0 101.4 90.0 | Dectris EIGER1 Si 4M | KEAP1 complexed to linear peptide 6 | 1 |
| 9JZO | IRRMC 10.18430/m39jzo | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. | 1 |
| 9KHR | Zenodo 10.5281/zenodo.14070468 | RRCAT INDUS-2 PX-BL21 | 2.00 | P 21 21 21 | 48.7 50.3 78.0 90.0 90.0 90.0 | marCCD, 225 mm plate | Crystal structure of Plasmoredoxin, a disulfide oxidoreductase from Plasmodium falciparum crystallized in the presence of Dithiothreitol (DTT) | 2 |
| 9MH4 | IRRMC 10.18430/M39MH4 | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes | 1 |
| 9MIN | SBGrid 10.15785/sbgrid/1151 | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 | 1 |
| 9O0H | IRRMC 10.18430/M39O0H | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker | 1 |
| 9P7Q | IRRMC 10.18430/M39P7Q | SSRL BL12-1 | 2.21 | C 1 2 1 | 97.0 45.0 72.1 90.0 105.1 90.0 | Dectris EIGER2 Si 16M | 273K human S-adenosylmethionine decarboxylase | 1 |
| 9PBB | IRRMC 10.18430/M39PBB | SSRL BL12-1 | 2.17 | C 1 2 1 | 97.4 45.9 72.2 90.0 105.0 90.0 | Dectris EIGER2 Si 16M | 293K human S-adenosylmethionine decarboxylase | 1 |
| 9Q41 | SBGrid 10.15785/sbgrid/1194 | CHESS 7B2 | 1.95 | C 2 2 21 | 118.6 133.7 82.4 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | Crystal Structure of Human Apo Spermidine Synthase | 2 |
| 9Q66 | SBGrid 10.15785/sbgrid/1208 | NSLS-II 17-ID-1 | 2.01 | P 1 21 1 | 105.9 67.3 158.0 90.0 99.1 90.0 | Dectris EIGER1 Si 9M | Human prolyl endopeptidase (PREP) - complex with JP-4-1-7 | 2 |
| 9QW8 | ESRF 10.15151/ESRF-DC-2127908021 | ESRF ID23-1 | 1.80 | P 1 | 35.6 35.6 100.9 86.5 84.2 72.5 | Dectris EIGER2 CdTe 16M | FKBP12 in complex with bifunctional ligand 1ad | 1 |
| 9RCI | Zenodo 10.5281/zenodo.15615368 | SOLEIL PROXIMA 2 | 1.66 | P 1 | 35.9 39.3 100.9 98.3 90.3 90.1 | Dectris Eiger 9M | Crystal Structure of Flap Endonuclease FEN1 with Compound 28 | 1 |
| 9RCS | XRDa 10.51093/xrd-00383 | Diamond I24 | 3.01 | P 1 21 1 | 70.0 78.8 82.3 90.0 88.6 90.0 | Eiger 9M | Cardioderma bat coronavirus KY43 receptor binding domain in complex with human CEACAM6 | 2 |
| 9RP9 | IRRMC 10.18430/M39RP9 | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex | 1 |
| 9SL0 | IRRMC 10.18430/M39SL0 | ESRF MASSIF-1 | 1.60 | P 21 21 21 | 60.2 80.2 111.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of HLA-A0201 in complex with peptide LLWNGPMAV | 1 |
| 9T6S | SBGrid 10.15785/sbgrid/1260 | ESRF ID30B | 2.00 | P 21 21 21 | 63.0 64.6 102.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of the Listeria monocytogenes CadC with Cadmium | 2 |
| 9UPT | XRDa 10.51093/xrd-00191 | NSRRC TPS 05A | 2.37 | P 6 | 158.3 158.3 54.0 90.0 90.0 120.0 | SMV, S/N 930 | Structure of AtBgl1A, a GH1 beta-Glucosidase from Acetivibrio thermocellus | 2 |
| 9VX7 | IRRMC 10.18430/M39VX7 | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor | 1 |
| 9VYB | IRRMC 10.18430/M39VYB | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd | 1 |
| 9W3Y | IRRMC 10.18430/M39W3Y | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) | 1 |
| 9YL4 | Zenodo 10.5281/zenodo.17298261 | APS 17-ID | 3.70 | P 21 21 21 | 95.8 111.3 403.0 90.0 90.0 90.0 | PILATUS 6M | Crystal structure of PprA S-F filament from Deinococcus radiodurans | 2 |
| 9YZK | IRRMC 10.18430/M39YZK | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | 1 |
| 9Z44 | IRRMC 10.18430/M39Z44 | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain | 1 |
| 9Z72 | SBGrid 10.15785/sbgrid/1239 | SSRL BL9-2 | 2.38 | P 31 2 1 | 59.2 59.2 426.2 90.0 90.0 120.0 | Dectris EIGER2 Si 16M | Structure of V. cholerae CapS (form 1) | 2 |
| 9ZLO | Zenodo 10.5281/zenodo.18652652 | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE | 1 |
| 9ZM0 | IRRMC 10.18430/M39ZM0 | NSLS-II 17-ID-1 | 2.10 | P 1 21 1 | 50.4 30.1 91.2 90.0 97.1 90.0 | Dectris EIGER1 Si 9M | Crystal structure of monomeric Atg23 | 1 |
| 9ZMU | IRRMC 10.18430/M39ZMU | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) | 1 |
| — | Zenodo 10.5281/zenodo.1036416 | Diamond Light Source I19-1 | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 | 1 | |||
| — | Zenodo 10.5281/zenodo.14894181 | Dectris Eiger 9M | Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation | 1 | ||||
| — | Zenodo 10.5281/zenodo.20041091 | Diamond Light Source I19-2 | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | 1 | |||
| — | Zenodo 10.5281/zenodo.20135265 | Diamond Light Source I19-2 | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | 1 | |||
| — | Zenodo 10.5281/zenodo.6347466 | Diamond Light Source I19-2 | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source | 1 | |||
| — | Zenodo 10.5281/zenodo.33555 | Diamond Light Source I19-1 | PILATUS 2M | Example Cytidine data set from I19-1 at Diamond Light Source | 1 | |||
| — | Zenodo 10.5281/zenodo.11946282 | Diamond Light Source I19 | PILATUS 2M | RODIN X-ray Diffraction Data 2360282 (L-alanine) | 1 |
Seven rows have no PDB code. Six are small-molecule / chemical-crystallography datasets, kept because they exercise short wavelengths, CdTe sensors, fine slicing and non-zero detector 2θ; the seventh is the second collection in the 6R72 Zenodo record, described below. They have no deposited macromolecular values, so those columns are blank, and their titles are the repository record titles verbatim.
Five of the third-round datasets are in primitive space groups with no screw axis - 6ZQR, 6ZQY, 6ZR0 and 9FCF in P 4, and 6NEN in P 3 1 2. They are in the battery as negative controls for screw-axis detection: the correct answer for each has no systematic absences.
Archives that are not a single sweep
Most rows above are a single continuous rotation. Among the 102 first-round datasets twenty-one archives are not; their layout is read from the image files themselves, from the repository file listings and from the depositors' own description of the record. (The 51 datasets of the second scouting round, described at the end of this page, and the 18 of the third have not had their archive layouts audited to this depth; the third-round archives that needed special handling are described at the end of this section.) Where an archive held more than one collection, only one is kept - the repository's project page is not a reliable guide to this, because it describes the project rather than the tarball (7TCD's page lists a 900-frame miniCBF sweep the archive does not contain).
6R72 - two collections on one crystal. The Zenodo record holds two complete 360° sweeps of
3600 × 0.1° frames taken from the same crystal: a helical collection, which produced the
deposited structure, and a low-dose collection from a single position, which was not used for a
deposition and therefore has no PDB entry. Both are in the table, sharing one DOI; the deposited
values belong to the helical collection only. The record also ships the authors' XDS.INP.
The three CHESS depositions - wedges plus a measured background. Each crystal was rotated in
50° wedges of 500 × 0.1° frames and translated between wedges to spread the dose. Each crystal
also has a rotation at 1° per frame taken with the crystal translated out of the beam, which the
depositors include as a measured background and say can be matched to the diffraction frames by
the phi value in the image header.
| PDB | Crystals | Wedges per crystal | Background rotation |
|---|---|---|---|
| 8DYZ | 1 | 8 | 360 frames |
| 8DZ7 | 2 | 4 | 200 frames per crystal |
| 6O2H | 4 | 1, 3, 2, 5 - 11 in all | 50, 145, 95, 235 frames, one per crystal |
Seven IRRMC archives hold more than one collection. In six of them one sweep is kept and the rest were deleted, so a run over the data directory sees a single collection per dataset. 7RIS is the exception: its two sweeps are at different wavelengths and both are kept.
| PDB | What the archive holds | Kept |
|---|---|---|
| 6UKF | two sweeps on one crystal - 960 x 0.25° (240°) and 1440 x 0.25° (360°) | the 360° sweep |
| 7DKP | two complete 360° sweeps on one crystal, 3° apart in ω | the first |
| 9PBB | two overlapping 135° wedges of one crystal, 90 x 1.5° each | the first |
| 8U0I | a 69-frame screening wedge and three 180° sweeps on three crystals | the first 180° sweep |
| 36GK | two 360° sweeps of 1800 x 0.2° at the same geometry | the one the archive and DOI are named for |
| 9CRW | a dose pair on one crystal 37 min apart - 0.025 s at 289 mm, 0.010 s at 276 mm | the 0.025 s sweep, whose 2.5 Å target matches the deposited 2.49 Å |
| 7RIS | two crystals at two wavelengths - 1.53494 Å (Ho derivative) and 1.03329 Å (the deposited native) | both |
Ten of the scout archives hold more than one collection. Their layout was read from the image files and repository listings; one sweep is kept for a run over the data directory unless noted.
| PDB / dataset | What the archive holds | Kept |
|---|---|---|
| 5JVN | two 360° sweeps of one crystal, 3600 × 0.1° each (w1_3, w1_4) |
the w1_3 sweep |
| 6FID | two 360° sweeps of one crystal, 3600 × 0.1° each | the first |
| 6IU8 | a two-wavelength MAD pair, 720 × 0.5° each at 1.605 Å (low remote) and 1.740 Å (peak) | both - the pair is the point |
| 7OS3 | four 360° sweeps at λ 2.066 Å, 3600 × 0.1° each, from two crystal positions (pos2_1/2, pos3_1/2) |
all four are kept as separate sweep directories pos*/ |
| 7L84 | two ~720° helical sweeps, 1439 × 0.5° each at λ 1.892 Å, room temperature | the 301_helical_1 sweep |
| 5M17 | seven crystals in one tar (5M03/5M17/5MEL/5MC8/5M5D/5M3W/5LYR), one 1800-frame sweep each | only the 5M17 tar was downloaded |
| cytidine | six scans, three ω and three φ, at 2θ = 30° (I19-1 commissioning) | the 1800-frame φ scan |
| lalanine | four runs of the RODIN L-alanine deposition at 2θ = 20° | the 900-frame pgw240050_01 run |
| 9E2T | one continuous sweep plus screening images | the 2700-frame sweep |
| 8OWM | three MXRDR zips covering one 1800-frame sweep, plus a processed-data zip | the three sweep zips (proc zip skipped) |
Three third-round archives needed special handling to obtain the images.
- 5KY6 is served by MXRDR as 11 separate RAR archives, one folder of frames per archive, 50
frames per archive except the last, 564 frames in all. Reading them needs a RAR reader with
RAR3 filter support: the official 7-Zip
7zzreads them, while the unrar-free and p7zip builds of Enterprise Linux 8 cannot. - 6ZR0's zip, as the Keele University repository serves it, is damaged: it has no central directory. Frames 1-1059 of the 1060 were recovered from the zip's local file headers; the last frame is lost.
- 6NEN's University of Queensland eSpace record blocks scripted download, so its archive was downloaded by hand in a browser.
Datasets published as Raw Data Letters
Three of the datasets - 6R72, 8QQ7 and 6RLR - were published as IUCrData Raw Data Letters, a format whose purpose is to make raw images citable and re-processable in their own right. The letters describe the collections and the difficulties in them, and are the reference for what the data are:
- V. Zampieri, A. Vermot, M. Thepaut, I. Petit-Hartlein, F. Fieschi, P. Falson and V. Chaptal, "X-ray diffraction images for two membrane protein crystals presenting high anisotropy; the B. subtilis ABC transporter BmrA and the S. pneumoniae NADPH oxidase" (2025), IUCrData 10, x250591 doi:10.1107/S2414314625005917 - covers 6R72 and 8QQ7.
- V. Neviani, M. Lutz, W. Oosterheert, P. Gros and L. Kroon-Batenburg, "Crystal structure of the second extracellular domain of human tetraspanin CD9: twinning and diffuse scattering" (2022), IUCrData 7, x220852 doi:10.1107/S2414314622008525 - covers 6RLR.
The authors of the second letter also published their own reciprocal-space reconstruction of the 6RLR data as a separate Zenodo record, 10.5281/zenodo.6961763.
Detector: image file vs PDB entry
For 94 of the 95 first-round PDB-coded rows both the image file and the PDB entry name a detector. (For
8XTG neither can be compared - the header reads PILATUS XXX, S/N XX-XXX.) The table above uses
the file value in every case, because the entry's label is often approximate.
Nine of the 94 genuinely conflict - the two sources name detectors that cannot both be right:
| PDB | PDB entry says | Image file says | Conflict |
|---|---|---|---|
| 6JGJ | DECTRIS PILATUS3 6M | PILATUS3 300K, S/N 3-0226 | model / size |
| 8R5R | DECTRIS PILATUS 6M | Dectris EIGER2 CdTe 16M | model / size |
| 9SL0 | DECTRIS PILATUS4 X 4M | Dectris EIGER2 Si 9M | model / size |
| 9VX7 | DECTRIS EIGER X 9M | PILATUS3 6M, S/N 60-0133 | model / size |
| 7ATG | DECTRIS PILATUS3 S 6M | PILATUS 6M-F, S/N 60-0117-F | generation |
| 9O0H | DECTRIS EIGER X 16M | Dectris EIGER2 Si 16M, S/N D021324 | generation |
| 9Z44 | DECTRIS EIGER X 9M | Dectris EIGER2 Si 9M, S/N E-18-0131 | generation |
| 9HNC | DECTRIS EIGER X 16M | PILATUS 6M-F, S/N 60-0117-F | model / size |
| 6P8P | DECTRIS PILATUS3 S 6M | PILATUS 6M-F, S/N 60-0112-F | generation |
For 9SL0 the file is decisive and the entry is wrong: 3108 x 3262 pixels of 75 um on 450 um
silicon, written by EIGER2 firmware release-2022.1.2, is an EIGER2 9M and not a PILATUS4 4M.
A further 29 differ only in how much they state, which is not a conflict. In 23 the NXmx
description gives the model and size but no generation (Dectris Eiger 16M) where the entry
names one (DECTRIS EIGER X 16M); in 6 it is the other way round, the miniCBF header naming a
generation (PILATUS3 6M) that the entry leaves off (DECTRIS PILATUS 6M) - 6YQF, 7PH1, 7QIS,
7YZX, 8XTE and 9YZK.
The 51 second-round datasets add formats whose files name the detector differently - or not at
all. A marCCD file names no model: its instrument header states the image dimensions and the
pixel size, from which the plate size follows (3072 x 73.242 um = 225 mm, 4096 x 73.242 um =
300 mm), and its comment block a serial number; the LS-CAT beamlines additionally write
detector='Rayonix MX-300 s/n 023' into the dataset comment. An SMV header names only a serial
(DETECTOR_SN=930). For those rows the Detector column carries what the file itself establishes:
the plate size (marCCD, 225 mm plate), the comment's name where one is present
(Rayonix MX-300), or the serial (SMV, S/N 930).
Seven of the 51 conflict with their PDB entry:
| PDB | PDB entry says | Image file says | Conflict |
|---|---|---|---|
| 7N2S | DECTRIS EIGER X 16M | PILATUS 6M, S/N 60-0101 | model / size |
| 8RUD | DECTRIS PILATUS 6M | Dectris Eiger 16M, E-32-0107 | model / size |
| 6FWC | DECTRIS EIGER X 4M | PILATUS 2MF, S/N 24-0109-F | model / size |
| 9Q41 | DECTRIS PILATUS 6M | Dectris EIGER2 Si 16M | model / size |
| 9Z72 | DECTRIS EIGER X 16M | Dectris EIGER2 Si 16M, S/N E-32-0127 | generation |
| 9KHR | MAR CCD 165 mm | marCCD, S/N 35, 3072 x 3072 pixels of 73.242 um | plate size |
| 9UPT | RAYONIX MX300-HS | SMV, S/N 930, 3072 x 3072 pixels of 102.588 um | plate size |
For 9KHR and 9UPT the file names no model, so the comparison is on geometry, and it is decisive both times: 3072 x 3072 pixels of 73.242 um is a 225 mm plate, not the entry's 165 mm one, and 3072 x 3072 pixels of 102.588 um is a 315 mm plate, which no 300 mm detector has. The 6FWC frames were written by the same PILATUS 2M-F, S/N 24-0109-F, that wrote the 5NW5 and 6TOC frames at SLS X06DA, although the entry deposits an EIGER 4M at ESRF MASSIF-3.
The other 44 of the 51 agree with their entry, up to how much each side states: DECTRIS EIGER X 9M against the file's Dectris EIGER1 Si 9M, MARMOSAIC 300 mm CCD against a comment reading
Rayonix MX-300 (the same detector under its later brand), a serial number or an -F suffix
the entry leaves off.
Two of the 18 third-round datasets conflict with their PDB entry:
| PDB | PDB entry says | Image file says | Conflict |
|---|---|---|---|
| 5MLN | MARMOSAIC 225 mm CCD | PILATUS3 2M, S/N 24-0118, ESRF ID23 | model / size |
| 9H0Q | DECTRIS EIGER X 16M | Dectris EIGER1 Si 9M, E-18-0102 | model / size |
The other 16 agree with their entry up to how much each side states. The three ADSC entries
(ADSC QUANTUM 315, ADSC QUANTUM 315r) have SMV files of 3072 x 3072 pixels of 0.1026 mm (0.102592 mm for
6NEN), a 315 mm detector; the marCCD files are 225 mm plates where the entry names a 225 mm detector and
300 mm plates where it names a 300 mm one.
Deposited models and structure factors
164 of the 171 datasets have a released PDB entry (those of the second and third rounds all do), and RCSB
reports released structure factors (status_code_sf = REL) for every one of them. A merged
result from this pipeline can therefore be checked against the deposited model or against the
deposited intensities.
Rows where our reduction and the deposition disagree
Six of the 171 rows are ones where rugnux does not reproduce the deposited space group or
cell, and where we have looked at the disagreement closely enough to change how the row is
scored. They are collected here because a scoring row that silently disagrees with a published
entry is not something a reader should have to discover from the code.
These are open questions, not errors we are attributing to the PDB. A deposited entry was arrived at by someone who had something we do not: a model that had to refine, and usually more knowledge of the crystal than the images carry. Where we describe evidence below, it is evidence about what these images support, which is a narrower thing than what the crystal is. In every one of the symmetry rows the possibility that the crystal really has the lower symmetry, with a pseudo-symmetry too exact for any test available to us to see, remains live - see the limit at the end of this section.
How the manifest records it, in tools/battery/open.json:
refalways keeps the deposited values verbatim, so the deposition is never lost.ref_alternativeslists the other answers the row accepts. Each one replaces the reference fields it names - a space group, a cell, or both - and the row passes if our answer matches any of the references, the deposited one included. Each must carrywhy; an alternative with no stated reason is a schema error, not a silent pass, so the mechanism cannot become a way to turn a failure into a pass quietly. This is how the five knife-edge rows below are recorded: we are not asserting that our answer is right, only that both descriptions are defensible and that picking either one is acceptable. The report counts these rows separately from ordinary passes and prints the reason, so a reader can see how many there are and judge each.ref_overridereplaces the fields the battery scores against, withref_override_why. It asserts a corrected reference, so it is for a reference we can show to be wrong about these images - 8XBP below - and not for a disagreement that is open.unscoreddrops the row from scoring entirely. It is a last resort: it also loses a test that still works, which is why an open question is now recorded as accepted alternatives instead.
8XBP is a question about provenance, not about symmetry
8XBP is different in kind from the other five and should not be read alongside them. Nothing
here concerns the deposited model or its space group. The question is whether the raw images
uploaded with the entry are the same crystal the deposited cell describes: the master file
records data_collection_date 2023-06-21 where the entry records a collection date of
2023-06-23, and the deposited b = 50.78 A is 2.0% away from the b these images give. Two
independent signals, one of them nothing to do with our processing. The override replaces the
cell with the one DIALS 3.29 indexes de novo on this master and keeps the deposited space group
and resolution.
Four trigonal and tetragonal rows where we read a higher point group
| PDB | Deposited | rugnux reads |
Where it stands |
|---|---|---|---|
| 6TOC | P 42 | P 42 2 2 | both acceptable; the refinement test is not unanimous |
| 8XTE | P 32 | P 31 2 1 / P 32 2 1 | both acceptable; ours is the better supported |
| 8XTG | P 32 | P 31 2 1 / P 32 2 1 | both acceptable; the deposition is the better supported |
| 6PXB | P 32 | P 31 1 2 / P 32 1 2 | both acceptable; unresolved in either direction |
All four accept either answer: the deposited group and the one we read both pass. None of them
is a claim that the deposited assignment is wrong - each is a question we cannot close, and 8XTE
and 8XTG do not lean the same way, so they should not be read in one voice. The two 8XT* rows
were for a time scored against our own answer by editing the reference itself, with no reason
recorded; the deposition is back in ref verbatim and the disagreement is stated here.
6TOC. The deposited asymmetric unit holds two chains, and they are related by the very two-fold the higher group adds, to 0.16 A C-alpha RMSD over 43 residues - coordinate error at the deposited 1.85 A. Merging in P 42 2 2 costs 0.0006 in Rmeas for 1.75 times the multiplicity, and correlates better with the deposited model than the P 42 merge does. POINTLESS, run independently on our own P1 merge, reads the same point group. The refinement test - refine in each candidate group and compare R-free, which is the one comparison not biased toward the group the deposited model was refined in - does not come out unanimous: ZANUDA 1.097 makes P 42 2 2 the better group at half the parameters and reports the deposited assignment incorrect, while an independent Refmac 5.8.0431 comparison on a symmetry-consistent free set makes P 42 the better one, by less than the spread between refinement protocols - the spread of the test exceeds the effect it is being asked to measure. Both answers are therefore accepted, with the refinement evidence recorded as split.
8XTE. The distinguishing test is the twin-immune centric zone: reflections that the higher
group makes centric but the subgroup does not are their own twin mates, so a merohedral twin law
cannot make them read centric. They read <|E^2-1|> = 0.946 +/- 0.012 against a centric
expectation of 0.968 and an acentric one of 0.736. Re-refinement on a shared free set, with the
twin law removed from both sides, favours the higher group. The deposited entry's published R
values are themselves reproducible only with a twin law the entry does not declare, at a twin
fraction of 0.50 - and a 0.50-twinned target already has the symmetry in question. Of the four
rows this is the one where the evidence most clearly favours what we read; it still cannot be
closed, because the centric zone is the only test that speaks to it (see the limit below), so
both answers are accepted.
8XTG. This row is genuinely open and is flagged as such in the manifest. Every
correlation-based instrument we have - our own operator correlations, and POINTLESS on our P1
merge - reads the higher point group, but the centric-zone test, the only one of them that can
separate real symmetry from pseudo-symmetry, reads <|E^2-1|> = 0.869 at -44.9 nats: between
the two expectations, and on the wrong side. The L-test indicates a twin fraction near 0.20-0.26.
Whether this crystal is partially twinned or purely pseudo-symmetric has not been established.
Here the better-supported answer is the deposited one, which is the opposite of 8XTE: the two
rows look alike in the table and are not alike in the evidence. Both answers are accepted.
6PXB. Unscored rather than overridden, because the evidence does not settle either way. Our merge and POINTLESS both read a 312 point group, the added two-folds correlate at or above the level of the three-folds nobody disputes, and merging in the higher group lowers Rmeas at twice the multiplicity. Against that, the deposited asymmetric unit's six chains pair under the added two-fold at 0.3-0.7 A, which is more than coordinate error at 1.75 A, and ZANUDA settles on a different trigonal supergroup - 321 rather than 312 - whose operators these data do not support. Neither answer is established in either direction, so both are accepted and the row still tests everything else about the set.
9RCI: two defensible descriptions of one lattice
The sixth row is not about symmetry but about which cell describes the crystal. The Patterson
has an off-origin peak at 62.5% of the origin, so a genuine translational NCS relates the two
halves of the cell rugnux reports, and the deposited cell is that supercell's
(0, 1/2, 1/2)-centred sublattice to 0.17%. Both are correct descriptions of the same diffraction:
one leaves the near-translation in the contents of a doubled cell, the other absorbs it into the
lattice and indexes only the strong sublattice. Which one a program should prefer is a choice,
not a measurement, so the row accepts either. The alternative cell recorded in the manifest is
computed from the deposited cell alone (c' = b + 2c, centring removed), not copied from our
output, so it stays a statement about the deposition's lattice.
The limit that applies to all four symmetry rows
A merohedral twin at a twin fraction of exactly 0.5 and a crystal that genuinely has the higher symmetry predict identical intensities. No amount of data and no refinement R separates them, and the same holds, approximately, for a pseudo-symmetry that is merely very exact. Every test described above measures how nearly a symmetry operator holds on these images; none of them can show that it holds exactly. Where the higher symmetry is right, merging in it gains multiplicity and completeness; where it is a pseudo-symmetry that close, merging in it costs nothing measurable either. That is why these rows are described as open questions, and why none of them should be read as a statement that a deposited model is wrong.
Dataset directories whose name is not the PDB code
| Directory | PDB code in the table | Why |
|---|---|---|
7brr |
7D1M | The IRRMC archive and its DOI are published under 7BRR, which the PDB obsoleted on 2020-10-28 and replaced with 7D1M. The directory and the DOI keep the archive's own name; the deposited values are 7D1M's. |
An archive that ships placeholder images
8AGQ's data/ directory contains 30 files named ForBackgroundOnly_000NN.img alongside the
1800-frame sweep. They are not images: each is a 64-byte text file holding a path string. A
reader that globs *.img will pick them up, so they are named here rather than silently left.
Datasets with no PDB entry
| Dataset | Repository record | Why there is no PDB code |
|---|---|---|
6r72/ld |
Zenodo record 10.5281/zenodo.14894181, file prefix V-CK63-8-ld_1_ |
a second collection in the 6R72 record - a low-dose sweep on the same crystal, not the one the deposited structure was built from |
cuhf2 |
Zenodo record 10.5281/zenodo.6347466 | a small-molecule dataset, not a PDB deposition |
dnba |
Zenodo record 10.5281/zenodo.1036416 | a small-molecule dataset, not a PDB deposition |
metformin |
Zenodo record 10.5281/zenodo.20135265 | a small-molecule dataset, not a PDB deposition |
nidppe |
Zenodo record 10.5281/zenodo.20041091 | a small-molecule dataset, not a PDB deposition |
cytidine |
Zenodo record 10.5281/zenodo.33555 | a small-molecule dataset, not a PDB deposition |
lalanine |
Zenodo record 10.5281/zenodo.11946282 | a small-molecule dataset, not a PDB deposition |
Five of the six small-molecule sets have a published structure to check a run against. These are reference values from the literature, not results obtained here.
| Dataset | Space group | Cell (A, deg) | T | Reference |
|---|---|---|---|---|
dnba |
C 1 2/c 1 (15) |
20.2635 8.7575 9.6697 / 90 109.941 90 | 30 K | the Zenodo record's own title and the xia2.html the depositors ship inside it, corroborated by COD 4510614/4510615 - Cryst. Growth Des. 13 (2013) 1861-1871 doi:10.1021/cg300906j |
metformin |
P 1 21/c 1 (14) |
7.9104 13.8794 7.9310 / 90 114.606 90 | 100 K | the hydrochloride, form I; COD 2108029 - Acta Cryst. B73 (2017) 10-22 doi:10.1107/S2052520616017844 |
nidppe |
P 1 21/c 1 (14) |
11.2779 13.3386 15.8739 / 90 98.7953 90 | 150 K | COD 2012031 - Acta Cryst. C57 (2001) 690-693 doi:10.1107/S0108270101003961 |
cytidine |
P 21 21 21 (19) |
13.98 14.788 5.119 / 90 90 90 | 296 K | β-cytidine; COD 2001311 - D. L. Ward, Acta Cryst. C49 (1993) 1789-1792 doi:10.1107/S0108270193003464 |
lalanine |
P 21 21 21 (19) |
5.7952 5.933 12.362 / 90 90 90 | ambient | COD 2104782 - N. A. Tumanov et al., Acta Cryst. B66 (2010) 458-471 doi:10.1107/S010876811001983X |
cuhf2 has no confirmed cell. Its space group is published as P 4/n m m (Phys. Rev. B 81,
064422 (2010) doi:10.1103/PhysRevB.81.064422) but no
numeric cell was located, so a run on it can be scored on the space group and not on the cell.
The second-round additions in numbers
The 51 rows marked round 2 in the table were added together, in a second scouting round chosen to widen the spread of file formats, detectors, facilities and symmetries rather than to be easy to process. They hold 519 GB of images. The counts below describe where that collection comes from; like everything else on this page, they are metadata about the depositions and their files, not measurements.
- Repository: IRRMC 16, SBGrid 14, Zenodo 10, MXRDR 6, XRDa 3, ESRF 2.
- File format, as the files are on disk: miniCBF 23 (20 plain, 2 gzip-compressed, one
bzip2-compressed inside a tar), marCCD 14 (one as
.mccdfiles inside a zip), NXmx HDF5 12, SMV 2. - Facility - counted from the facility part of the Facility / beamline column, the beamline ignored so that entries deposited with and without one count the same: APS 12, BESSY 5, ESRF 5, PETRA III 4, SPring-8 4, SSRL 4, ALS 3, NSLS-II 3, SLS 3, Diamond 2, and one each from CHESS, ELETTRA, NSRRC, RRCAT Indus-2, SOLEIL and SSRF - sixteen facilities.
- Crystal system, from the deposited space group: orthorhombic 12, monoclinic 10, trigonal 10, cubic 8, tetragonal 7, hexagonal 3, triclinic 1.
The format spread is the point of the round: these datasets are the reason rugnux reads marCCD,
SMV and gzip-compressed miniCBF natively, and accepts the .img and numeric-suffix (.001)
file names those formats arrive with.
The third-round additions in numbers
The 18 rows marked round 3 were added to widen the symmetry coverage: five are the screw-free negative controls named below the table, and three have a cell axis longer than 320 Å (6G1F, 9H0Q and 6QAJ).
- Repository: IRRMC 5, MXRDR 4, SBGrid 3, Keele University 3, Zenodo 2, University of Queensland eSpace 1.
- File format, as the images are on disk after extraction: marCCD 8, miniCBF 6 (one gzip-compressed), SMV 3, NXmx HDF5 1.
Licences
Each dataset carries the licence of its own deposition, stated on the record page linked above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each record states. None of these data are redistributed with Jungfraujoch; this page only records where they came from.