The crystal was measured at two wavelengths; both sweeps are kept. The native sweep carries the deposited resolution, the 1.89 A sweep is scored on symmetry and cell only. Co-Authored-By: Claude Opus 5 (1M context) <noreply@anthropic.com>
155 lines
32 KiB
JSON
155 lines
32 KiB
JSON
{"arm": "open", "sets": [
|
|
{"id": "11if", "input": "11if/BopeA_18500_a_B2-PEF_11if/data/PSL-1503_13949_master.h5", "ref": {"sg": "P 43", "sgno": 78, "cell": [51.14, 51.14, 71.92, 90.0, 90.0, 90.0], "dmin": 1.51}, "tags": ["h5", "tetragonal"], "tiers": {"smoke": "Eiger NXmx from another facility, 4-fold screw"}},
|
|
{"id": "36gk", "input": "36gk/CLS-0074_5-3_36GK/data/CLS-0074_5-3_master.h5", "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [120.58, 189.49, 199.69, 90.0, 90.0, 90.0], "dmin": 2.28}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "3inp", "input": "3inp/IDP02542_3inp/data/idp02542b.001", "ref": {"sg": "F 41 3 2", "sgno": 210, "cell": [224.08, 224.08, 224.08, 90.0, 90.0, 90.0], "dmin": 2.05}, "tags": ["marCCD", "cubic"]},
|
|
{"id": "3ky7", "input": "3ky7/IDP90258_3ky7/data/idp90258f.001", "ref": {"sg": "P 43 3 2", "sgno": 212, "cell": [125.176, 125.176, 125.176, 90.0, 90.0, 90.0], "dmin": 2.35}, "tags": ["marCCD", "cubic"]},
|
|
{"id": "5ebi", "input": "5ebi/dna-rna-chimera_Ba_high_2_001.img", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [35.72, 44.1, 35.72, 90.0, 119.98, 90.0], "dmin": 1.09}, "pinned": true, "tags": ["marCCD", "monoclinic", "twin"]},
|
|
{"id": "5epe", "input": "5epe/030805_5epe/data/E1_7_set.001", "ref": {"sg": "F 2 3", "sgno": 196, "cell": [157.536, 157.536, 157.536, 90.0, 90.0, 90.0], "dmin": 1.9}, "tags": ["marCCD", "cubic"]},
|
|
{"id": "5f6m", "input": "5f6m/crystal3_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [54.81, 58.51, 67.42, 90.0, 90.0, 90.0], "dmin": 1.1}, "tags": ["cbf", "orthorhombic", "diffuse"]},
|
|
{"id": "5j23", "input": "5j23/012132_5j23/data/XZ2_set.001", "ref": {"sg": "H 3", "sgno": 146, "cell": [175.822, 175.822, 136.839, 90.0, 90.0, 120.0], "dmin": 2.3}, "tags": ["marCCD", "trigonal", "twin"]},
|
|
{"id": "5jvn", "input": "5jvn/5jvn/data/PPDK-AV2820_w1_3_0001.cbf", "ref": {"sg": "P 6 2 2", "sgno": 177, "cell": [249.43, 249.43, 84.06, 90.0, 90.0, 120.0], "dmin": 2.9}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "5lzl", "input": "5lzl/pcalad/alad-levoil6_M3S15_1_0001.cbf", "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [205.561, 205.561, 199.171, 90.0, 90.0, 120.0], "dmin": 3.47}, "tags": ["cbf", "trigonal"]},
|
|
{"id": "5m17", "input": "5m17/BxGH99_WTDD_HA00AG2801_2_0001.cbf", "ref": {"sg": "I 4", "sgno": 79, "cell": [108.576, 108.576, 67.746, 90.0, 90.0, 90.0], "dmin": 1.03}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "5nw5", "input": "5nw5/5NW5_1_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [92.14, 169.8, 390.16, 90.0, 90.0, 90.0], "dmin": 6.502}, "tags": ["cbf", "orthorhombic", "low-resolution"]},
|
|
{"id": "5reo", "input": "5reo/cbf/Mpro-x0752_1_0001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [112.39, 52.59, 44.38, 90.0, 103.04, 90.0], "dmin": 1.88}, "tags": ["cbf", "monoclinic"], "tiers": {"smoke": "fastest set (10 s): miniCBF, monoclinic"}},
|
|
{"id": "5src", "input": "5src/5src/data/FRS004_15_1_00001.cbf", "ref": {"sg": "P 43", "sgno": 78, "cell": [88.68, 88.68, 39.23, 90.0, 90.0, 90.0], "dmin": 1.05}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "6fid", "input": "6fid/Trypsin_x1_align_2_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [59.947, 64.107, 69.694, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6fvz", "input": "6fvz/maox215_6fvz/data/maox215_w1_1_0001.cbf", "ref": {"sg": "C 2 2 2", "sgno": 21, "cell": [131.182, 222.753, 86.482, 90.0, 90.0, 90.0], "dmin": 1.8}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6fwc", "input": "6fwc/maox225_6fwc/data/maox225_1_00001.cbf", "ref": {"sg": "C 2 2 2", "sgno": 21, "cell": [131.728, 222.051, 86.293, 90.0, 90.0, 90.0], "dmin": 1.7}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6h2p_native", "input": "6h2p/ProlMut1MnCAC_6h2p/data/Prol_Mut1_Mn_X1_nat_1_0002.cbf", "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [103.453, 107.075, 216.543, 90.0, 90.0, 90.0], "dmin": 1.479}, "tags": ["cbf", "orthorhombic", "two-wavelength"]},
|
|
{"id": "6h2p_1p89A", "input": "6h2p/ProlMut1MnCAC_6h2p/data/Prol_Mut1_Mn_X_pk1_2_0001.cbf", "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [103.453, 107.075, 216.543, 90.0, 90.0, 90.0], "dmin": null}, "tags": ["cbf", "orthorhombic", "long-wavelength", "two-wavelength"]},
|
|
{"id": "6h5t", "input": "6h5t/6h5t/data/SH3-1_x2_1_001.img", "ref": {"sg": "I 4 2 2", "sgno": 97, "cell": [86.792, 86.792, 141.768, 90.0, 90.0, 90.0], "dmin": 1.689}, "tags": ["marCCD", "tetragonal"]},
|
|
{"id": "6hv2", "input": "6hv2/6hv2/data/coll_1_master.h5", "ref": {"sg": "P 61 2 2", "sgno": 178, "cell": [68.928, 68.928, 133.563, 90.0, 90.0, 120.0], "dmin": 1.709}, "tags": ["h5", "hexagonal"]},
|
|
{"id": "6hwj", "input": "6hwj/bg3006_2_0001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [59.812, 96.07, 80.252, 90.0, 106.69, 90.0], "dmin": 1.979}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "6i3j", "input": "6i3j/6i3j/data/BF19_go_1_0001.img", "ref": {"sg": "F 2 2 2", "sgno": 22, "cell": [134.382, 203.846, 226.744, 90.0, 90.0, 90.0], "dmin": 2.59}, "tags": ["marCCD", "orthorhombic"]},
|
|
{"id": "6iu5", "input": "6iu5/6iu5_VIT1_MBD_Zn/peak/peak_000001.cbf", "ref": {"sg": "P 31", "sgno": 144, "cell": [84.942, 84.942, 98.19, 90.0, 90.0, 120.0], "dmin": 2.25}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
|
|
{"id": "6iu6", "input": "6iu6/6iu6_VIT1_MBD_Ni/peak/peak_000001.cbf", "ref": {"sg": "P 31", "sgno": 144, "cell": [84.744, 84.744, 97.398, 90.0, 90.0, 120.0], "dmin": 2.9}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
|
|
{"id": "6iu8", "input": "6iu8/6iu8_VIT1_MBD_Co/low/low_000001.cbf", "ref": {"sg": "P 31", "sgno": 144, "cell": [85.503, 85.503, 98.355, 90.0, 90.0, 120.0], "dmin": 2.7}, "tags": ["cbf", "trigonal"]},
|
|
{"id": "6iu9", "input": "6iu9/6iu9_VIT1_MBD_Fe/peak/data01_000001.cbf", "ref": {"sg": "P 31", "sgno": 144, "cell": [85.321, 85.321, 97.573, 90.0, 90.0, 120.0], "dmin": 3.0}, "pinned": true, "tags": ["cbf", "trigonal", "twin"]},
|
|
{"id": "6jgi", "input": "6jgi/6jgi/data/00001.img", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.857, 62.403, 69.172, 90.0, 90.0, 90.0], "dmin": 0.85}, "tags": ["marCCD", "orthorhombic"]},
|
|
{"id": "6jgj", "input": "6jgj/6jgj/data/000001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [50.87, 62.34, 68.85, 90.0, 90.0, 90.0], "dmin": 0.77}, "tags": ["cbf", "orthorhombic", "cdte"]},
|
|
{"id": "6moj", "input": "6moj/A9_1_00001.cbf", "ref": {"sg": "I 41 2 2", "sgno": 98, "cell": [130.418, 130.418, 293.453, 90.0, 90.0, 90.0], "dmin": 2.431}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "6o2h", "input": "6o2h/lys_nitr_10_1_0001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [27.424, 32.134, 34.513, 88.657, 108.46, 111.877], "dmin": 1.212}, "tags": ["cbf", "triclinic", "diffuse"]},
|
|
{"id": "6oel", "input": "6oel/1449-8_3_001.img", "ref": {"sg": "F 41 3 2", "sgno": 210, "cell": [328.1, 328.1, 328.1, 90.0, 90.0, 90.0], "dmin": 3.1}, "tags": ["SMV", "cubic"], "tiers": {"smoke": "SMV reader (ADSC), cubic F4132"}},
|
|
{"id": "6p8p", "input": "6p8p/14_12_1_0001.cbf", "ref": {"sg": "P 4", "sgno": 75, "cell": [97.525, 97.525, 60.134, 90.0, 90.0, 90.0], "dmin": 1.635}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "6pb3", "input": "6pb3/14_16_1_000001.cbf", "ref": {"sg": "P 6", "sgno": 168, "cell": [100.436, 100.436, 48.86, 90.0, 90.0, 120.0], "dmin": 2.048}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "6pxb", "input": "6pxb/TJB1_3_rachel_1_0001.cbf", "ref": {"sg": "P 32", "sgno": 145, "cell": [64.021, 64.021, 119.447, 90.0, 90.0, 120.0], "dmin": 1.747}, "tags": ["cbf", "trigonal"]},
|
|
{"id": "6pxc", "input": "6pxc/TJB6_1_Rachel_1_0001.cbf", "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [44.19, 64.827, 87.239, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6r72", "input": "6r72/V-CK63-8-ld_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [117.805, 110.754, 155.615, 90.0, 93.23, 90.0], "dmin": 3.95}, "pinned": true, "tags": ["h5", "monoclinic"]},
|
|
{"id": "6rlr", "input": "6rlr/_b4_1_master.h5", "ref": {"sg": "P 1", "sgno": 1, "cell": [39.986, 39.998, 63.643, 80.39, 76.29, 68.15], "dmin": 2.0}, "tags": ["h5", "triclinic", "twin"]},
|
|
{"id": "6toc", "input": "6toc/zenodo/dts_1_00001.cbf", "ref": {"sg": "P 42", "sgno": 77, "cell": [31.523, 31.523, 81.599, 90.0, 90.0, 90.0], "dmin": 1.853}, "tags": ["cbf", "tetragonal", "twin"]},
|
|
{"id": "6ttn", "input": "6ttn/6ttn/data/H6H_33_01_hyo_full_1_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [39.894, 79.841, 104.701, 90.0, 90.0, 90.0], "dmin": 1.12}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6u7g", "input": "6u7g/6u7g/data/SNB02_11_8_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [99.555, 98.682, 147.525, 90.0, 104.6, 90.0], "dmin": 2.35}, "pinned": true, "tags": ["h5", "monoclinic"]},
|
|
{"id": "6ukf", "input": "6ukf/6ukf/data/XDC-7_Pn6_000001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [61.018, 37.317, 69.027, 90.0, 109.768, 90.0], "dmin": 1.0}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "6vww", "input": "6vww/IDP51000_6vww/data/m4H11g_00001.cbf", "ref": {"sg": "P 63", "sgno": 173, "cell": [150.539, 150.539, 111.31, 90.0, 90.0, 120.0], "dmin": 2.2}, "tags": ["cbf", "hexagonal", "twin"], "tiers": {"smoke": "merohedral twin, P63"}},
|
|
{"id": "6w4h", "input": "6w4h/IDP51000_6W4H/data/idp51000-201-a_1_2_3.001", "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [167.74, 167.74, 51.942, 90.0, 90.0, 120.0], "dmin": 1.8}, "tags": ["marCCD", "trigonal"]},
|
|
{"id": "6wzo", "input": "6wzo/9_1_1_000001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [43.718, 50.061, 69.337, 106.499, 90.094, 97.145], "dmin": 1.42}, "tags": ["cbf", "triclinic"]},
|
|
{"id": "6yqf", "input": "6yqf/6yqf/data/SYCE2TEX12-8_1_0001.cbf", "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [42.67, 59.68, 156.49, 90.0, 90.0, 90.0], "dmin": 3.327}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "6z8o", "input": "6z8o/HASE01-gaKr1_w1_1_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [63.716, 97.022, 121.318, 90.0, 104.656, 90.0], "dmin": 2.2}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "6ze4", "input": "6ze4/806/o8_1_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [93.56, 109.88, 116.11, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["cbf", "orthorhombic"], "tiers": {"smoke": "known hard: P212121 under-called as P21 since rc168"}},
|
|
{"id": "7arr", "input": "7arr/PF4N_04D_w1_1_00001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [30.937, 32.068, 43.087, 114.16, 91.88, 109.86], "dmin": 1.1}, "tags": ["cbf", "triclinic"]},
|
|
{"id": "7atg", "input": "7atg/7atg/data/put-2-2.0s_5_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [17.97, 31.02, 43.86, 90.0, 90.0, 90.0], "dmin": 0.6}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "7bgt", "input": "7bgt/MPMV2243_3_001.img", "ref": {"sg": "P 1", "sgno": 1, "cell": [29.296, 67.618, 69.716, 76.845, 83.875, 83.645], "dmin": 1.93}, "tags": ["marCCD", "triclinic"]},
|
|
{"id": "7brr", "input": "7brr/7brr/data/3C_2_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [55.45, 99.02, 59.583, 90.0, 108.54, 90.0], "dmin": 1.35}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "7dkp", "input": "7dkp/7dkp/data/LOX1-sree-p1a9-1p2_w1_1_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [49.84, 169.451, 49.842, 90.0, 93.51, 90.0], "dmin": 1.45}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "7k1l", "input": "7k1l/IDP52015_7k1l/data/cs1C2eg_00001.cbf", "ref": {"sg": "P 63", "sgno": 173, "cell": [150.83, 150.83, 110.73, 90.0, 90.0, 120.0], "dmin": 2.25}, "tags": ["cbf", "hexagonal"], "tiers": {"smoke": "known hard: screw axis (P6 vs P63)"}},
|
|
{"id": "7kcn", "input": "7kcn/7kcn/data/ttr_hiuase_1_D1_33_00001.cbf", "ref": {"sg": "P 41 2 2", "sgno": 91, "cell": [67.03, 67.03, 116.89, 90.0, 90.0, 90.0], "dmin": 1.46}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "7l6j", "input": "7l6j/7l6j/data/idp97824-102sm-a_1_1_7.001", "ref": {"sg": "I 41 3 2", "sgno": 214, "cell": [171.693, 171.693, 171.693, 90.0, 90.0, 90.0], "dmin": 1.78}, "tags": ["marCCD", "cubic"]},
|
|
{"id": "7l84", "input": "7l84/301_helical_1_0001.cbf", "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [79.344, 79.344, 37.81, 90.0, 90.0, 90.0], "dmin": 1.7}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "7mzt", "input": "7mzt/7mzt/data/BVG2_Pn3_000001.cbf", "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [113.619, 96.989, 108.33, 90.0, 90.0, 90.0], "dmin": 4.07}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "7n0i", "input": "7n0i/8_2_1_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [75.846, 131.557, 140.048, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["cbf", "orthorhombic", "tncs"]},
|
|
{"id": "7n2s", "input": "7n2s/1449-4_1_00001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [83.211, 52.789, 106.291, 90.0, 98.278, 90.0], "dmin": 2.37}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "7orr", "input": "7orr/7orr/data/Nsp10-VT00022_1_master.h5", "ref": {"sg": "I 21 3", "sgno": 199, "cell": [105.88, 105.88, 105.88, 90.0, 90.0, 90.0], "dmin": 1.79}, "tags": ["h5", "cubic"]},
|
|
{"id": "7os3", "input": "7os3/pos2_1/pos2_1_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [78.15, 91.05, 105.84, 90.0, 90.0, 90.0], "dmin": 2.177}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "7ph1", "input": "7ph1/7ph1/data/9_1_0001.cbf", "ref": {"sg": "I 2 2 2", "sgno": 23, "cell": [74.975, 81.289, 124.248, 90.0, 90.0, 90.0], "dmin": 1.18}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "7pq7", "input": "7pq7/7pq7/data/1436_p52_A3_1_1_00001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [120.88, 51.73, 75.54, 90.0, 125.14, 90.0], "dmin": 1.55}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "7qij", "input": "7qij/907/dg046_2_data_1_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [143.46, 324.92, 369.38, 90.0, 90.0, 90.0], "dmin": 4.1}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "7qis", "input": "7qis/7qis/data/Chymo_Dfe_x1_2_0001.cbf", "ref": {"sg": "P 61", "sgno": 169, "cell": [100.269, 100.269, 206.215, 90.0, 90.0, 120.0], "dmin": 1.83}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "7ris", "input": "7ris/7ris/data/GLVase_Ca_we21108b7b_1_2_2.001_master.h5", "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [44.54, 44.54, 189.95, 90.0, 90.0, 120.0], "dmin": 1.72}, "pinned": true, "tags": ["h5", "trigonal"]},
|
|
{"id": "7rji", "input": "7rji/7rji/data/DD3_00000.cbf", "ref": {"sg": "H 3 2", "sgno": 155, "cell": [83.036, 83.036, 124.83, 90.0, 90.0, 120.0], "dmin": 1.71}, "tags": ["cbf", "trigonal"]},
|
|
{"id": "7t5t", "input": "7t5t/A1_2_00001.cbf", "ref": {"sg": "P 42 21 2", "sgno": 94, "cell": [95.309, 95.309, 104.915, 90.0, 90.0, 90.0], "dmin": 1.35}, "pinned": true, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "7tcd", "input": "7tcd/7tcd/data/col_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [138.504, 47.902, 78.068, 90.0, 107.56, 90.0], "dmin": 1.7}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "7yzx", "input": "7yzx/7yzx/data/783-1_1_0001.cbf", "ref": {"sg": "P 63 2 2", "sgno": 182, "cell": [169.42, 169.42, 141.83, 90.0, 90.0, 120.0], "dmin": 1.9}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "8a1a", "input": "8a1a/L1F11v1_8a1a/data/L1-F11-v1_9ly1_D06_01_2_master.h5", "ref": {"sg": "P 65", "sgno": 170, "cell": [191.866, 191.866, 122.409, 90.0, 90.0, 120.0], "dmin": 2.05}, "tags": ["h5", "hexagonal"]},
|
|
{"id": "8agq", "input": "8agq/8agq_zip_8AGQ/data/coll_1_00001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [89.948, 55.447, 54.787, 90.0, 113.55, 90.0], "dmin": 1.093}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "8dqb", "input": "8dqb/KloxA_17380_a_B1-Apo_I23_Form_8dqb/data/PSL-1405_653_master.h5", "ref": {"sg": "I 2 3", "sgno": 197, "cell": [164.124, 164.124, 164.124, 90.0, 90.0, 90.0], "dmin": 2.5}, "tags": ["h5", "cubic"]},
|
|
{"id": "8dyz", "input": "8dyz/lys_1_2_0001.cbf", "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [79.632, 79.632, 38.296, 90.0, 90.0, 90.0], "dmin": 1.272}, "tags": ["cbf", "tetragonal", "diffuse"]},
|
|
{"id": "8dz7", "input": "8dz7/lys_rt_2_38_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [30.486, 56.401, 73.852, 90.0, 90.0, 90.0], "dmin": 1.34}, "tags": ["cbf", "orthorhombic", "diffuse"]},
|
|
{"id": "8egn", "input": "8egn/PsaeA_00137_b_B5-az13643701_8egn/data/FKC8_4_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [71.69, 75.16, 109.79, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "8iya", "input": "8iya/8iya/data/11_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [102.747, 50.077, 109.248, 90.0, 91.754, 90.0], "dmin": 2.43}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "8k1g", "input": "8k1g/8k1g/data/KP02_0001.cbf", "ref": {"sg": "I 4 2 2", "sgno": 97, "cell": [182.01, 182.01, 80.71, 90.0, 90.0, 90.0], "dmin": 2.09}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "8oic", "input": "8oic/8oic/data/_b20_1_master.h5", "ref": {"sg": "P 1", "sgno": 1, "cell": [73.055, 94.665, 120.589, 105.081, 89.959, 93.826], "dmin": 2.8}, "tags": ["h5", "triclinic"]},
|
|
{"id": "8owm", "input": "8owm/p13x4_1_00001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [95.544, 95.629, 95.841, 90.416, 93.59, 117.775], "dmin": 1.7}, "tags": ["cbf", "triclinic"]},
|
|
{"id": "8pqd", "input": "8pqd/8pqd/data/11AT05_w1_1_1_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [59.39, 59.37, 192.89, 90.0, 90.0, 90.0], "dmin": 1.5}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "8qaw", "input": "8qaw/p18x3/p18x3_1_00001.cbf.gz", "ref": {"sg": "H 3", "sgno": 146, "cell": [137.68, 137.68, 265.907, 90.0, 90.0, 120.0], "dmin": 1.55}, "tags": ["cbf", "trigonal", "long-axis"]},
|
|
{"id": "8qj5", "input": "8qj5/8qj5/data/Lcsbc3_1_2_00001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [57.61, 100.63, 77.93, 90.0, 96.06, 90.0], "dmin": 1.63}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "8qq7", "input": "8qq7/cbf/SpNox-Sp49-B3-B_088_1_0001.cbf", "ref": {"sg": "P 64 2 2", "sgno": 181, "cell": [145.967, 145.967, 153.619, 90.0, 90.0, 120.0], "dmin": 3.62}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "8r5r", "input": "8r5r/8r5r/data/D5-33805_1_1_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [91.74, 132.91, 137.5, 90.0, 90.0, 90.0], "dmin": 3.08}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "8rud", "input": "8rud/p08x03_1_00001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [78.066, 91.386, 114.547, 90.0, 96.9, 90.0], "dmin": 2.1}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "8s38", "input": "8s38/MX733_2_00001.cbf", "ref": {"sg": "I 21 21 21", "sgno": 24, "cell": [95.368, 163.1, 219.023, 90.0, 90.0, 90.0], "dmin": 1.89}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "8sa8", "input": "8sa8/KlaeA_00906_a_B1-PLP_8sa8/data/PSL-0412_255_master.h5", "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [87.887, 131.544, 165.363, 90.0, 104.48, 90.0], "dmin": 1.3}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "8sqo", "input": "8sqo/BrabA_00028_a_A1-Mg_8sqo/data/PSL-1801_942_master.h5", "ref": {"sg": "P 4 3 2", "sgno": 207, "cell": [112.91, 112.91, 112.91, 90.0, 90.0, 90.0], "dmin": 1.55}, "tags": ["h5", "cubic"]},
|
|
{"id": "8sqq", "input": "8sqq/BrabA_00028_a_A1-Apo_8sqq/data/PSL-1810_965_master.h5", "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [171.52, 171.52, 171.52, 90.0, 90.0, 90.0], "dmin": 2.25}, "tags": ["h5", "cubic"]},
|
|
{"id": "8sqt", "input": "8sqt/BrabA_00028_a_A1-Fe_8sqt/data/PSL-1812_971_master.h5", "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [170.72, 170.72, 170.72, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["h5", "cubic"]},
|
|
{"id": "8t7r", "input": "8t7r/8t7r/data/GREEN-04_Pn5_000001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [357.076, 259.582, 255.361, 90.0, 133.13, 90.0], "dmin": 3.84}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "8tha", "input": "8tha/1TEL_double_helix_8tha/data/A3_1_00001.cbf", "ref": {"sg": "P 64", "sgno": 172, "cell": [69.16, 69.16, 29.13, 90.0, 90.0, 120.0], "dmin": 1.68}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "8tyy", "input": "8tyy/CPS_2_1_000001.cbf", "ref": {"sg": "F 4 3 2", "sgno": 209, "cell": [214.891, 214.891, 214.891, 90.0, 90.0, 90.0], "dmin": 1.68}, "tags": ["cbf", "cubic"]},
|
|
{"id": "8u0i", "input": "8u0i/8u0i/data/dI-2-05a_4_00001.cbf", "ref": {"sg": "P 43 21 2", "sgno": 96, "cell": [50.317, 50.317, 90.596, 90.0, 90.0, 90.0], "dmin": 1.541}, "tags": ["cbf", "tetragonal"]},
|
|
{"id": "8v4o", "input": "8v4o/CaalA_00629_a_FS11-AMP_8v4o/data/PSL-1602_2180_master.h5", "ref": {"sg": "P 61 2 2", "sgno": 178, "cell": [139.46, 139.46, 544.99, 90.0, 90.0, 120.0], "dmin": 2.7}, "tags": ["h5", "hexagonal"]},
|
|
{"id": "8xbp", "input": "8xbp/8xbp/data/puck2872_3_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [148.29, 50.78, 60.21, 90.0, 92.33, 90.0], "dmin": 1.99}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "8xte", "input": "8xte/1101/G2_1_00001.cbf", "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [208.77, 208.77, 67.22, 90.0, 90.0, 120.0], "dmin": 1.99}, "tags": ["cbf", "trigonal"]},
|
|
{"id": "8xtf", "input": "8xtf/1102/puck03_12_1_master.h5", "ref": {"sg": "H 3 2", "sgno": 155, "cell": [211.75, 211.75, 67.42, 90.0, 90.0, 120.0], "dmin": 2.13}, "tags": ["h5", "trigonal"]},
|
|
{"id": "8xtg", "input": "8xtg/1100/mpag15_1_00001.cbf", "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [199.54, 199.54, 67.15, 90.0, 90.0, 120.0], "dmin": 2.0}, "tags": ["cbf", "trigonal"]},
|
|
{"id": "8y74", "input": "8y74/1_1/1_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [125.782, 76.553, 87.143, 90.0, 92.449, 90.0], "dmin": 1.9}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "8ys9", "input": "8ys9/8YS9_xray-data_8ys9/data/SDS_09_18112_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [71.04, 77.68, 83.16, 90.0, 90.0, 90.0], "dmin": 1.46}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9b22", "input": "9b22/KlpnC_20447_a_B1-AR6-AMP_9b22/data/PSL-1011_1580_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [39.826, 92.659, 57.716, 90.0, 91.68, 90.0], "dmin": 1.3}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9bn8", "input": "9bn8/EscoA_17938_a_AE1-UMA-A1AQS_9bn8/data/PSL-0401_8296_master.h5", "ref": {"sg": "P 41", "sgno": 76, "cell": [65.488, 65.488, 134.764, 90.0, 90.0, 90.0], "dmin": 1.35}, "tags": ["h5", "tetragonal"]},
|
|
{"id": "9c18", "input": "9c18/BLVRB-2_5217_master.h5", "ref": {"sg": "P 1", "sgno": 1, "cell": [41.94, 41.977, 60.212, 84.11, 87.24, 63.66], "dmin": 1.9}, "tags": ["h5", "triclinic"]},
|
|
{"id": "9chw", "input": "9chw/D1.001", "ref": {"sg": "P 61", "sgno": 169, "cell": [98.686, 98.686, 82.062, 90.0, 90.0, 120.0], "dmin": 2.16}, "tags": ["marCCD", "hexagonal"]},
|
|
{"id": "9crw", "input": "9crw/data_9crw/data/Kip3-475-22-2_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [83.96, 104.57, 118.78, 90.0, 93.37, 90.0], "dmin": 2.49}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9e2t", "input": "9e2t/ga026f4b-1_5_00001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [75.499, 78.082, 101.219, 94.63, 103.39, 114.55], "dmin": 2.28}, "tags": ["cbf", "triclinic"]},
|
|
{"id": "9ea5", "input": "9ea5/K4_1_00001.cbf", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [65.868, 73.064, 98.399, 90.0, 108.725, 90.0], "dmin": 2.0}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "9fcg", "input": "9fcg/IBCH-15-p02x06_2_00001.cbf.gz", "ref": {"sg": "P 4", "sgno": 75, "cell": [87.79, 87.79, 35.633, 90.0, 90.0, 90.0], "dmin": 1.54}, "tags": ["cbf", "tetragonal"], "tiers": {"smoke": "cbf.gz reader, pure 4-fold"}},
|
|
{"id": "9fhc", "input": "9fhc/te/te312_2_001.img", "ref": {"sg": "I 2 3", "sgno": 197, "cell": [227.46, 227.46, 227.46, 90.0, 90.0, 90.0], "dmin": 2.2}, "tags": ["marCCD", "cubic"]},
|
|
{"id": "9gdj", "input": "9gdj/slh34_w1_1_1_master.h5", "ref": {"sg": "P 41 21 2", "sgno": 92, "cell": [123.92, 123.92, 126.44, 90.0, 90.0, 90.0], "dmin": 1.47}, "tags": ["h5", "tetragonal", "cdte"]},
|
|
{"id": "9gjx", "input": "9gjx/BlNTR_9gjx/data/SC6_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [76.776, 115.807, 103.807, 90.0, 110.29, 90.0], "dmin": 2.4}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9gqg", "input": "9gqg/MX-2555/FKBP51-MSP500-A-5522-11_1_3094759/FKBP51-MSP500-A-5522-11_1_1_master.h5", "ref": {"sg": "P 32 2 1", "sgno": 154, "cell": [48.157, 48.157, 188.036, 90.0, 90.0, 120.0], "dmin": 2.0}, "tags": ["h5", "trigonal"]},
|
|
{"id": "9hnc", "input": "9hnc/asp_7_00001.cbf", "ref": {"sg": "P 1 2 1", "sgno": 3, "cell": [123.764, 123.645, 187.679, 90.0, 90.063, 90.0], "dmin": 1.879}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "9hs7", "input": "9hs7/9hs7/data/B28X1_1_0001.cbf", "ref": {"sg": "P 65", "sgno": 170, "cell": [65.44, 65.44, 88.77, 90.0, 90.0, 120.0], "dmin": 1.698}, "tags": ["cbf", "hexagonal"]},
|
|
{"id": "9i0a", "input": "9i0a/carm1END468_9i0a_tar_9I0A/data/X151B1_1_master.h5", "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [75.237, 98.676, 208.551, 90.0, 90.0, 90.0], "dmin": 2.22}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9i80", "input": "9i80/20230422-PX1-LecA_RO5-5315-1/LecA-RO5_1_master.h5", "ref": {"sg": "P 41", "sgno": 76, "cell": [81.214, 81.214, 165.029, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["h5", "tetragonal", "twin"]},
|
|
{"id": "9ig7", "input": "9ig7/9IG7/data/KOD-P596-G2_3_00001.cbf", "ref": {"sg": "P 21 21 2", "sgno": 18, "cell": [111.472, 153.471, 69.03, 90.0, 90.0, 90.0], "dmin": 2.6}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "9ih9", "input": "9ih9/run_01_05_datacollection_9IH9/data/design-Xinjian-P1Thro-4_1_5_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [78.758, 133.933, 82.32, 90.0, 101.356, 90.0], "dmin": 1.7}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9jzo", "input": "9jzo/JS_35P2_C3-002_diffraction_files_9JZO/data/JS_35P2_C3-002_0001.cbf", "ref": {"sg": "P 1", "sgno": 1, "cell": [41.63, 43.1, 54.2, 112.97, 90.11, 118.18], "dmin": 1.4}, "tags": ["cbf", "triclinic"], "tiers": {"smoke": "triclinic P1"}},
|
|
{"id": "9khr", "input": "9khr/PfPlrx-DTT-9KHR/data-PfPlrx-DTT-9KHR/ods1467-lp13D1-01001.mccd", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [48.704, 50.31, 78.018, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["marCCD", "orthorhombic"], "tiers": {"smoke": "marCCD reader (.mccd), fast"}},
|
|
{"id": "9mh4", "input": "9mh4/KlaeA_00150_a_B1_9mh4/data/PSL-0501_2719_master.h5", "ref": {"sg": "P 21 3", "sgno": 198, "cell": [138.65, 138.65, 138.65, 90.0, 90.0, 90.0], "dmin": 3.05}, "tags": ["h5", "cubic"]},
|
|
{"id": "9min", "input": "9min/1151/A8_31_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [95.45, 98.54, 155.74, 90.0, 90.0, 90.0], "dmin": 2.05}, "tags": ["cbf", "orthorhombic"], "tiers": {"smoke": "known hard: halved axis"}},
|
|
{"id": "9o0h", "input": "9o0h/3TEL-GG-TNK1-UBA_9o0h/data/E1_1_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [55.15, 65.54, 112.9, 90.0, 90.0, 90.0], "dmin": 2.24}, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "9p7q", "input": "9p7q/9p7q_9P7Q/data/SAMDC_MTA_273_40_00001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [96.978, 45.018, 72.061, 90.0, 105.109, 90.0], "dmin": 2.21}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "9pbb", "input": "9pbb/9pbb_9PBB/data/SAMDC_MTA_293_30_00001.cbf", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [97.418, 45.876, 72.248, 90.0, 104.971, 90.0], "dmin": 2.17}, "pinned": true, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "9q41", "input": "9q41/apoSPDS_1_master.h5", "ref": {"sg": "C 2 2 21", "sgno": 20, "cell": [118.568, 133.704, 82.369, 90.0, 90.0, 90.0], "dmin": 1.95}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9q66", "input": "9q66/PREP_JP417_D8a_12694_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [105.853, 67.294, 158.019, 90.0, 99.109, 90.0], "dmin": 2.01}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9qw8", "input": "9qw8/MX-2555/run_03_datacollection [2023-09-08 22:19:51]/FKBP12BRD4-5519-6-BD1-PPU688_w1_1_1_master.h5", "ref": {"sg": "P 1", "sgno": 1, "cell": [35.648, 35.65, 100.919, 86.458, 84.218, 72.475], "dmin": 1.8}, "tags": ["h5", "triclinic"]},
|
|
{"id": "9rci", "input": "9rci/FEN1-CD029134_A09-3_AD049A-10_1_master.h5", "ref": {"sg": "P 1", "sgno": 1, "cell": [35.869, 39.297, 100.916, 98.3, 90.32, 90.09], "dmin": 1.662}, "tags": ["h5", "triclinic", "tncs"]},
|
|
{"id": "9rcs", "input": "9rcs/760_B7_x1_1_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [70.01, 78.8, 82.34, 90.0, 88.64, 90.0], "dmin": 3.012}, "tags": ["h5", "monoclinic", "cdte"]},
|
|
{"id": "9rp9", "input": "9rp9/data_9RP9/data/TAR148-TAR148_X2_1_master.h5", "ref": {"sg": "C 1 2 1", "sgno": 5, "cell": [73.48, 59.78, 91.67, 90.0, 100.85, 90.0], "dmin": 2.1}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9sl0", "input": "9sl0/wt-1_9sl0/data/design-Yan-HLA-WT-1_1_5_1_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [60.181, 80.201, 111.589, 90.0, 90.0, 90.0], "dmin": 1.6}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9t6s", "input": "9t6s/CadC-AF6586_1_5_1_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [63.004, 64.574, 102.705, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["h5", "orthorhombic", "tncs"]},
|
|
{"id": "9upt", "input": "9upt/Raw data 1A/C12_7_00001.img", "ref": {"sg": "P 6", "sgno": 168, "cell": [158.27, 158.27, 53.962, 90.0, 90.0, 120.0], "dmin": 2.369}, "tags": ["SMV", "hexagonal"]},
|
|
{"id": "9vyb", "input": "9vyb/Antitoxin Phd_9vyb/data/G7-5_4187_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [44.37, 47.76, 48.35, 90.0, 90.0, 90.0], "dmin": 2.12}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9w3y", "input": "9w3y/9w3y/data/collect_01_00001_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [60.75, 69.98, 94.24, 90.0, 90.0, 90.0], "dmin": 1.5}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9yl4", "input": "9yl4/data_MJ4720/UWO0004_06_0001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [95.837, 111.339, 402.967, 90.0, 90.0, 90.0], "dmin": 3.7}, "pinned": true, "tags": ["cbf", "orthorhombic"]},
|
|
{"id": "9yzk", "input": "9yzk/CC1_21_TGGGAAGATACTGGATGAGGT_empty_9yzk/data/run_29_00001.cbf", "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [75.836, 163.022, 192.278, 90.0, 98.614, 90.0], "dmin": 5.1}, "tags": ["cbf", "monoclinic"], "tiers": {"smoke": "I2/C2 setting choice at low resolution"}},
|
|
{"id": "9z44", "input": "9z44/CC1_10_CCCGGCCGG_Cclamp_9z44/data/run_41_00001.cbf", "ref": {"sg": "I 1 2 1", "sgno": 5, "cell": [73.491, 127.653, 141.183, 90.0, 91.984, 90.0], "dmin": 7.2}, "tags": ["cbf", "monoclinic"]},
|
|
{"id": "9z72", "input": "9z72/A7_1_00001.cbf", "ref": {"sg": "P 31 2 1", "sgno": 152, "cell": [59.173, 59.173, 426.203, 90.0, 90.0, 120.0], "dmin": 2.38}, "tags": ["cbf", "trigonal", "long-axis"], "tiers": {"smoke": "long axis c=426 A, at the FFT ceiling"}},
|
|
{"id": "9zlo", "input": "9zlo/ASP0887_09_0114_master.h5", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [38.39, 89.98, 106.97, 90.0, 90.0, 90.0], "dmin": 2.0}, "tags": ["h5", "orthorhombic"]},
|
|
{"id": "9zm0", "input": "9zm0/Atg23ANNS_9zm0_9ZM0/data/SeAtg23_B_10_2115_master.h5", "ref": {"sg": "P 1 21 1", "sgno": 4, "cell": [50.409, 30.101, 91.244, 90.0, 97.146, 90.0], "dmin": 2.1}, "tags": ["h5", "monoclinic"]},
|
|
{"id": "9zmu", "input": "9zmu/BrmeA_18154_a_B2-Apo_9zmu/data/PSL-0613_7518_master.h5", "ref": {"sg": "P 65 2 2", "sgno": 179, "cell": [47.81, 47.81, 492.58, 90.0, 90.0, 120.0], "dmin": 1.98}, "tags": ["h5", "hexagonal"]},
|
|
{"id": "cuhf2", "input": "cuhf2/03_CuHF2pyz2PF6b_P_O/CuHF2pyz2PF6b_P_O_01.nxs", "pinned": true, "tags": ["nxs", "small-molecule"]},
|
|
{"id": "cytidine", "input": "cytidine/20151020-Cytidine-2th-30/fixed-omega--180-phi-scan01_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [13.98, 14.788, 5.119, 90.0, 90.0, 90.0], "dmin": null}, "tags": ["cbf", "orthorhombic", "small-molecule"]},
|
|
{"id": "dnba", "input": "dnba/35dnba_30K_2_04_00001.cbf", "ref": {"sg": "C 1 2/c 1", "sgno": 15, "cell": [20.2635, 8.7575, 9.6697, 90.0, 109.941, 90.0], "dmin": 0.48}, "tags": ["cbf", "monoclinic", "small-molecule"]},
|
|
{"id": "lalanine", "input": "lalanine/pgw240050_01_00001.cbf", "ref": {"sg": "P 21 21 21", "sgno": 19, "cell": [5.7952, 5.933, 12.362, 90.0, 90.0, 90.0], "dmin": null}, "tags": ["cbf", "orthorhombic", "small-molecule"], "tiers": {"smoke": "small molecule, miniCBF"}},
|
|
{"id": "metformin", "input": "metformin/013_Mmetformin_01_master.h5", "ref": {"sg": "P 1 21/c 1", "sgno": 14, "cell": [7.9104, 13.8794, 7.931, 90.0, 114.606, 90.0], "dmin": 0.45}, "tags": ["h5", "monoclinic", "small-molecule"], "tiers": {"smoke": "small molecule, Diamond I19 NXmx master"}},
|
|
{"id": "nidppe", "input": "nidppe/001_NiDppeCl2_01_master.h5", "ref": {"sg": "P 1 21/c 1", "sgno": 14, "cell": [11.2779, 13.3386, 15.8739, 90.0, 98.7953, 90.0], "dmin": 0.77}, "tags": ["h5", "monoclinic", "small-molecule"]}
|
|
]}
|