Jungfraujoch/docs/EXTERNAL_TEST_DATA.md

External test data

Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only ever sees its own detectors is not tested. The datasets below were collected by other people, on detectors and in file formats we do not produce ourselves, and are used here to check that rugnux reads foreign files correctly and reduces them to sensible results. Most were collected at other facilities; a few come from SLS beamlines, where the data are still written by someone else's detector and someone else's acquisition system. Their authors published all of these for exactly this kind of reuse, and this page is where we credit them.

None of these data were collected by us. If you use any of them, cite the dataset DOI in the table below; the repositories themselves are cited in ACKNOWLEDGEMENT.

Where the values come from

• Source is the repository we downloaded from and that repository's own citable DOI for the archive we took. Every DOI on this page was resolved against DataCite before it was written down, and the identity of each dataset was taken from the repository's record for the archive - not from our directory names.
• Beamline, resolution, space group and cell are the values deposited with the PDB entry, read from the RCSB data API. They describe the published experiment. They are not our reprocessing results; no quantity measured by Jungfraujoch appears on this page.
• Detector is read out of the image files themselves - the NXmx /entry/instrument/detector/description or the miniCBF # Detector: header - because the detector named in a PDB entry is often only approximate. Where the two differ, the difference is listed below the table.
• Anything that could not be established from one of those sources is left blank.

Datasets

PDB	Source	Facility / beamline	dmin (Å)	Space group	Unit cell a b c α β γ (Å, °)	Detector (from file)	Title
11IF	IRRMC 10.18430/M311IF	NSLS-II 19-ID	1.51	P 43	51.1 51.1 71.9 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2
36GK	IRRMC 10.18430/M336GK	CLSI 08ID-1	2.28	I 2 2 2	120.6 189.5 199.7 90.0 90.0 90.0	Dectris Eiger 9M	D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain
5F6M	SBGrid 10.15785/sbgrid/201	SSRL BL11-1	1.10	P 21 21 21	54.8 58.5 67.4 90.0 90.0 90.0	PILATUS 6M	Isotropic Trypsin Model for Comparison of Diffuse Scattering
5REO	Zenodo 10.5281/zenodo.3730956	Diamond I04-1	1.88	C 1 2 1	112.4 52.6 44.4 90.0 103.0 90.0	PILATUS 6M-F	PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578
5SRC	IRRMC 10.18430/M35SRC	ALS 8.3.1	1.05	P 43	88.7 88.7 39.2 90.0 90.0 90.0	PILATUS3 6M	PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers
6HV2	IRRMC 10.18430/m36hv2	SLS X06SA	1.71	P 61 2 2	68.9 68.9 133.6 90.0 90.0 120.0	Dectris Eiger 16M	MMP-13 in complex with the peptide IMISF
6JGJ	IRRMC 10.18430/m36jgj	SPring-8 BL41XU	0.77	P 21 21 21	50.9 62.3 68.8 90.0 90.0 90.0	PILATUS3 300K	Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A
6O2H	SBGrid 10.15785/sbgrid/747	CHESS F1	1.21	P 1	27.4 32.1 34.5 88.7 108.5 111.9	PILATUS3 6M	Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset
6R72	Zenodo 10.5281/zenodo.14894181	SOLEIL PROXIMA 2	3.95	P 1 21 1	117.8 110.8 155.6 90.0 93.2 90.0	Dectris Eiger 9M	Crystal structure of BmrA-E504A in an outward-facing conformation
6RLR	Zenodo 10.5281/zenodo.5886687	Diamond I04	2.00	P 1	40.0 40.0 63.6 80.4 76.3 68.2	Eiger 16M	Crystal structure of CD9 large extracellular loop
6TTN	IRRMC 10.18430/m36ttn	BESSY 14.1	1.12	P 21 21 21	39.9 79.8 104.7 90.0 90.0 90.0	PILATUS 6M	N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine
6UKF	IRRMC 10.18430/m36ukf	APS 22-ID	1.00	P 1 21 1	61.0 37.3 69.0 90.0 109.8 90.0	Dectris Eiger 16M	HhaI endonuclease in Complex with DNA at 1 Angstrom Resolution
6YQF	IRRMC 10.18430/m36yqf	Diamond I24	3.33	P 21 21 2	42.7 59.7 156.5 90.0 90.0 90.0	PILATUS3 6M	Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly
6ZE4	SBGrid 10.15785/sbgrid/806	BESSY 14.1	1.60	P 21 21 21	93.6 109.9 116.1 90.0 90.0 90.0	PILATUS 6M	FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide
7ATG	IRRMC 10.18430/m37atg	PETRA III, EMBL c/o DESY P13 (MX1)	0.60	P 21 21 21	18.0 31.0 43.9 90.0 90.0 90.0	PILATUS 6M-F	Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution
7D1M	IRRMC 10.18430/m37brr	SSRF BL17U1	1.35	P 1 21 1	55.5 99.0 59.6 90.0 108.5 90.0	Dectris Eiger 16M	CRYSTAL STRUCTURE OF THE SARS-CoV-2 MAIN PROTEASE COMPLEXED WITH GC376
7DKP	IRRMC 10.18430/M37DKP	ESRF MASSIF-3	1.45	P 1 21 1	49.8 169.5 49.8 90.0 93.5 90.0	Dectris Eiger 4M	Crystal structure of E. coli Grx2 in complex with GSH at 1.45 A resolution
7K1L	IRRMC 10.18430/m37k1l	APS 19-ID	2.25	P 63	150.8 150.8 110.7 90.0 90.0 120.0	PILATUS3 6M	Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate
7KCN	IRRMC 10.18430/m37kcn	LNLS W01B-MX2	1.46	P 41 2 2	67.0 67.0 116.9 90.0 90.0 90.0	PILATUS 2M	Reconstructed ancestor of HIUases and Transthyretins
7MZT	IRRMC 10.18430/m37mzt	APS 22-ID	4.07	P 21 21 2	113.6 97.0 108.3 90.0 90.0 90.0	Dectris Eiger 16M	Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A
7ORR	IRRMC 10.18430/M37ORR	MAX IV BioMAX	1.79	I 21 3	105.9 105.9 105.9 90.0 90.0 90.0	Dectris Eiger 16M	Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022
7PH1	IRRMC 10.18430/M37PH1	BESSY 14.2	1.18	I 2 2 2	75.0 81.3 124.2 90.0 90.0 90.0	PILATUS3 2M	Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid
7PQ7	IRRMC 10.18430/M3.IRRMC.6072	ELETTRA 11.2C	1.55	C 1 2 1	120.9 51.7 75.5 90.0 125.1 90.0	PILATUS 6M	Crystal structure of Campylobacter jejuni DsbA1
7QIJ	SBGrid 10.15785/sbgrid/907	PETRA III, EMBL c/o DESY P13 (MX1)	4.10	P 21 21 21	143.5 324.9 369.4 90.0 90.0 90.0	PILATUS 6M-F	Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY
7QIS	IRRMC 10.18430/M37QIS	BESSY 14.2	1.83	P 61	100.3 100.3 206.2 90.0 90.0 120.0	PILATUS3 2M	CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX
7RIS	IRRMC 10.18430/M37RIS	APS 21-ID-D	1.72	P 32 2 1	44.5 44.5 189.9 90.0 90.0 120.0	Dectris Eiger 9M	Crystal structure of RPA3624, a beta-propeller lactonase from Rhodopseudomonas palustris, with active-site bound phosphate
7RJI	IRRMC 10.18430/M37RJI	LNLS W01B-MX2	1.71	H 3 2	83.0 83.0 124.8 90.0 90.0 120.0	PILATUS 2M	BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid
7TCD	IRRMC 10.18430/m37tcd	SLS X06SA	1.70	C 1 2 1	138.5 47.9 78.1 90.0 107.6 90.0	Dectris Eiger 16M	LOV2-DARPIN fusion: D13
7YZX	IRRMC 10.18430/M37YZX	Diamond I24	1.90	P 63 2 2	169.4 169.4 141.8 90.0 90.0 120.0	PILATUS3 6M	ScpA from Streptococcus pyogenes, D783A mutant.
8A1A	IRRMC 10.18430/M38A1A	SLS X06SA	2.05	P 65	191.9 191.9 122.4 90.0 90.0 120.0	Dectris Eiger 16M	Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct
8AGQ	IRRMC 10.18430/M38AGQ	SLS X06DA	1.09	C 1 2 1	89.9 55.4 54.8 90.0 113.5 90.0	PILATUS 2MF	Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione
8DYZ	SBGrid 10.15785/sbgrid/957	CHESS F1	1.27	P 43 21 2	79.6 79.6 38.3 90.0 90.0 90.0	PILATUS3 6M	Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset
8DZ7	SBGrid 10.15785/sbgrid/958	CHESS F1	1.34	P 21 21 21	30.5 56.4 73.9 90.0 90.0 90.0	PILATUS3 6M	Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset
8EGN	IRRMC 10.18430/M38EGN	CLSI 08B1-1	1.95	P 21 21 21	71.7 75.2 109.8 90.0 90.0 90.0	PILATUS3 6M	Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701
8IYA	IRRMC 10.18430/m38iya	SSRF BL02U1	2.43	C 1 2 1	102.7 50.1 109.2 90.0 91.8 90.0	Dectris EIGER2 Si 9M	Complex of SETDB1-derived peptide bound to UBE2E1
8K1G	IRRMC 10.18430/M38K1G	PAL/PLS 11C	2.09	I 4 2 2	182.0 182.0 80.7 90.0 90.0 90.0	PILATUS3 6M	Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae
8OIC	IRRMC 10.18430/m38oic	Diamond I04	2.80	P 1	73.1 94.7 120.6 105.1 90.0 93.8	Eiger 16M	Trichomonas vaginalis riboside hydrolase (His-tagged)
8PQD	IRRMC 10.18430/m38pqd	ESRF MASSIF-3	1.50	P 21 21 21	59.4 59.4 192.9 90.0 90.0 90.0	Dectris Eiger 4M	c-KIT kinase domain in complex with avapritinib derivative 10
8QQ7	Zenodo 10.5281/zenodo.14901515	ESRF MASSIF-1	3.62	P 64 2 2	146.0 146.0 153.6 90.0 90.0 120.0	PILATUS3 2M	Structure of SpNOX: a Bacterial NADPH oxidase
8R5R	IRRMC 10.18430/m38r5r	ESRF ID23-1	3.08	P 21 21 21	91.7 132.9 137.5 90.0 90.0 90.0	Dectris EIGER2 CdTe 16M	Structure of apo TDO with a bound inhibitor
8SA8	IRRMC 10.18430/M38SA8	NSLS-II 19-ID	1.30	I 1 2 1	87.9 131.5 165.4 90.0 104.5 90.0	Dectris EIGER2 Si 9M	Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form)
8SQQ	IRRMC 10.18430/M38SQQ	NSLS-II 19-ID	2.25	F 4 3 2	171.5 171.5 171.5 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant)
8SQT	IRRMC 10.18430/M38SQT	NSLS-II 19-ID	2.20	F 4 3 2	170.7 170.7 170.7 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant)
8T7R	IRRMC 10.18430/M38T7R	APS 22-ID	3.84	C 1 2 1	357.1 259.6 255.4 90.0 133.1 90.0	Dectris Eiger 16M	Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07
8THA	IRRMC 10.18430/m38tha	SSRL BL9-2	1.68	P 64	69.2 69.2 29.1 90.0 90.0 120.0	PILATUS 6M	1TEL, non-compressed, double-helical crystal form
8U0I	IRRMC 10.18430/m38u0i	ALS 8.2.1	1.54	P 43 21 2	50.3 50.3 90.6 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal structure of PA0012 complexed with cyclic-di-GMP from Pseudomonas aeruginosa
8V4O	IRRMC 10.18430/m38v4o	NSLS-II 19-ID	2.70	P 61 2 2	139.5 139.5 545.0 90.0 90.0 120.0	Dectris EIGER2 Si 9M	Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans
8XBP	IRRMC 10.18430/M38XBP	SOLEIL PROXIMA 1	1.99	C 1 2 1	148.3 50.8 60.2 90.0 92.3 90.0	Dectris Eiger 16M	Crystal structure of AtNATA1 bound to Acetyl CoA
8XTE	SBGrid 10.15785/sbgrid/1101	SSRF BL19U1	1.99	P 32	208.8 208.8 67.2 90.0 90.0 120.0	PILATUS3 6M	Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP
8XTF	SBGrid 10.15785/sbgrid/1102	SSRF BL02U1	2.13	H 3 2	211.8 211.8 67.4 90.0 90.0 120.0	Dectris EIGER2 Si 9M	Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C
8XTG	SBGrid 10.15785/sbgrid/1100	SSRF BL19U1	2.00	P 32	199.5 199.5 67.2 90.0 90.0 120.0		Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA
8YS9	IRRMC 10.18430/M38YS9	PAL/PLS 5C (4A)	1.46	P 21 21 21	71.0 77.7 83.2 90.0 90.0 90.0	Dectris Eiger 9M	Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH
9B22	IRRMC 10.18430/m39b22	NSLS-II 19-ID	1.30	P 1 21 1	39.8 92.7 57.7 90.0 91.7 90.0	Dectris EIGER2 Si 9M	Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound)
9BN8	IRRMC 10.18430/m39bn8	NSLS-II 19-ID	1.35	P 41	65.5 65.5 134.8 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19
9CRW	IRRMC 10.18430/m39crw	CLSI 08ID-1	2.49	P 1 21 1	84.0 104.6 118.8 90.0 93.4 90.0	Dectris Eiger 9M	Crystal structure of the Candida albicans kinesin-8 proximal tail domain
9GJX	IRRMC 10.18430/M39GJX	Diamond I04	2.40	P 1 21 1	76.8 115.8 103.8 90.0 110.3 90.0	Eiger 16M	Bacillus licheniformis nitroreductase
9HS7	IRRMC 10.18430/M39HS7	ALBA XALOC	1.70	P 65	65.4 65.4 88.8 90.0 90.0 120.0	PILATUS3 X 6M	Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER
9I0A	IRRMC 10.18430/M39I0A	SOLEIL PROXIMA 1	2.22	P 21 21 2	75.2 98.7 208.6 90.0 90.0 90.0	Dectris Eiger 16M	CARM1 in complex with arg-aDMA analog
9IG7	IRRMC 10.18430/M39IG7	PETRA III, EMBL c/o DESY P13 (MX1)	2.60	P 21 21 2	111.5 153.5 69.0 90.0 90.0 90.0	Dectris EIGER1 Si 16M	KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides
9IH9	IRRMC 10.18430/M39IH9	ESRF MASSIF-3	1.70	C 1 2 1	78.8 133.9 82.3 90.0 101.4 90.0	Dectris EIGER1 Si 4M	KEAP1 complexed to linear peptide 6
9JZO	IRRMC 10.18430/m39jzo	PAL/PLS 11C	1.40	P 1	41.6 43.1 54.2 113.0 90.1 118.2	PILATUS3 6M	Crystal structure of PHICD111_20024_EAD.
9MH4	IRRMC 10.18430/M39MH4	NSLS-II 19-ID	3.05	P 21 3	138.7 138.7 138.7 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes
9MIN	SBGrid 10.15785/sbgrid/1151	ALS 8.2.1	2.05	P 21 21 21	95.5 98.5 155.7 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Structure of a designed minibinder to NYESO1-A*02:01
9O0H	IRRMC 10.18430/M39O0H	SSRL BL12-2	2.24	P 21 21 21	55.2 65.5 112.9 90.0 90.0 90.0	Dectris EIGER2 Si 16M	The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker
9P7Q	IRRMC 10.18430/M39P7Q	SSRL BL12-1	2.21	C 1 2 1	97.0 45.0 72.1 90.0 105.1 90.0	Dectris EIGER2 Si 16M	273K human S-adenosylmethionine decarboxylase
9PBB	IRRMC 10.18430/M39PBB	SSRL BL12-1	2.17	C 1 2 1	97.4 45.9 72.2 90.0 105.0 90.0	Dectris EIGER2 Si 16M	293K human S-adenosylmethionine decarboxylase
9RP9	IRRMC 10.18430/M39RP9	SOLEIL PROXIMA 1	2.10	C 1 2 1	73.5 59.8 91.7 90.0 100.8 90.0	Dectris Eiger 16M	Crystal structure of mouse pVHL-ElonginB-ElonginC complex
9SL0	IRRMC 10.18430/M39SL0	ESRF MASSIF-1	1.60	P 21 21 21	60.2 80.2 111.6 90.0 90.0 90.0	Dectris EIGER2 Si 9M	Crystal structure of HLA-A0201 in complex with peptide LLWNGPMAV
9VX7	IRRMC 10.18430/M39VX7	PAL/PLS 5C (4A)	4.85	P 64	122.5 122.5 118.9 90.0 90.0 120.0	PILATUS3 6M	Transcription factor
9VYB	IRRMC 10.18430/M39VYB	PAL/PLS 5C (4A)	2.12	P 21 21 21	44.4 47.8 48.4 90.0 90.0 90.0	Dectris Eiger 9M	Antitoxin Phd
9W3Y	IRRMC 10.18430/M39W3Y	Photon Factory BL-1A	1.50	P 21 21 21	60.7 70.0 94.2 90.0 90.0 90.0	Dectris EIGER1 Si 4M	X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6)
9YZK	IRRMC 10.18430/M39YZK	ALS 8.2.2	4.44	I 1 2 1	75.8 163.0 192.3 90.0 98.6 90.0	PILATUS3 S 2M	Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
9Z44	IRRMC 10.18430/M39Z44	ALS 8.2.1	7.20	I 1 2 1	73.5 127.7 141.2 90.0 92.0 90.0	Dectris EIGER2 Si 9M	Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain
9ZLO	Zenodo 10.5281/zenodo.18652652	Australian Synchrotron MX2	2.00	P 21 21 21	38.4 90.0 107.0 90.0 90.0 90.0	Dectris EIGER1 Si 16M	Crystal structure of Proteus mirabilis UreE
9ZM0	IRRMC 10.18430/M39ZM0	NSLS-II 17-ID-1	2.10	P 1 21 1	50.4 30.1 91.2 90.0 97.1 90.0	Dectris EIGER1 Si 9M	Crystal structure of monomeric Atg23
9ZMU	IRRMC 10.18430/M39ZMU	NSLS-II 19-ID	1.98	P 65 2 2	47.8 47.8 492.6 90.0 90.0 120.0	Dectris EIGER2 Si 9M	Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form)
5JVN	IRRMC 10.18430/m35jvn	ESRF ID29	2.90	P 6 2 2	249.4 249.4 84.1 90.0 90.0 120.0	PILATUS3 6M	C3-type pyruvate phosphate dikinase: intermediate state of the swiveling-domain mechanism
5M17	Zenodo 10.5281/zenodo.4300323	Diamond I02	1.03	I 4	108.6 108.6 67.7 90.0 90.0 90.0	PILATUS 6M-F	Structure of the GH99 endo-alpha-mannanase from Bacteroides xylanisolvens
6FID	SBGrid 10.15785/sbgrid/541	ESRF ID30B	2.20	P 21 21 21	59.9 64.1 69.7 90.0 90.0 90.0	PILATUS3 6M	Bovine trypsin solved by S-SAD on ID30B
6FVZ	IRRMC 10.18430/m36fvz	ESRF ID23-2	1.80	C 2 2 2	131.2 222.8 86.5 90.0 90.0 90.0	PILATUS3 X 2M	Crystal structure of human monoamine oxidase B (MAO B) in complex with an inhibitor
6HWJ	SBGrid 10.15785/sbgrid/614	ALBA XALOC	1.98	P 1 21 1	59.8 96.1 80.3 90.0 106.7 90.0	PILATUS 6M	Glucosamine kinase (crystal form A)
6IU8	Zenodo 10.5281/zenodo.2532134	SPring-8 BL41XU	2.70	P 31	85.5 85.5 98.4 90.0 90.0 120.0	PILATUS3 6M	Crystal structure of cytoplasmic metal binding domain with cobalt
6P8P	SBGrid 10.15785/sbgrid/673	APS 24-ID-C	1.64	P 4	97.5 97.5 60.1 90.0 90.0 90.0	PILATUS 6M-F	Structure of P. aeruginosa ATCC27853 HORMA1
6PB3	SBGrid 10.15785/sbgrid/681	APS 24-ID-E	2.05	P 6	100.4 100.4 48.9 90.0 90.0 120.0	Dectris Eiger 16M	Structure of Rhizobiales Trip13
6WZO	SBGrid 10.15785/sbgrid/785	APS 24-ID-E	1.42	P 1	43.7 50.1 69.3 106.5 90.1 97.1	Dectris Eiger 16M	Structure of SARS-CoV-2 Nucleocapsid dimerization domain, P1 form
7ARR	MXRDR 10.18150/EM87YL	PETRA III, EMBL c/o DESY P13 (MX1)	1.10	P 1	30.9 32.1 43.1 114.2 91.9 109.9	PILATUS 6M-F	The de novo designed hybrid alpha/beta-miniprotein
7L84	SBGrid 10.15785/sbgrid/816	APS 24-ID-C	1.60	P 43 21 2	79.3 79.3 37.8 90.0 90.0 90.0	PILATUS 6M-F	Hen Egg White Lysozyme by Native S-SAD at Room Temperature
7OS3	MXRDR 10.18150/74YTYQ	PETRA III, EMBL c/o DESY P13 (MX1)	2.18	P 21 21 21	78.2 91.0 105.8 90.0 90.0 90.0	PILATUS 6M-F	Crystal structure of Rhizobium etli inducible L-asparaginase
8TYY	SBGrid 10.15785/sbgrid/1040	APS 24-ID-E	1.68	F 4 3 2	214.9 214.9 214.9 90.0 90.0 90.0	Dectris Eiger 16M	Structure of a bacterial Ubl-deubiquitinase complex (form 2)
9C18	Zenodo 10.5281/zenodo.11405662	NSLS-II 17-ID-1	1.90	P 1	41.9 42.0 60.2 84.1 87.2 63.7	Dectris EIGER1 Si 9M	Human biliverdin IX beta reductase in complex with NADP
9E2T	SBGrid 10.15785/sbgrid/1148	SSRL BL12-1	2.28	P 1	75.5 78.1 101.2 94.6 103.4 114.5	Dectris EIGER2 Si 16M	Structure of a de novo designed interleukin-21 mimetic complex
9HNC	MXRDR 10.60884/0K7B68	PETRA III, EMBL c/o DESY P13 (MX1)	1.88	P 1 2 1	123.8 123.6 187.7 90.0 90.1 90.0	PILATUS 6M-F	Crystal structure of potassium-independent L-asparaginase
9QW8	ESRF 10.15151/ESRF-DC-2127908021	ESRF ID23-1	1.80	P 1	35.6 35.6 100.9 86.5 84.2 72.5	Dectris EIGER2 CdTe 16M	FKBP12 in complex with bifunctional ligand 1ad
9RCI	Zenodo 10.5281/zenodo.15615368	SOLEIL PROXIMA 2	1.66	P 1	35.9 39.3 100.9 98.3 90.3 90.1	Dectris Eiger 9M	Crystal Structure of Flap Endonuclease FEN1 with Compound 28
8OWM	MXRDR 10.18150/II5MT4	PETRA III, EMBL c/o DESY P13 (MX1)	1.70	P 1	95.5 95.6 95.8 90.4 93.6 117.8	Dectris Eiger 16M	Crystal structure of glutamate dehydrogenase 2 from Arabidopsis thaliana binding Ca, NAD and 2,2-dihydroxyglutarate
—	Zenodo 10.5281/zenodo.1036416	Diamond Light Source I19-1				PILATUS 2M	0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1
—	Zenodo 10.5281/zenodo.14894181					Dectris Eiger 9M	Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation
—	Zenodo 10.5281/zenodo.20041091	Diamond Light Source I19-2				Eiger 2X 4M (CdTe)	Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor
—	Zenodo 10.5281/zenodo.20135265	Diamond Light Source I19-2				Eiger 2X 4M (CdTe)	Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor
—	Zenodo 10.5281/zenodo.6347466	Diamond Light Source I19-2				Eiger 2X 4M (CdTe)	Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source
—	Zenodo 10.5281/zenodo.33555	Diamond Light Source I19-1				PILATUS 2M	Example Cytidine data set from I19-1 at Diamond Light Source
—	Zenodo 10.5281/zenodo.11946282	Diamond Light Source I19				PILATUS 2M	RODIN X-ray Diffraction Data 2360282 (L-alanine)

Seven rows have no PDB code. Six are small-molecule / chemical-crystallography datasets, kept because they exercise short wavelengths, CdTe sensors, fine slicing and non-zero detector 2θ; the seventh is the second collection in the 6R72 Zenodo record, described below. They have no deposited macromolecular values, so those columns are blank, and their titles are the repository record titles verbatim.

Archives that are not a single sweep

Most rows above are a single continuous rotation. Twenty-one archives are not; their layout is read from the image files themselves, from the repository file listings and from the depositors' own description of the record. Where an archive held more than one collection, only one is kept - the repository's project page is not a reliable guide to this, because it describes the project rather than the tarball (7TCD's page lists a 900-frame miniCBF sweep the archive does not contain).

6R72 - two collections on one crystal. The Zenodo record holds two complete 360° sweeps of 3600 × 0.1° frames taken from the same crystal: a helical collection, which produced the deposited structure, and a low-dose collection from a single position, which was not used for a deposition and therefore has no PDB entry. Both are in the table, sharing one DOI; the deposited values belong to the helical collection only. The record also ships the authors' XDS.INP.

The three CHESS depositions - wedges plus a measured background. Each crystal was rotated in 50° wedges of 500 × 0.1° frames and translated between wedges to spread the dose. Each crystal also has a rotation at 1° per frame taken with the crystal translated out of the beam, which the depositors include as a measured background and say can be matched to the diffraction frames by the phi value in the image header.

PDB	Crystals	Wedges per crystal	Background rotation
8DYZ	1	8	360 frames
8DZ7	2	4	200 frames per crystal
6O2H	4	1, 3, 2, 5 - 11 in all	50, 145, 95, 235 frames, one per crystal

Seven IRRMC archives hold more than one collection. In six of them one sweep is kept and the rest were deleted, so a run over the data directory sees a single collection per dataset. 7RIS is the exception: its two sweeps are at different wavelengths and both are kept.

PDB	What the archive holds	Kept
6UKF	two sweeps on one crystal - 960 x 0.25° (240°) and 1440 x 0.25° (360°)	the 360° sweep
7DKP	two complete 360° sweeps on one crystal, 3° apart in ω	the first
9PBB	two overlapping 135° wedges of one crystal, 90 x 1.5° each	the first
8U0I	a 69-frame screening wedge and three 180° sweeps on three crystals	the first 180° sweep
36GK	two 360° sweeps of 1800 x 0.2° at the same geometry	the one the archive and DOI are named for
9CRW	a dose pair on one crystal 37 min apart - 0.025 s at 289 mm, 0.010 s at 276 mm	the 0.025 s sweep, whose 2.5 Å target matches the deposited 2.49 Å
7RIS	two crystals at two wavelengths - 1.53494 Å (Ho derivative) and 1.03329 Å (the deposited native)	both

Ten of the scout archives hold more than one collection. Their layout was read from the image files and repository listings; one sweep is kept for a run over the data directory unless noted.

PDB / dataset	What the archive holds	Kept
5JVN	two 360° sweeps of one crystal, 3600 × 0.1° each (w1_3, w1_4)	the w1_3 sweep
6FID	two 360° sweeps of one crystal, 3600 × 0.1° each	the first
6IU8	a two-wavelength MAD pair, 720 × 0.5° each at 1.605 Å (low remote) and 1.740 Å (peak)	both - the pair is the point
7OS3	four 360° sweeps at λ 2.066 Å, 3600 × 0.1° each, from two crystal positions (pos2_1/2, pos3_1/2)	all four are kept as separate sweep directories pos*/
7L84	two ~720° helical sweeps, 1439 × 0.5° each at λ 1.892 Å, room temperature	the 301_helical_1 sweep
5M17	seven crystals in one tar (5M03/5M17/5MEL/5MC8/5M5D/5M3W/5LYR), one 1800-frame sweep each	only the 5M17 tar was downloaded
cytidine	six scans, three ω and three φ, at 2θ = 30° (I19-1 commissioning)	the 1800-frame φ scan
lalanine	four runs of the RODIN L-alanine deposition at 2θ = 20°	the 900-frame pgw240050_01 run
9E2T	one continuous sweep plus screening images	the 2700-frame sweep
8OWM	three MXRDR zips covering one 1800-frame sweep, plus a processed-data zip	the three sweep zips (proc zip skipped)

Datasets published as Raw Data Letters

Three of the datasets - 6R72, 8QQ7 and 6RLR - were published as IUCrData Raw Data Letters, a format whose purpose is to make raw images citable and re-processable in their own right. The letters describe the collections and the difficulties in them, and are the reference for what the data are:

• V. Zampieri, A. Vermot, M. Thepaut, I. Petit-Hartlein, F. Fieschi, P. Falson and V. Chaptal, "X-ray diffraction images for two membrane protein crystals presenting high anisotropy; the B. subtilis ABC transporter BmrA and the S. pneumoniae NADPH oxidase" (2025), IUCrData 10, x250591 doi:10.1107/S2414314625005917 - covers 6R72 and 8QQ7.
• V. Neviani, M. Lutz, W. Oosterheert, P. Gros and L. Kroon-Batenburg, "Crystal structure of the second extracellular domain of human tetraspanin CD9: twinning and diffuse scattering" (2022), IUCrData 7, x220852 doi:10.1107/S2414314622008525 - covers 6RLR.

The authors of the second letter also published their own reciprocal-space reconstruction of the 6RLR data as a separate Zenodo record, 10.5281/zenodo.6961763.

Detector: image file vs PDB entry

For 94 of the 95 PDB-coded rows both the image file and the PDB entry name a detector. (For 8XTG neither can be compared - the header reads PILATUS XXX, S/N XX-XXX.) The table above uses the file value in every case, because the entry's label is often approximate.

Nine of the 94 genuinely conflict - the two sources name detectors that cannot both be right:

PDB	PDB entry says	Image file says	Conflict
6JGJ	DECTRIS PILATUS3 6M	PILATUS3 300K, S/N 3-0226	model / size
8R5R	DECTRIS PILATUS 6M	Dectris EIGER2 CdTe 16M	model / size
9SL0	DECTRIS PILATUS4 X 4M	Dectris EIGER2 Si 9M	model / size
9VX7	DECTRIS EIGER X 9M	PILATUS3 6M, S/N 60-0133	model / size
7ATG	DECTRIS PILATUS3 S 6M	PILATUS 6M-F, S/N 60-0117-F	generation
9O0H	DECTRIS EIGER X 16M	Dectris EIGER2 Si 16M, S/N D021324	generation
9Z44	DECTRIS EIGER X 9M	Dectris EIGER2 Si 9M, S/N E-18-0131	generation
9HNC	DECTRIS EIGER X 16M	PILATUS 6M-F, S/N 60-0117-F	model / size
6P8P	DECTRIS PILATUS3 S 6M	PILATUS 6M-F, S/N 60-0112-F	generation / size

For 9SL0 the file is decisive and the entry is wrong: 3108 x 3262 pixels of 75 um on 450 um silicon, written by EIGER2 firmware release-2022.1.2, is an EIGER2 9M and not a PILATUS4 4M.

A further 29 differ only in how much they state, which is not a conflict. In 23 the NXmx description gives the model and size but no generation (Dectris Eiger 16M) where the entry names one (DECTRIS EIGER X 16M); in 6 it is the other way round, the miniCBF header naming a generation (PILATUS3 6M) that the entry leaves off (DECTRIS PILATUS 6M) - 6YQF, 7PH1, 7QIS, 7YZX, 8XTE and 9YZK.

Deposited models and structure factors

95 of the 102 datasets have a released PDB entry, and RCSB reports released structure factors (status_code_sf = REL) for every one of them. A merged result from this pipeline can therefore be checked against the deposited model or against the deposited intensities.

Dataset directories whose name is not the PDB code

Directory	PDB code in the table	Why
7brr	7D1M	The IRRMC archive and its DOI are published under 7BRR, which the PDB obsoleted on 2020-10-28 and replaced with 7D1M. The directory and the DOI keep the archive's own name; the deposited values are 7D1M's.

An archive that ships placeholder images

8AGQ's data/ directory contains 30 files named ForBackgroundOnly_000NN.img alongside the 1800-frame sweep. They are not images: each is a 64-byte text file holding a path string. A reader that globs *.img will pick them up, so they are named here rather than silently left.

Datasets with no PDB entry

Dataset	Repository record	Why there is no PDB code
6r72/ld	Zenodo record 10.5281/zenodo.14894181, file prefix V-CK63-8-ld_1_	a second collection in the 6R72 record - a low-dose sweep on the same crystal, not the one the deposited structure was built from
cuhf2	Zenodo record 10.5281/zenodo.6347466	a small-molecule dataset, not a PDB deposition
dnba	Zenodo record 10.5281/zenodo.1036416	a small-molecule dataset, not a PDB deposition
metformin	Zenodo record 10.5281/zenodo.20135265	a small-molecule dataset, not a PDB deposition
nidppe	Zenodo record 10.5281/zenodo.20041091	a small-molecule dataset, not a PDB deposition
cytidine	Zenodo record 10.5281/zenodo.33555	a small-molecule dataset, not a PDB deposition
lalanine	Zenodo record 10.5281/zenodo.11946282	a small-molecule dataset, not a PDB deposition

Five of the six small-molecule sets have a published structure to check a run against. These are reference values from the literature, not results obtained here.

Dataset	Space group	Cell (A, deg)	T	Reference
dnba	C 1 2/c 1 (15)	20.2635 8.7575 9.6697 / 90 109.941 90	30 K	the Zenodo record's own title and the xia2.html the depositors ship inside it, corroborated by COD 4510614/4510615 - Cryst. Growth Des. 13 (2013) 1861-1871 doi:10.1021/cg300906j
metformin	P 1 21/c 1 (14)	7.9104 13.8794 7.9310 / 90 114.606 90	100 K	the hydrochloride, form I; COD 2108029 - Acta Cryst. B73 (2017) 10-22 doi:10.1107/S2052520616017844
nidppe	P 1 21/c 1 (14)	11.2779 13.3386 15.8739 / 90 98.7953 90	150 K	COD 2012031 - Acta Cryst. C57 (2001) 690-693 doi:10.1107/S0108270101003961
cytidine	P 21 21 21 (19)	13.98 14.788 5.119 / 90 90 90	296 K	β-cytidine; COD 2001311 - D. L. Ward, Acta Cryst. C49 (1993) 1789-1792 doi:10.1107/S0108270193003464
lalanine	P 21 21 21 (19)	5.7952 5.933 12.362 / 90 90 90	ambient	COD 2104782 - N. A. Tumanov et al., Acta Cryst. B66 (2010) 458-471 doi:10.1107/S010876811001983X

cuhf2 has no confirmed cell. Its space group is published as P 4/n m m (Phys. Rev. B 81, 064422 (2010) doi:10.1103/PhysRevB.81.064422) but no numeric cell was located, so a run on it can be scored on the space group and not on the cell.

Licences

Each dataset carries the licence of its own deposition, stated on the record page linked above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each record states. None of these data are redistributed with Jungfraujoch; this page only records where they came from.