From 9d3c2787f8844ece595942e226b5cc019dc9c10e Mon Sep 17 00:00:00 2001 From: Filip Leonarski Date: Sat, 29 Aug 2026 21:59:49 +0200 Subject: [PATCH] docs: credit the public diffraction data the pipeline is tested against Jungfraujoch is developed at one facility, so the reader and the reduction pipeline are exercised on data collected elsewhere - other detectors, other file formats, other conventions. That data was collected and published by other people, and until now nothing in the repository said so. NON_SLS_TEST_DATA lists all 51 datasets: the DOI to cite for each, the repository it came from, and the experiment as deposited. Beamline, resolution, space group and cell are the values deposited with the corresponding PDB entry, read from the RCSB data API - not results measured here; no quantity produced by this software appears on the page. The detector is read out of the image file instead, because the detector named in a PDB entry is often only approximate, and the twelve cases where the two disagree are listed rather than silently reconciled. ACKNOWLEDGEMENT gains a section for the repositories themselves, with the IRRMC, SBGrid and Zenodo citations and the PDB citation for the metadata. Every DOI on both pages was resolved before it was written down. Co-Authored-By: Claude Opus 5 (1M context) Claude-Session: https://claude.ai/code/session_01Lc5JG6kJqZoCWaoZ43JGTW --- docs/ACKNOWLEDGEMENT.md | 35 ++++++++++ docs/NON_SLS_TEST_DATA.md | 135 ++++++++++++++++++++++++++++++++++++++ docs/index.rst | 1 + 3 files changed, 171 insertions(+) create mode 100644 docs/NON_SLS_TEST_DATA.md diff --git a/docs/ACKNOWLEDGEMENT.md b/docs/ACKNOWLEDGEMENT.md index 3ee56f9df..fc5fca2a6 100644 --- a/docs/ACKNOWLEDGEMENT.md +++ b/docs/ACKNOWLEDGEMENT.md @@ -23,6 +23,41 @@ over a sorted hit list, resolved by a parallel union-find. traccc is MPL-2.0; se This software uses Viridis, Magma and Inferno colormaps from Matplotlib under its BSD-compatible license +## Public diffraction data used for testing + +Jungfraujoch is developed at the Swiss Light Source, so it is tested against diffraction data +collected at other facilities, on detectors and in file formats we do not produce ourselves. That +data was collected and published by other people. Every dataset used, the DOI to cite for it, and +the deposition it belongs to are listed in [NON_SLS_TEST_DATA](NON_SLS_TEST_DATA.md); we thank the +depositors, and the repositories that make the data findable and citable. + +**[IRRMC](https://proteindiffraction.org/)**, the Integrated Resource for Reproducibility in +Macromolecular Crystallography (Minor lab, University of Virginia), is the source of most of them. +IRRMC releases its data under CC0 and asks that the DOI of the dataset be cited; those DOIs are in +the table. M. Grabowski, K. M. Langner, M. Cymborowski, P. J. Porebski, P. Sroka, H. Zheng, +D. R. Cooper, M. D. Zimmerman, M.-A. Elsliger, S. K. Burley and W. Minor, "A public database of +macromolecular diffraction experiments" (2016), Acta Cryst. D72, 1181-1193 +[doi:10.1107/S2059798316014716](https://doi.org/10.1107/S2059798316014716); M. Grabowski, +M. Cymborowski, P. J. Porebski, T. Osinski, I. G. Shabalin, D. R. Cooper and W. Minor, "The +Integrated Resource for Reproducibility in Macromolecular Crystallography: Experiences of the first +four years" (2019), Struct. Dyn. 6, 064301 +[doi:10.1063/1.5128672](https://doi.org/10.1063/1.5128672). + +**[SBGrid Data Bank](https://data.sbgrid.org/)** supplied five of the datasets. P. A. Meyer, +S. Socias, J. Key, E. Ransey, E. C. Tjon, A. Buschiazzo et al., "Data publication with the +structural biology data grid supports live analysis" (2016), Nat. Commun. 7, 10882 +[doi:10.1038/ncomms10882](https://doi.org/10.1038/ncomms10882). + +**[Zenodo](https://zenodo.org/)** hosts seven, deposited there directly by the groups that +collected them. European Organization for Nuclear Research and OpenAIRE, "Zenodo" (2013), CERN +[doi:10.25495/7GXK-RD71](https://doi.org/10.25495/7GXK-RD71). + +The beamline, resolution, space group and unit cell quoted for each dataset are the values +deposited with the corresponding PDB entry, read from the RCSB PDB data API. H. M. Berman, +J. Westbrook, Z. Feng, G. Gilliland, T. N. Bhat, H. Weissig, I. N. Shindyalov and P. E. Bourne, +"The Protein Data Bank" (2000), Nucleic Acids Res. 28, 235-242 +[doi:10.1093/nar/28.1.235](https://doi.org/10.1093/nar/28.1.235). + ## Crystallographic methods adopted from other packages The analysis pipeline reimplements methods first published, and in most cases first implemented, by diff --git a/docs/NON_SLS_TEST_DATA.md b/docs/NON_SLS_TEST_DATA.md new file mode 100644 index 000000000..df36acda0 --- /dev/null +++ b/docs/NON_SLS_TEST_DATA.md @@ -0,0 +1,135 @@ +# Non-SLS test data + +Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only +ever sees one facility's detectors is not tested. The datasets below were collected elsewhere, +on detectors and in file formats we do not produce ourselves, and are used here to check that +`rugnux` reads foreign files correctly and reduces them to sensible results. Their authors +published them for exactly this kind of reuse, and this page is where we credit them. + +**None of these data were collected by us.** If you use any of them, cite the dataset DOI in +the table below; the repositories themselves are cited in +[ACKNOWLEDGEMENT](ACKNOWLEDGEMENT.md). + +## Where the values come from + +- **Source** is the repository we downloaded from and that repository's own citable DOI for + the archive we took. Every DOI on this page was resolved against DataCite before it was + written down, and the identity of each dataset was taken from the repository's record for + the archive - not from our directory names. +- **Beamline, resolution, space group and cell are the values deposited with the PDB entry**, + read from the RCSB data API. They describe the published experiment. They are *not* our + reprocessing results; no quantity measured by Jungfraujoch appears on this page. +- **Detector is read out of the image files themselves** - the NXmx + `/entry/instrument/detector/description` or the miniCBF `# Detector:` header - because the + detector named in a PDB entry is often only approximate. Where the two differ, the + difference is listed below the table. +- Anything that could not be established from one of those sources is left blank. + +## Datasets + +| PDB | Source | Facility / beamline | dmin (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title | +|---|---|---|---|---|---|---|---| +| [11IF](https://www.rcsb.org/structure/11IF) | IRRMC [10.18430/M311IF](https://doi.org/10.18430/M311IF) | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 | +| [5REO](https://www.rcsb.org/structure/5REO) | Zenodo [10.5281/zenodo.3730956](https://doi.org/10.5281/zenodo.3730956) | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 | +| [5SRC](https://www.rcsb.org/structure/5SRC) | IRRMC [10.18430/M35SRC](https://doi.org/10.18430/M35SRC) | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers | +| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A | +| [6LEO](https://www.rcsb.org/structure/6LEO) | Zenodo [10.5281/zenodo.4003042](https://doi.org/10.5281/zenodo.4003042) | SPring-8 BL32XU | 2.52 | C 2 2 21 | 73.5 95.3 101.4 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of thiosulfate transporter YeeE from Spirochaeta thermophila | +| [6TTN](https://www.rcsb.org/structure/6TTN) | IRRMC [10.18430/m36ttn](https://doi.org/10.18430/m36ttn) | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine | +| [6YQF](https://www.rcsb.org/structure/6YQF) | IRRMC [10.18430/m36yqf](https://doi.org/10.18430/m36yqf) | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly | +| [6ZE4](https://www.rcsb.org/structure/6ZE4) | SBGrid [10.15785/sbgrid/806](https://doi.org/10.15785/sbgrid/806) | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide | +| [7ATG](https://www.rcsb.org/structure/7ATG) | IRRMC [10.18430/m37atg](https://doi.org/10.18430/m37atg) | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution | +| [7K1L](https://www.rcsb.org/structure/7K1L) | IRRMC [10.18430/m37k1l](https://doi.org/10.18430/m37k1l) | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate | +| [7KCN](https://www.rcsb.org/structure/7KCN) | IRRMC [10.18430/m37kcn](https://doi.org/10.18430/m37kcn) | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins | +| [7MZT](https://www.rcsb.org/structure/7MZT) | IRRMC [10.18430/m37mzt](https://doi.org/10.18430/m37mzt) | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A | +| [7ORR](https://www.rcsb.org/structure/7ORR) | IRRMC [10.18430/M37ORR](https://doi.org/10.18430/M37ORR) | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 | +| [7PH1](https://www.rcsb.org/structure/7PH1) | IRRMC [10.18430/M37PH1](https://doi.org/10.18430/M37PH1) | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid | +| [7PQ7](https://www.rcsb.org/structure/7PQ7) | IRRMC [10.18430/M3.IRRMC.6072](https://doi.org/10.18430/M3.IRRMC.6072) | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 | +| [7QIS](https://www.rcsb.org/structure/7QIS) | IRRMC [10.18430/M37QIS](https://doi.org/10.18430/M37QIS) | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX | +| [7RJI](https://www.rcsb.org/structure/7RJI) | IRRMC [10.18430/M37RJI](https://doi.org/10.18430/M37RJI) | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid | +| [7YZX](https://www.rcsb.org/structure/7YZX) | IRRMC [10.18430/M37YZX](https://doi.org/10.18430/M37YZX) | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. | +| [8EGN](https://www.rcsb.org/structure/8EGN) | IRRMC [10.18430/M38EGN](https://doi.org/10.18430/M38EGN) | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 | +| [8K1G](https://www.rcsb.org/structure/8K1G) | IRRMC [10.18430/M38K1G](https://doi.org/10.18430/M38K1G) | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae | +| [8R5R](https://www.rcsb.org/structure/8R5R) | IRRMC [10.18430/m38r5r](https://doi.org/10.18430/m38r5r) | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor | +| [8SA8](https://www.rcsb.org/structure/8SA8) | IRRMC [10.18430/M38SA8](https://doi.org/10.18430/M38SA8) | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) | +| [8SQQ](https://www.rcsb.org/structure/8SQQ) | IRRMC [10.18430/M38SQQ](https://doi.org/10.18430/M38SQQ) | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) | +| [8SQT](https://www.rcsb.org/structure/8SQT) | IRRMC [10.18430/M38SQT](https://doi.org/10.18430/M38SQT) | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) | +| [8T7R](https://www.rcsb.org/structure/8T7R) | IRRMC [10.18430/M38T7R](https://doi.org/10.18430/M38T7R) | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 | +| [8THA](https://www.rcsb.org/structure/8THA) | IRRMC [10.18430/m38tha](https://doi.org/10.18430/m38tha) | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form | +| [8V4O](https://www.rcsb.org/structure/8V4O) | IRRMC [10.18430/m38v4o](https://doi.org/10.18430/m38v4o) | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans | +| [8XTE](https://www.rcsb.org/structure/8XTE) | SBGrid [10.15785/sbgrid/1101](https://doi.org/10.15785/sbgrid/1101) | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP | +| [8XTF](https://www.rcsb.org/structure/8XTF) | SBGrid [10.15785/sbgrid/1102](https://doi.org/10.15785/sbgrid/1102) | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C | +| [8XTG](https://www.rcsb.org/structure/8XTG) | SBGrid [10.15785/sbgrid/1100](https://doi.org/10.15785/sbgrid/1100) | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA | +| [8YS9](https://www.rcsb.org/structure/8YS9) | IRRMC [10.18430/M38YS9](https://doi.org/10.18430/M38YS9) | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH | +| [9B22](https://www.rcsb.org/structure/9B22) | IRRMC [10.18430/m39b22](https://doi.org/10.18430/m39b22) | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) | +| [9BN8](https://www.rcsb.org/structure/9BN8) | IRRMC [10.18430/m39bn8](https://doi.org/10.18430/m39bn8) | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 | +| [9HS7](https://www.rcsb.org/structure/9HS7) | IRRMC [10.18430/M39HS7](https://doi.org/10.18430/M39HS7) | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER | +| [9JZO](https://www.rcsb.org/structure/9JZO) | IRRMC [10.18430/m39jzo](https://doi.org/10.18430/m39jzo) | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. | +| [9MH4](https://www.rcsb.org/structure/9MH4) | IRRMC [10.18430/M39MH4](https://doi.org/10.18430/M39MH4) | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes | +| [9MIN](https://www.rcsb.org/structure/9MIN) | SBGrid [10.15785/sbgrid/1151](https://doi.org/10.15785/sbgrid/1151) | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 | +| [9O0H](https://www.rcsb.org/structure/9O0H) | IRRMC [10.18430/M39O0H](https://doi.org/10.18430/M39O0H) | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker | +| [9RP9](https://www.rcsb.org/structure/9RP9) | IRRMC [10.18430/M39RP9](https://doi.org/10.18430/M39RP9) | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex | +| [9VX7](https://www.rcsb.org/structure/9VX7) | IRRMC [10.18430/M39VX7](https://doi.org/10.18430/M39VX7) | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor | +| [9VYB](https://www.rcsb.org/structure/9VYB) | IRRMC [10.18430/M39VYB](https://doi.org/10.18430/M39VYB) | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd | +| [9W3Y](https://www.rcsb.org/structure/9W3Y) | IRRMC [10.18430/M39W3Y](https://doi.org/10.18430/M39W3Y) | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) | +| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | +| [9Z44](https://www.rcsb.org/structure/9Z44) | IRRMC [10.18430/M39Z44](https://doi.org/10.18430/M39Z44) | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain | +| [9ZLO](https://www.rcsb.org/structure/9ZLO) | Zenodo [10.5281/zenodo.18652652](https://doi.org/10.5281/zenodo.18652652) | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE | +| [9ZMU](https://www.rcsb.org/structure/9ZMU) | IRRMC [10.18430/M39ZMU](https://doi.org/10.18430/M39ZMU) | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) | +| — | IRRMC [10.18430/M3.IRRMC.6753](https://doi.org/10.18430/M3.IRRMC.6753) | | | | | PILATUS 6MF | C-phycocyanin as a highly attractive model system in protein crystallography: unique crystallization properties and packing-diversity screening | +| — | Zenodo [10.5281/zenodo.6347466](https://doi.org/10.5281/zenodo.6347466) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source | +| — | Zenodo [10.5281/zenodo.1036416](https://doi.org/10.5281/zenodo.1036416) | Diamond Light Source I19-1 | | | | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 | +| — | Zenodo [10.5281/zenodo.20135265](https://doi.org/10.5281/zenodo.20135265) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | +| — | Zenodo [10.5281/zenodo.20041091](https://doi.org/10.5281/zenodo.20041091) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | + +The last rows have no PDB code. Four are small-molecule / chemical-crystallography datasets, +kept because they exercise short wavelengths, CdTe sensors and fine slicing; one is a protein +dataset whose IRRMC record names no PDB entry. They have no deposited macromolecular values, +so those columns are blank, and their titles are the repository record titles verbatim. + +## Detector: image file vs PDB entry + +For 45 datasets both the image file and the PDB entry name a detector that can be read as a +(model, generation, size). **12 of those 45 disagree** - 3 on the model or the size, and 9 +only because the PDB entry omits the detector generation. The table above uses the file value +in every case. + +| PDB | PDB entry says | Image file says | Difference | +|---|---|---|---| +| 6JGJ | DECTRIS PILATUS3 6M | PILATUS3 300K, S/N 3-0226 | model / size | +| 6YQF | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0119 | generation only | +| 7ATG | DECTRIS PILATUS3 S 6M | PILATUS 6M-F, S/N 60-0117-F | generation only | +| 7PH1 | DECTRIS PILATUS 2M | PILATUS3 2M, S/N 24-0124 | generation only | +| 7QIS | DECTRIS PILATUS 2M | PILATUS3 2M, S/N 24-0124 | generation only | +| 7YZX | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0119 | generation only | +| 8R5R | DECTRIS PILATUS 6M | Dectris EIGER2 CdTe 16M | model / size | +| 8XTE | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0124 | generation only | +| 9O0H | DECTRIS EIGER X 16M | Dectris EIGER2 Si 16M, S/N D021324 | generation only | +| 9VX7 | DECTRIS EIGER X 9M | PILATUS3 6M, S/N 60-0133 | model / size | +| 9YZK | DECTRIS PILATUS 2M | PILATUS3 S_2M, SN 24-0173 | generation only | +| 9Z44 | DECTRIS EIGER X 9M | Dectris EIGER2 Si 9M, S/N E-18-0131 | generation only | + +The detector could not be read from the file for 8XTG (header reads `PILATUS XXX, S/N XX-XXX`). + +## Deposited models and structure factors + +46 of the 51 datasets have a released PDB entry, and RCSB reports released structure factors +(`status_code_sf = REL`) for all of them. A merged result from this pipeline can therefore be checked +against the deposited model or against the deposited intensities. + +## Datasets with no PDB entry + +| Dataset | Repository record | Why there is no PDB code | +|---|---|---| +| `8agq` | IRRMC project page Phyco_JCSG_a3 | IRRMC's own project record for this archive names no PDB entry | +| `cuhf2` | Zenodo record 10.5281/zenodo.6347466 | a small-molecule dataset, not a PDB deposition | +| `dnba` | Zenodo record 10.5281/zenodo.1036416 | a small-molecule dataset, not a PDB deposition | +| `metformin` | Zenodo record 10.5281/zenodo.20135265 | a small-molecule dataset, not a PDB deposition | +| `nidppe` | Zenodo record 10.5281/zenodo.20041091 | a small-molecule dataset, not a PDB deposition | + +## Licences + +Each dataset carries the licence of its own deposition, stated on the record page linked +above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's +own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each +record states. None of these data are redistributed with Jungfraujoch; this page only records +where they came from. diff --git a/docs/index.rst b/docs/index.rst index f0504f351..3c79a8612 100644 --- a/docs/index.rst +++ b/docs/index.rst @@ -16,6 +16,7 @@ Jungfraujoch is distributed under the GPLv3 license. :caption: General ACKNOWLEDGEMENT + NON_SLS_TEST_DATA LICENSE THIRD_PARTY_NOTICES DETECTORS