diff --git a/docs/ACKNOWLEDGEMENT.md b/docs/ACKNOWLEDGEMENT.md index 3ee56f9df..fc5fca2a6 100644 --- a/docs/ACKNOWLEDGEMENT.md +++ b/docs/ACKNOWLEDGEMENT.md @@ -23,6 +23,41 @@ over a sorted hit list, resolved by a parallel union-find. traccc is MPL-2.0; se This software uses Viridis, Magma and Inferno colormaps from Matplotlib under its BSD-compatible license +## Public diffraction data used for testing + +Jungfraujoch is developed at the Swiss Light Source, so it is tested against diffraction data +collected at other facilities, on detectors and in file formats we do not produce ourselves. That +data was collected and published by other people. Every dataset used, the DOI to cite for it, and +the deposition it belongs to are listed in [NON_SLS_TEST_DATA](NON_SLS_TEST_DATA.md); we thank the +depositors, and the repositories that make the data findable and citable. + +**[IRRMC](https://proteindiffraction.org/)**, the Integrated Resource for Reproducibility in +Macromolecular Crystallography (Minor lab, University of Virginia), is the source of most of them. +IRRMC releases its data under CC0 and asks that the DOI of the dataset be cited; those DOIs are in +the table. M. Grabowski, K. M. Langner, M. Cymborowski, P. J. Porebski, P. Sroka, H. Zheng, +D. R. Cooper, M. D. Zimmerman, M.-A. Elsliger, S. K. Burley and W. Minor, "A public database of +macromolecular diffraction experiments" (2016), Acta Cryst. D72, 1181-1193 +[doi:10.1107/S2059798316014716](https://doi.org/10.1107/S2059798316014716); M. Grabowski, +M. Cymborowski, P. J. Porebski, T. Osinski, I. G. Shabalin, D. R. Cooper and W. Minor, "The +Integrated Resource for Reproducibility in Macromolecular Crystallography: Experiences of the first +four years" (2019), Struct. Dyn. 6, 064301 +[doi:10.1063/1.5128672](https://doi.org/10.1063/1.5128672). + +**[SBGrid Data Bank](https://data.sbgrid.org/)** supplied five of the datasets. P. A. Meyer, +S. Socias, J. Key, E. Ransey, E. C. Tjon, A. Buschiazzo et al., "Data publication with the +structural biology data grid supports live analysis" (2016), Nat. Commun. 7, 10882 +[doi:10.1038/ncomms10882](https://doi.org/10.1038/ncomms10882). + +**[Zenodo](https://zenodo.org/)** hosts seven, deposited there directly by the groups that +collected them. European Organization for Nuclear Research and OpenAIRE, "Zenodo" (2013), CERN +[doi:10.25495/7GXK-RD71](https://doi.org/10.25495/7GXK-RD71). + +The beamline, resolution, space group and unit cell quoted for each dataset are the values +deposited with the corresponding PDB entry, read from the RCSB PDB data API. H. M. Berman, +J. Westbrook, Z. Feng, G. Gilliland, T. N. Bhat, H. Weissig, I. N. Shindyalov and P. E. Bourne, +"The Protein Data Bank" (2000), Nucleic Acids Res. 28, 235-242 +[doi:10.1093/nar/28.1.235](https://doi.org/10.1093/nar/28.1.235). + ## Crystallographic methods adopted from other packages The analysis pipeline reimplements methods first published, and in most cases first implemented, by diff --git a/docs/NON_SLS_TEST_DATA.md b/docs/NON_SLS_TEST_DATA.md new file mode 100644 index 000000000..df36acda0 --- /dev/null +++ b/docs/NON_SLS_TEST_DATA.md @@ -0,0 +1,135 @@ +# Non-SLS test data + +Jungfraujoch is developed at the Swiss Light Source, but a data-reduction pipeline that only +ever sees one facility's detectors is not tested. The datasets below were collected elsewhere, +on detectors and in file formats we do not produce ourselves, and are used here to check that +`rugnux` reads foreign files correctly and reduces them to sensible results. Their authors +published them for exactly this kind of reuse, and this page is where we credit them. + +**None of these data were collected by us.** If you use any of them, cite the dataset DOI in +the table below; the repositories themselves are cited in +[ACKNOWLEDGEMENT](ACKNOWLEDGEMENT.md). + +## Where the values come from + +- **Source** is the repository we downloaded from and that repository's own citable DOI for + the archive we took. Every DOI on this page was resolved against DataCite before it was + written down, and the identity of each dataset was taken from the repository's record for + the archive - not from our directory names. +- **Beamline, resolution, space group and cell are the values deposited with the PDB entry**, + read from the RCSB data API. They describe the published experiment. They are *not* our + reprocessing results; no quantity measured by Jungfraujoch appears on this page. +- **Detector is read out of the image files themselves** - the NXmx + `/entry/instrument/detector/description` or the miniCBF `# Detector:` header - because the + detector named in a PDB entry is often only approximate. Where the two differ, the + difference is listed below the table. +- Anything that could not be established from one of those sources is left blank. + +## Datasets + +| PDB | Source | Facility / beamline | dmin (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title | +|---|---|---|---|---|---|---|---| +| [11IF](https://www.rcsb.org/structure/11IF) | IRRMC [10.18430/M311IF](https://doi.org/10.18430/M311IF) | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 | +| [5REO](https://www.rcsb.org/structure/5REO) | Zenodo [10.5281/zenodo.3730956](https://doi.org/10.5281/zenodo.3730956) | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 | +| [5SRC](https://www.rcsb.org/structure/5SRC) | IRRMC [10.18430/M35SRC](https://doi.org/10.18430/M35SRC) | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers | +| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A | +| [6LEO](https://www.rcsb.org/structure/6LEO) | Zenodo [10.5281/zenodo.4003042](https://doi.org/10.5281/zenodo.4003042) | SPring-8 BL32XU | 2.52 | C 2 2 21 | 73.5 95.3 101.4 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of thiosulfate transporter YeeE from Spirochaeta thermophila | +| [6TTN](https://www.rcsb.org/structure/6TTN) | IRRMC [10.18430/m36ttn](https://doi.org/10.18430/m36ttn) | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine | +| [6YQF](https://www.rcsb.org/structure/6YQF) | IRRMC [10.18430/m36yqf](https://doi.org/10.18430/m36yqf) | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly | +| [6ZE4](https://www.rcsb.org/structure/6ZE4) | SBGrid [10.15785/sbgrid/806](https://doi.org/10.15785/sbgrid/806) | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide | +| [7ATG](https://www.rcsb.org/structure/7ATG) | IRRMC [10.18430/m37atg](https://doi.org/10.18430/m37atg) | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution | +| [7K1L](https://www.rcsb.org/structure/7K1L) | IRRMC [10.18430/m37k1l](https://doi.org/10.18430/m37k1l) | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate | +| [7KCN](https://www.rcsb.org/structure/7KCN) | IRRMC [10.18430/m37kcn](https://doi.org/10.18430/m37kcn) | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins | +| [7MZT](https://www.rcsb.org/structure/7MZT) | IRRMC [10.18430/m37mzt](https://doi.org/10.18430/m37mzt) | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A | +| [7ORR](https://www.rcsb.org/structure/7ORR) | IRRMC [10.18430/M37ORR](https://doi.org/10.18430/M37ORR) | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 | +| [7PH1](https://www.rcsb.org/structure/7PH1) | IRRMC [10.18430/M37PH1](https://doi.org/10.18430/M37PH1) | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid | +| [7PQ7](https://www.rcsb.org/structure/7PQ7) | IRRMC [10.18430/M3.IRRMC.6072](https://doi.org/10.18430/M3.IRRMC.6072) | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 | +| [7QIS](https://www.rcsb.org/structure/7QIS) | IRRMC [10.18430/M37QIS](https://doi.org/10.18430/M37QIS) | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX | +| [7RJI](https://www.rcsb.org/structure/7RJI) | IRRMC [10.18430/M37RJI](https://doi.org/10.18430/M37RJI) | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid | +| [7YZX](https://www.rcsb.org/structure/7YZX) | IRRMC [10.18430/M37YZX](https://doi.org/10.18430/M37YZX) | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. | +| [8EGN](https://www.rcsb.org/structure/8EGN) | IRRMC [10.18430/M38EGN](https://doi.org/10.18430/M38EGN) | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 | +| [8K1G](https://www.rcsb.org/structure/8K1G) | IRRMC [10.18430/M38K1G](https://doi.org/10.18430/M38K1G) | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae | +| [8R5R](https://www.rcsb.org/structure/8R5R) | IRRMC [10.18430/m38r5r](https://doi.org/10.18430/m38r5r) | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor | +| [8SA8](https://www.rcsb.org/structure/8SA8) | IRRMC [10.18430/M38SA8](https://doi.org/10.18430/M38SA8) | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) | +| [8SQQ](https://www.rcsb.org/structure/8SQQ) | IRRMC [10.18430/M38SQQ](https://doi.org/10.18430/M38SQQ) | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) | +| [8SQT](https://www.rcsb.org/structure/8SQT) | IRRMC [10.18430/M38SQT](https://doi.org/10.18430/M38SQT) | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) | +| [8T7R](https://www.rcsb.org/structure/8T7R) | IRRMC [10.18430/M38T7R](https://doi.org/10.18430/M38T7R) | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 | +| [8THA](https://www.rcsb.org/structure/8THA) | IRRMC [10.18430/m38tha](https://doi.org/10.18430/m38tha) | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form | +| [8V4O](https://www.rcsb.org/structure/8V4O) | IRRMC [10.18430/m38v4o](https://doi.org/10.18430/m38v4o) | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans | +| [8XTE](https://www.rcsb.org/structure/8XTE) | SBGrid [10.15785/sbgrid/1101](https://doi.org/10.15785/sbgrid/1101) | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP | +| [8XTF](https://www.rcsb.org/structure/8XTF) | SBGrid [10.15785/sbgrid/1102](https://doi.org/10.15785/sbgrid/1102) | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C | +| [8XTG](https://www.rcsb.org/structure/8XTG) | SBGrid [10.15785/sbgrid/1100](https://doi.org/10.15785/sbgrid/1100) | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA | +| [8YS9](https://www.rcsb.org/structure/8YS9) | IRRMC [10.18430/M38YS9](https://doi.org/10.18430/M38YS9) | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH | +| [9B22](https://www.rcsb.org/structure/9B22) | IRRMC [10.18430/m39b22](https://doi.org/10.18430/m39b22) | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) | +| [9BN8](https://www.rcsb.org/structure/9BN8) | IRRMC [10.18430/m39bn8](https://doi.org/10.18430/m39bn8) | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 | +| [9HS7](https://www.rcsb.org/structure/9HS7) | IRRMC [10.18430/M39HS7](https://doi.org/10.18430/M39HS7) | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER | +| [9JZO](https://www.rcsb.org/structure/9JZO) | IRRMC [10.18430/m39jzo](https://doi.org/10.18430/m39jzo) | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. | +| [9MH4](https://www.rcsb.org/structure/9MH4) | IRRMC [10.18430/M39MH4](https://doi.org/10.18430/M39MH4) | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes | +| [9MIN](https://www.rcsb.org/structure/9MIN) | SBGrid [10.15785/sbgrid/1151](https://doi.org/10.15785/sbgrid/1151) | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 | +| [9O0H](https://www.rcsb.org/structure/9O0H) | IRRMC [10.18430/M39O0H](https://doi.org/10.18430/M39O0H) | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker | +| [9RP9](https://www.rcsb.org/structure/9RP9) | IRRMC [10.18430/M39RP9](https://doi.org/10.18430/M39RP9) | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex | +| [9VX7](https://www.rcsb.org/structure/9VX7) | IRRMC [10.18430/M39VX7](https://doi.org/10.18430/M39VX7) | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor | +| [9VYB](https://www.rcsb.org/structure/9VYB) | IRRMC [10.18430/M39VYB](https://doi.org/10.18430/M39VYB) | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd | +| [9W3Y](https://www.rcsb.org/structure/9W3Y) | IRRMC [10.18430/M39W3Y](https://doi.org/10.18430/M39W3Y) | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) | +| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | +| [9Z44](https://www.rcsb.org/structure/9Z44) | IRRMC [10.18430/M39Z44](https://doi.org/10.18430/M39Z44) | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain | +| [9ZLO](https://www.rcsb.org/structure/9ZLO) | Zenodo [10.5281/zenodo.18652652](https://doi.org/10.5281/zenodo.18652652) | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE | +| [9ZMU](https://www.rcsb.org/structure/9ZMU) | IRRMC [10.18430/M39ZMU](https://doi.org/10.18430/M39ZMU) | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) | +| — | IRRMC [10.18430/M3.IRRMC.6753](https://doi.org/10.18430/M3.IRRMC.6753) | | | | | PILATUS 6MF | C-phycocyanin as a highly attractive model system in protein crystallography: unique crystallization properties and packing-diversity screening | +| — | Zenodo [10.5281/zenodo.6347466](https://doi.org/10.5281/zenodo.6347466) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source | +| — | Zenodo [10.5281/zenodo.1036416](https://doi.org/10.5281/zenodo.1036416) | Diamond Light Source I19-1 | | | | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 | +| — | Zenodo [10.5281/zenodo.20135265](https://doi.org/10.5281/zenodo.20135265) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | +| — | Zenodo [10.5281/zenodo.20041091](https://doi.org/10.5281/zenodo.20041091) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | + +The last rows have no PDB code. Four are small-molecule / chemical-crystallography datasets, +kept because they exercise short wavelengths, CdTe sensors and fine slicing; one is a protein +dataset whose IRRMC record names no PDB entry. They have no deposited macromolecular values, +so those columns are blank, and their titles are the repository record titles verbatim. + +## Detector: image file vs PDB entry + +For 45 datasets both the image file and the PDB entry name a detector that can be read as a +(model, generation, size). **12 of those 45 disagree** - 3 on the model or the size, and 9 +only because the PDB entry omits the detector generation. The table above uses the file value +in every case. + +| PDB | PDB entry says | Image file says | Difference | +|---|---|---|---| +| 6JGJ | DECTRIS PILATUS3 6M | PILATUS3 300K, S/N 3-0226 | model / size | +| 6YQF | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0119 | generation only | +| 7ATG | DECTRIS PILATUS3 S 6M | PILATUS 6M-F, S/N 60-0117-F | generation only | +| 7PH1 | DECTRIS PILATUS 2M | PILATUS3 2M, S/N 24-0124 | generation only | +| 7QIS | DECTRIS PILATUS 2M | PILATUS3 2M, S/N 24-0124 | generation only | +| 7YZX | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0119 | generation only | +| 8R5R | DECTRIS PILATUS 6M | Dectris EIGER2 CdTe 16M | model / size | +| 8XTE | DECTRIS PILATUS 6M | PILATUS3 6M, S/N 60-0124 | generation only | +| 9O0H | DECTRIS EIGER X 16M | Dectris EIGER2 Si 16M, S/N D021324 | generation only | +| 9VX7 | DECTRIS EIGER X 9M | PILATUS3 6M, S/N 60-0133 | model / size | +| 9YZK | DECTRIS PILATUS 2M | PILATUS3 S_2M, SN 24-0173 | generation only | +| 9Z44 | DECTRIS EIGER X 9M | Dectris EIGER2 Si 9M, S/N E-18-0131 | generation only | + +The detector could not be read from the file for 8XTG (header reads `PILATUS XXX, S/N XX-XXX`). + +## Deposited models and structure factors + +46 of the 51 datasets have a released PDB entry, and RCSB reports released structure factors +(`status_code_sf = REL`) for all of them. A merged result from this pipeline can therefore be checked +against the deposited model or against the deposited intensities. + +## Datasets with no PDB entry + +| Dataset | Repository record | Why there is no PDB code | +|---|---|---| +| `8agq` | IRRMC project page Phyco_JCSG_a3 | IRRMC's own project record for this archive names no PDB entry | +| `cuhf2` | Zenodo record 10.5281/zenodo.6347466 | a small-molecule dataset, not a PDB deposition | +| `dnba` | Zenodo record 10.5281/zenodo.1036416 | a small-molecule dataset, not a PDB deposition | +| `metformin` | Zenodo record 10.5281/zenodo.20135265 | a small-molecule dataset, not a PDB deposition | +| `nidppe` | Zenodo record 10.5281/zenodo.20041091 | a small-molecule dataset, not a PDB deposition | + +## Licences + +Each dataset carries the licence of its own deposition, stated on the record page linked +above. IRRMC and the SBGrid Data Bank both release under CC0 and both ask that the dataset's +own citation - its DOI - be used; the Zenodo records here are CC0 or CC BY 4.0, as each +record states. None of these data are redistributed with Jungfraujoch; this page only records +where they came from. diff --git a/docs/index.rst b/docs/index.rst index f0504f351..3c79a8612 100644 --- a/docs/index.rst +++ b/docs/index.rst @@ -16,6 +16,7 @@ Jungfraujoch is distributed under the GPLv3 license. :caption: General ACKNOWLEDGEMENT + NON_SLS_TEST_DATA LICENSE THIRD_PARTY_NOTICES DETECTORS