From 232e03afa8f1cfd866d740e483bf3b10aebcf69a Mon Sep 17 00:00:00 2001 From: Filip Leonarski Date: Tue, 22 Sep 2026 16:14:38 +0200 Subject: [PATCH] docs: eighteen third-round open-arm sets in EXTERNAL_TEST_DATA; one table sorted by PDB id Adds 5ky6 5mln 5t39 6cdl 6f3p 6g1f 6jgh 6nen 6qaj 6s1u 6w75 6zqr 6zqy 6zr0 7ou1 7raa 9fcf 9h0q in the existing row form: deposited values from RCSB, the detector from the image files, DOIs resolved (6NEN's is a Crossref DOI whose landing page refuses scripted access). New notes: the five screw-free negative controls, the 5KY6 RAR set, the damaged 6ZR0 zip, the hand-downloaded 6NEN archive, two detector conflicts (5MLN, 9H0Q), third-round counts. The table rows, which were grouped by download round, are now sorted by PDB id; the round moves into a Round column, and the prose that referred to "the first 95 rows" or "the last 51 rows" refers to the round instead. Counts updated to 171 datasets / 164 PDB entries (all 18 new entries have released structure factors). Co-Authored-By: Claude Opus 5 (1M context) Claude-Session: https://claude.ai/code/session_013nW6FNRP1bBJJ8pfHiByAT --- docs/EXTERNAL_TEST_DATA.md | 389 +++++++++++++++++++++---------------- 1 file changed, 225 insertions(+), 164 deletions(-) diff --git a/docs/EXTERNAL_TEST_DATA.md b/docs/EXTERNAL_TEST_DATA.md index 1fe70cc10..7b4162fa8 100644 --- a/docs/EXTERNAL_TEST_DATA.md +++ b/docs/EXTERNAL_TEST_DATA.md @@ -15,8 +15,8 @@ the table below; the repositories themselves are cited in ## Where the values come from - **Source** is the repository we downloaded from and that repository's own citable DOI for - the archive we took. Every DOI on this page was resolved against DataCite before it was - written down, and the identity of each dataset was taken from the repository's record for + the archive we took. Every DOI on this page was resolved against DataCite - or, for 6NEN, + whose DOI is registered with Crossref, against Crossref - before it was written down, and the identity of each dataset was taken from the repository's record for the archive - not from our directory names. - **Beamline, resolution, space group and cell are the values deposited with the PDB entry**, read from the RCSB data API. They describe the published experiment. They are *not* our @@ -26,164 +26,185 @@ the table below; the repositories themselves are cited in instrument header or the SMV key block - because the detector named in a PDB entry is often only approximate. Where the two differ, the difference is listed below the table. - Anything that could not be established from one of those sources is left blank. +- **Round** is the scouting round in which the dataset was added: 1 for the first 102 datasets, + 2 for the 51 of the second round and 3 for the 18 of the third. Several sections below + describe one round only. ## Datasets -| PDB | Source | Facility / beamline | dmin (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title | -|---|---|---|---|---|---|---|---| -| [11IF](https://www.rcsb.org/structure/11IF) | IRRMC [10.18430/M311IF](https://doi.org/10.18430/M311IF) | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 | -| [36GK](https://www.rcsb.org/structure/36GK) | IRRMC [10.18430/M336GK](https://doi.org/10.18430/M336GK) | CLSI 08ID-1 | 2.28 | I 2 2 2 | 120.6 189.5 199.7 90.0 90.0 90.0 | Dectris Eiger 9M | D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain | -| [5F6M](https://www.rcsb.org/structure/5F6M) | SBGrid [10.15785/sbgrid/201](https://doi.org/10.15785/sbgrid/201) | SSRL BL11-1 | 1.10 | P 21 21 21 | 54.8 58.5 67.4 90.0 90.0 90.0 | PILATUS 6M | Isotropic Trypsin Model for Comparison of Diffuse Scattering | -| [5REO](https://www.rcsb.org/structure/5REO) | Zenodo [10.5281/zenodo.3730956](https://doi.org/10.5281/zenodo.3730956) | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 | -| [5SRC](https://www.rcsb.org/structure/5SRC) | IRRMC [10.18430/M35SRC](https://doi.org/10.18430/M35SRC) | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers | -| [6HV2](https://www.rcsb.org/structure/6HV2) | IRRMC [10.18430/m36hv2](https://doi.org/10.18430/m36hv2) | SLS X06SA | 1.71 | P 61 2 2 | 68.9 68.9 133.6 90.0 90.0 120.0 | Dectris Eiger 16M | MMP-13 in complex with the peptide IMISF | -| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A | -| [6O2H](https://www.rcsb.org/structure/6O2H) | SBGrid [10.15785/sbgrid/747](https://doi.org/10.15785/sbgrid/747) | CHESS F1 | 1.21 | P 1 | 27.4 32.1 34.5 88.7 108.5 111.9 | PILATUS3 6M | Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset | -| [6R72](https://www.rcsb.org/structure/6R72) | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | SOLEIL PROXIMA 2 | 3.95 | P 1 21 1 | 117.8 110.8 155.6 90.0 93.2 90.0 | Dectris Eiger 9M | Crystal structure of BmrA-E504A in an outward-facing conformation | -| [6RLR](https://www.rcsb.org/structure/6RLR) | Zenodo [10.5281/zenodo.5886687](https://doi.org/10.5281/zenodo.5886687) | Diamond I04 | 2.00 | P 1 | 40.0 40.0 63.6 80.4 76.3 68.2 | Eiger 16M | Crystal structure of CD9 large extracellular loop | -| [6TTN](https://www.rcsb.org/structure/6TTN) | IRRMC [10.18430/m36ttn](https://doi.org/10.18430/m36ttn) | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine | -| [6UKF](https://www.rcsb.org/structure/6UKF) | IRRMC [10.18430/m36ukf](https://doi.org/10.18430/m36ukf) | APS 22-ID | 1.00 | P 1 21 1 | 61.0 37.3 69.0 90.0 109.8 90.0 | Dectris Eiger 16M | HhaI endonuclease in Complex with DNA at 1 Angstrom Resolution | -| [6YQF](https://www.rcsb.org/structure/6YQF) | IRRMC [10.18430/m36yqf](https://doi.org/10.18430/m36yqf) | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly | -| [6ZE4](https://www.rcsb.org/structure/6ZE4) | SBGrid [10.15785/sbgrid/806](https://doi.org/10.15785/sbgrid/806) | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide | -| [7ATG](https://www.rcsb.org/structure/7ATG) | IRRMC [10.18430/m37atg](https://doi.org/10.18430/m37atg) | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution | -| [7D1M](https://www.rcsb.org/structure/7D1M) | IRRMC [10.18430/m37brr](https://doi.org/10.18430/m37brr) | SSRF BL17U1 | 1.35 | P 1 21 1 | 55.5 99.0 59.6 90.0 108.5 90.0 | Dectris Eiger 16M | CRYSTAL STRUCTURE OF THE SARS-CoV-2 MAIN PROTEASE COMPLEXED WITH GC376 | -| [7DKP](https://www.rcsb.org/structure/7DKP) | IRRMC [10.18430/M37DKP](https://doi.org/10.18430/M37DKP) | ESRF MASSIF-3 | 1.45 | P 1 21 1 | 49.8 169.5 49.8 90.0 93.5 90.0 | Dectris Eiger 4M | Crystal structure of E. coli Grx2 in complex with GSH at 1.45 A resolution | -| [7K1L](https://www.rcsb.org/structure/7K1L) | IRRMC [10.18430/m37k1l](https://doi.org/10.18430/m37k1l) | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate | -| [7KCN](https://www.rcsb.org/structure/7KCN) | IRRMC [10.18430/m37kcn](https://doi.org/10.18430/m37kcn) | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins | -| [7MZT](https://www.rcsb.org/structure/7MZT) | IRRMC [10.18430/m37mzt](https://doi.org/10.18430/m37mzt) | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A | -| [7ORR](https://www.rcsb.org/structure/7ORR) | IRRMC [10.18430/M37ORR](https://doi.org/10.18430/M37ORR) | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 | -| [7PH1](https://www.rcsb.org/structure/7PH1) | IRRMC [10.18430/M37PH1](https://doi.org/10.18430/M37PH1) | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid | -| [7PQ7](https://www.rcsb.org/structure/7PQ7) | IRRMC [10.18430/M3.IRRMC.6072](https://doi.org/10.18430/M3.IRRMC.6072) | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 | -| [7QIJ](https://www.rcsb.org/structure/7QIJ) | SBGrid [10.15785/sbgrid/907](https://doi.org/10.15785/sbgrid/907) | PETRA III, EMBL c/o DESY P13 (MX1) | 4.10 | P 21 21 21 | 143.5 324.9 369.4 90.0 90.0 90.0 | PILATUS 6M-F | Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY | -| [7QIS](https://www.rcsb.org/structure/7QIS) | IRRMC [10.18430/M37QIS](https://doi.org/10.18430/M37QIS) | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX | -| [7RIS](https://www.rcsb.org/structure/7RIS) | IRRMC [10.18430/M37RIS](https://doi.org/10.18430/M37RIS) | APS 21-ID-D | 1.72 | P 32 2 1 | 44.5 44.5 189.9 90.0 90.0 120.0 | Dectris Eiger 9M | Crystal structure of RPA3624, a beta-propeller lactonase from Rhodopseudomonas palustris, with active-site bound phosphate | -| [7RJI](https://www.rcsb.org/structure/7RJI) | IRRMC [10.18430/M37RJI](https://doi.org/10.18430/M37RJI) | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid | -| [7TCD](https://www.rcsb.org/structure/7TCD) | IRRMC [10.18430/m37tcd](https://doi.org/10.18430/m37tcd) | SLS X06SA | 1.70 | C 1 2 1 | 138.5 47.9 78.1 90.0 107.6 90.0 | Dectris Eiger 16M | LOV2-DARPIN fusion: D13 | -| [7YZX](https://www.rcsb.org/structure/7YZX) | IRRMC [10.18430/M37YZX](https://doi.org/10.18430/M37YZX) | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. | -| [8A1A](https://www.rcsb.org/structure/8A1A) | IRRMC [10.18430/M38A1A](https://doi.org/10.18430/M38A1A) | SLS X06SA | 2.05 | P 65 | 191.9 191.9 122.4 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct | -| [8AGQ](https://www.rcsb.org/structure/8AGQ) | IRRMC [10.18430/M38AGQ](https://doi.org/10.18430/M38AGQ) | SLS X06DA | 1.09 | C 1 2 1 | 89.9 55.4 54.8 90.0 113.5 90.0 | PILATUS 2MF | Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione | -| [8DYZ](https://www.rcsb.org/structure/8DYZ) | SBGrid [10.15785/sbgrid/957](https://doi.org/10.15785/sbgrid/957) | CHESS F1 | 1.27 | P 43 21 2 | 79.6 79.6 38.3 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset | -| [8DZ7](https://www.rcsb.org/structure/8DZ7) | SBGrid [10.15785/sbgrid/958](https://doi.org/10.15785/sbgrid/958) | CHESS F1 | 1.34 | P 21 21 21 | 30.5 56.4 73.9 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset | -| [8EGN](https://www.rcsb.org/structure/8EGN) | IRRMC [10.18430/M38EGN](https://doi.org/10.18430/M38EGN) | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 | -| [8IYA](https://www.rcsb.org/structure/8IYA) | IRRMC [10.18430/m38iya](https://doi.org/10.18430/m38iya) | SSRF BL02U1 | 2.43 | C 1 2 1 | 102.7 50.1 109.2 90.0 91.8 90.0 | Dectris EIGER2 Si 9M | Complex of SETDB1-derived peptide bound to UBE2E1 | -| [8K1G](https://www.rcsb.org/structure/8K1G) | IRRMC [10.18430/M38K1G](https://doi.org/10.18430/M38K1G) | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae | -| [8OIC](https://www.rcsb.org/structure/8OIC) | IRRMC [10.18430/m38oic](https://doi.org/10.18430/m38oic) | Diamond I04 | 2.80 | P 1 | 73.1 94.7 120.6 105.1 90.0 93.8 | Eiger 16M | Trichomonas vaginalis riboside hydrolase (His-tagged) | -| [8PQD](https://www.rcsb.org/structure/8PQD) | IRRMC [10.18430/m38pqd](https://doi.org/10.18430/m38pqd) | ESRF MASSIF-3 | 1.50 | P 21 21 21 | 59.4 59.4 192.9 90.0 90.0 90.0 | Dectris Eiger 4M | c-KIT kinase domain in complex with avapritinib derivative 10 | -| [8QQ7](https://www.rcsb.org/structure/8QQ7) | Zenodo [10.5281/zenodo.14901515](https://doi.org/10.5281/zenodo.14901515) | ESRF MASSIF-1 | 3.62 | P 64 2 2 | 146.0 146.0 153.6 90.0 90.0 120.0 | PILATUS3 2M | Structure of SpNOX: a Bacterial NADPH oxidase | -| [8R5R](https://www.rcsb.org/structure/8R5R) | IRRMC [10.18430/m38r5r](https://doi.org/10.18430/m38r5r) | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor | -| [8SA8](https://www.rcsb.org/structure/8SA8) | IRRMC [10.18430/M38SA8](https://doi.org/10.18430/M38SA8) | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) | -| [8SQQ](https://www.rcsb.org/structure/8SQQ) | IRRMC [10.18430/M38SQQ](https://doi.org/10.18430/M38SQQ) | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) | -| [8SQT](https://www.rcsb.org/structure/8SQT) | IRRMC [10.18430/M38SQT](https://doi.org/10.18430/M38SQT) | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) | -| [8T7R](https://www.rcsb.org/structure/8T7R) | IRRMC [10.18430/M38T7R](https://doi.org/10.18430/M38T7R) | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 | -| [8THA](https://www.rcsb.org/structure/8THA) | IRRMC [10.18430/m38tha](https://doi.org/10.18430/m38tha) | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form | -| [8U0I](https://www.rcsb.org/structure/8U0I) | IRRMC [10.18430/m38u0i](https://doi.org/10.18430/m38u0i) | ALS 8.2.1 | 1.54 | P 43 21 2 | 50.3 50.3 90.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of PA0012 complexed with cyclic-di-GMP from Pseudomonas aeruginosa | -| [8V4O](https://www.rcsb.org/structure/8V4O) | IRRMC [10.18430/m38v4o](https://doi.org/10.18430/m38v4o) | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans | -| [8XBP](https://www.rcsb.org/structure/8XBP) | IRRMC [10.18430/M38XBP](https://doi.org/10.18430/M38XBP) | SOLEIL PROXIMA 1 | 1.99 | C 1 2 1 | 148.3 50.8 60.2 90.0 92.3 90.0 | Dectris Eiger 16M | Crystal structure of AtNATA1 bound to Acetyl CoA | -| [8XTE](https://www.rcsb.org/structure/8XTE) | SBGrid [10.15785/sbgrid/1101](https://doi.org/10.15785/sbgrid/1101) | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP | -| [8XTF](https://www.rcsb.org/structure/8XTF) | SBGrid [10.15785/sbgrid/1102](https://doi.org/10.15785/sbgrid/1102) | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C | -| [8XTG](https://www.rcsb.org/structure/8XTG) | SBGrid [10.15785/sbgrid/1100](https://doi.org/10.15785/sbgrid/1100) | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA | -| [8YS9](https://www.rcsb.org/structure/8YS9) | IRRMC [10.18430/M38YS9](https://doi.org/10.18430/M38YS9) | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH | -| [9B22](https://www.rcsb.org/structure/9B22) | IRRMC [10.18430/m39b22](https://doi.org/10.18430/m39b22) | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) | -| [9BN8](https://www.rcsb.org/structure/9BN8) | IRRMC [10.18430/m39bn8](https://doi.org/10.18430/m39bn8) | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 | -| [9CRW](https://www.rcsb.org/structure/9CRW) | IRRMC [10.18430/m39crw](https://doi.org/10.18430/m39crw) | CLSI 08ID-1 | 2.49 | P 1 21 1 | 84.0 104.6 118.8 90.0 93.4 90.0 | Dectris Eiger 9M | Crystal structure of the Candida albicans kinesin-8 proximal tail domain | -| [9GJX](https://www.rcsb.org/structure/9GJX) | IRRMC [10.18430/M39GJX](https://doi.org/10.18430/M39GJX) | Diamond I04 | 2.40 | P 1 21 1 | 76.8 115.8 103.8 90.0 110.3 90.0 | Eiger 16M | Bacillus licheniformis nitroreductase | -| [9HS7](https://www.rcsb.org/structure/9HS7) | IRRMC [10.18430/M39HS7](https://doi.org/10.18430/M39HS7) | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER | -| [9I0A](https://www.rcsb.org/structure/9I0A) | IRRMC [10.18430/M39I0A](https://doi.org/10.18430/M39I0A) | SOLEIL PROXIMA 1 | 2.22 | P 21 21 2 | 75.2 98.7 208.6 90.0 90.0 90.0 | Dectris Eiger 16M | CARM1 in complex with arg-aDMA analog | -| [9IG7](https://www.rcsb.org/structure/9IG7) | IRRMC [10.18430/M39IG7](https://doi.org/10.18430/M39IG7) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.60 | P 21 21 2 | 111.5 153.5 69.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides | -| [9IH9](https://www.rcsb.org/structure/9IH9) | IRRMC [10.18430/M39IH9](https://doi.org/10.18430/M39IH9) | ESRF MASSIF-3 | 1.70 | C 1 2 1 | 78.8 133.9 82.3 90.0 101.4 90.0 | Dectris EIGER1 Si 4M | KEAP1 complexed to linear peptide 6 | -| [9JZO](https://www.rcsb.org/structure/9JZO) | IRRMC [10.18430/m39jzo](https://doi.org/10.18430/m39jzo) | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. | -| [9MH4](https://www.rcsb.org/structure/9MH4) | IRRMC [10.18430/M39MH4](https://doi.org/10.18430/M39MH4) | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes | -| [9MIN](https://www.rcsb.org/structure/9MIN) | SBGrid [10.15785/sbgrid/1151](https://doi.org/10.15785/sbgrid/1151) | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 | -| [9O0H](https://www.rcsb.org/structure/9O0H) | IRRMC [10.18430/M39O0H](https://doi.org/10.18430/M39O0H) | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker | -| [9P7Q](https://www.rcsb.org/structure/9P7Q) | IRRMC [10.18430/M39P7Q](https://doi.org/10.18430/M39P7Q) | SSRL BL12-1 | 2.21 | C 1 2 1 | 97.0 45.0 72.1 90.0 105.1 90.0 | Dectris EIGER2 Si 16M | 273K human S-adenosylmethionine decarboxylase | -| [9PBB](https://www.rcsb.org/structure/9PBB) | IRRMC [10.18430/M39PBB](https://doi.org/10.18430/M39PBB) | SSRL BL12-1 | 2.17 | C 1 2 1 | 97.4 45.9 72.2 90.0 105.0 90.0 | Dectris EIGER2 Si 16M | 293K human S-adenosylmethionine decarboxylase | -| [9RP9](https://www.rcsb.org/structure/9RP9) | IRRMC [10.18430/M39RP9](https://doi.org/10.18430/M39RP9) | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex | -| [9SL0](https://www.rcsb.org/structure/9SL0) | IRRMC [10.18430/M39SL0](https://doi.org/10.18430/M39SL0) | ESRF MASSIF-1 | 1.60 | P 21 21 21 | 60.2 80.2 111.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of HLA-A0201 in complex with peptide LLWNGPMAV | -| [9VX7](https://www.rcsb.org/structure/9VX7) | IRRMC [10.18430/M39VX7](https://doi.org/10.18430/M39VX7) | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor | -| [9VYB](https://www.rcsb.org/structure/9VYB) | IRRMC [10.18430/M39VYB](https://doi.org/10.18430/M39VYB) | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd | -| [9W3Y](https://www.rcsb.org/structure/9W3Y) | IRRMC [10.18430/M39W3Y](https://doi.org/10.18430/M39W3Y) | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) | -| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | -| [9Z44](https://www.rcsb.org/structure/9Z44) | IRRMC [10.18430/M39Z44](https://doi.org/10.18430/M39Z44) | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain | -| [9ZLO](https://www.rcsb.org/structure/9ZLO) | Zenodo [10.5281/zenodo.18652652](https://doi.org/10.5281/zenodo.18652652) | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE | -| [9ZM0](https://www.rcsb.org/structure/9ZM0) | IRRMC [10.18430/M39ZM0](https://doi.org/10.18430/M39ZM0) | NSLS-II 17-ID-1 | 2.10 | P 1 21 1 | 50.4 30.1 91.2 90.0 97.1 90.0 | Dectris EIGER1 Si 9M | Crystal structure of monomeric Atg23 | -| [9ZMU](https://www.rcsb.org/structure/9ZMU) | IRRMC [10.18430/M39ZMU](https://doi.org/10.18430/M39ZMU) | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) | -| [5JVN](https://www.rcsb.org/structure/5JVN) | IRRMC [10.18430/m35jvn](https://doi.org/10.18430/m35jvn) | ESRF ID29 | 2.90 | P 6 2 2 | 249.4 249.4 84.1 90.0 90.0 120.0 | PILATUS3 6M | C3-type pyruvate phosphate dikinase: intermediate state of the swiveling-domain mechanism | -| [5M17](https://www.rcsb.org/structure/5M17) | Zenodo [10.5281/zenodo.4300323](https://doi.org/10.5281/zenodo.4300323) | Diamond I02 | 1.03 | I 4 | 108.6 108.6 67.7 90.0 90.0 90.0 | PILATUS 6M-F | Structure of the GH99 endo-alpha-mannanase from Bacteroides xylanisolvens | -| [6FID](https://www.rcsb.org/structure/6FID) | SBGrid [10.15785/sbgrid/541](https://doi.org/10.15785/sbgrid/541) | ESRF ID30B | 2.20 | P 21 21 21 | 59.9 64.1 69.7 90.0 90.0 90.0 | PILATUS3 6M | Bovine trypsin solved by S-SAD on ID30B | -| [6FVZ](https://www.rcsb.org/structure/6FVZ) | IRRMC [10.18430/m36fvz](https://doi.org/10.18430/m36fvz) | ESRF ID23-2 | 1.80 | C 2 2 2 | 131.2 222.8 86.5 90.0 90.0 90.0 | PILATUS3 X 2M | Crystal structure of human monoamine oxidase B (MAO B) in complex with an inhibitor | -| [6HWJ](https://www.rcsb.org/structure/6HWJ) | SBGrid [10.15785/sbgrid/614](https://doi.org/10.15785/sbgrid/614) | ALBA XALOC | 1.98 | P 1 21 1 | 59.8 96.1 80.3 90.0 106.7 90.0 | PILATUS 6M | Glucosamine kinase (crystal form A) | -| [6IU8](https://www.rcsb.org/structure/6IU8) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.70 | P 31 | 85.5 85.5 98.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with cobalt | -| [6P8P](https://www.rcsb.org/structure/6P8P) | SBGrid [10.15785/sbgrid/673](https://doi.org/10.15785/sbgrid/673) | APS 24-ID-C | 1.64 | P 4 | 97.5 97.5 60.1 90.0 90.0 90.0 | PILATUS 6M-F | Structure of P. aeruginosa ATCC27853 HORMA1 | -| [6PB3](https://www.rcsb.org/structure/6PB3) | SBGrid [10.15785/sbgrid/681](https://doi.org/10.15785/sbgrid/681) | APS 24-ID-E | 2.05 | P 6 | 100.4 100.4 48.9 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of Rhizobiales Trip13 | -| [6WZO](https://www.rcsb.org/structure/6WZO) | SBGrid [10.15785/sbgrid/785](https://doi.org/10.15785/sbgrid/785) | APS 24-ID-E | 1.42 | P 1 | 43.7 50.1 69.3 106.5 90.1 97.1 | Dectris Eiger 16M | Structure of SARS-CoV-2 Nucleocapsid dimerization domain, P1 form | -| [7ARR](https://www.rcsb.org/structure/7ARR) | MXRDR [10.18150/EM87YL](https://doi.org/10.18150/EM87YL) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.10 | P 1 | 30.9 32.1 43.1 114.2 91.9 109.9 | PILATUS 6M-F | The de novo designed hybrid alpha/beta-miniprotein | -| [7L84](https://www.rcsb.org/structure/7L84) | SBGrid [10.15785/sbgrid/816](https://doi.org/10.15785/sbgrid/816) | APS 24-ID-C | 1.60 | P 43 21 2 | 79.3 79.3 37.8 90.0 90.0 90.0 | PILATUS 6M-F | Hen Egg White Lysozyme by Native S-SAD at Room Temperature | -| [7OS3](https://www.rcsb.org/structure/7OS3) | MXRDR [10.18150/74YTYQ](https://doi.org/10.18150/74YTYQ) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.18 | P 21 21 21 | 78.2 91.0 105.8 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Rhizobium etli inducible L-asparaginase | -| [8TYY](https://www.rcsb.org/structure/8TYY) | SBGrid [10.15785/sbgrid/1040](https://doi.org/10.15785/sbgrid/1040) | APS 24-ID-E | 1.68 | F 4 3 2 | 214.9 214.9 214.9 90.0 90.0 90.0 | Dectris Eiger 16M | Structure of a bacterial Ubl-deubiquitinase complex (form 2) | -| [9C18](https://www.rcsb.org/structure/9C18) | Zenodo [10.5281/zenodo.11405662](https://doi.org/10.5281/zenodo.11405662) | NSLS-II 17-ID-1 | 1.90 | P 1 | 41.9 42.0 60.2 84.1 87.2 63.7 | Dectris EIGER1 Si 9M | Human biliverdin IX beta reductase in complex with NADP | -| [9E2T](https://www.rcsb.org/structure/9E2T) | SBGrid [10.15785/sbgrid/1148](https://doi.org/10.15785/sbgrid/1148) | SSRL BL12-1 | 2.28 | P 1 | 75.5 78.1 101.2 94.6 103.4 114.5 | Dectris EIGER2 Si 16M | Structure of a de novo designed interleukin-21 mimetic complex | -| [9HNC](https://www.rcsb.org/structure/9HNC) | MXRDR [10.60884/0K7B68](https://doi.org/10.60884/0K7B68) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.88 | P 1 2 1 | 123.8 123.6 187.7 90.0 90.1 90.0 | PILATUS 6M-F | Crystal structure of potassium-independent L-asparaginase | -| [9QW8](https://www.rcsb.org/structure/9QW8) | ESRF [10.15151/ESRF-DC-2127908021](https://doi.org/10.15151/ESRF-DC-2127908021) | ESRF ID23-1 | 1.80 | P 1 | 35.6 35.6 100.9 86.5 84.2 72.5 | Dectris EIGER2 CdTe 16M | FKBP12 in complex with bifunctional ligand 1ad | -| [9RCI](https://www.rcsb.org/structure/9RCI) | Zenodo [10.5281/zenodo.15615368](https://doi.org/10.5281/zenodo.15615368) | SOLEIL PROXIMA 2 | 1.66 | P 1 | 35.9 39.3 100.9 98.3 90.3 90.1 | Dectris Eiger 9M | Crystal Structure of Flap Endonuclease FEN1 with Compound 28 | -| [8OWM](https://www.rcsb.org/structure/8OWM) | MXRDR [10.18150/II5MT4](https://doi.org/10.18150/II5MT4) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.70 | P 1 | 95.5 95.6 95.8 90.4 93.6 117.8 | Dectris Eiger 16M | Crystal structure of glutamate dehydrogenase 2 from Arabidopsis thaliana binding Ca, NAD and 2,2-dihydroxyglutarate | -| [3INP](https://www.rcsb.org/structure/3INP) | IRRMC [10.18430/m33inp](https://doi.org/10.18430/m33inp) | APS 21-ID-F | 2.05 | F 41 3 2 | 224.1 224.1 224.1 90.0 90.0 90.0 | marCCD, 225 mm plate | 2.05 Angstrom Resolution Crystal Structure of D-ribulose-phosphate 3-epimerase from Francisella tularensis. | -| [3KY7](https://www.rcsb.org/structure/3KY7) | IRRMC [10.18430/m33ky7](https://doi.org/10.18430/m33ky7) | APS 21-ID-G | 2.35 | P 43 3 2 | 125.2 125.2 125.2 90.0 90.0 90.0 | marCCD, 300 mm plate | 2.35 Angstrom resolution crystal structure of a putative tRNA (guanine-7-)-methyltransferase (trmD) from Staphylococcus aureus subsp. aureus MRSA252 | -| [5EBI](https://www.rcsb.org/structure/5EBI) | MXRDR [10.18150/9887707](https://doi.org/10.18150/9887707) | BESSY 14.2 | 1.09 | P 1 21 1 | 35.7 44.1 35.7 90.0 120.0 90.0 | marCCD, 225 mm plate | Crystal structure of a DNA-RNA chimera in complex with Ba2+ ions: a case of unusual multi-domain twinning | -| [5EPE](https://www.rcsb.org/structure/5EPE) | IRRMC [10.18430/m3159c](https://doi.org/10.18430/m3159c) | APS 21-ID-G | 1.90 | F 2 3 | 157.5 157.5 157.5 90.0 90.0 90.0 | Rayonix MX-300 | Crystal structure of SAM-dependent methyltransferase from Thiobacillus denitrificans in complex with S-Adenosyl-L-homocysteine | -| [5J23](https://www.rcsb.org/structure/5J23) | IRRMC [10.18430/M35J23](https://doi.org/10.18430/M35J23) | APS 21-ID-G | 2.30 | H 3 | 175.8 175.8 136.8 90.0 90.0 120.0 | Rayonix MX-300 | Crystal structure of NADPH-dependent glyoxylate/hydroxypyruvate reductase SMc04462 (SmGhrB) from Sinorhizobium meliloti in complex with 2'-phospho-ADP-ribose | -| [5LZL](https://www.rcsb.org/structure/5LZL) | Zenodo [10.5281/zenodo.54757](https://doi.org/10.5281/zenodo.54757) | Diamond I02 | 3.47 | P 31 2 1 | 205.6 205.6 199.2 90.0 90.0 120.0 | PILATUS 6M-F | Pyrobaculum calidifontis 5-aminolaevulinic acid dehydratase | -| [5NW5](https://www.rcsb.org/structure/5NW5) | SBGrid [10.15785/sbgrid/446](https://doi.org/10.15785/sbgrid/446) | SLS X06DA | 6.50 | P 21 21 21 | 92.1 169.8 390.2 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of the Rif1 N-terminal domain (RIF1-NTD) from Saccharomyces cerevisiae in complex with DNA | -| [6FWC](https://www.rcsb.org/structure/6FWC) | IRRMC [10.18430/m36fwc](https://doi.org/10.18430/m36fwc) | ESRF MASSIF-3 | 1.70 | C 2 2 2 | 131.7 222.1 86.3 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of human monoamine oxidase B (MAO B) in complex with fluorophenyl-chromone-carboxamide | -| [6H2P](https://www.rcsb.org/structure/6H2P) | IRRMC [10.18430/m36h2p](https://doi.org/10.18430/m36h2p) | BESSY 14.1 | 1.48 | C 2 2 21 | 103.5 107.1 216.5 90.0 90.0 90.0 | PILATUS 6M | Crystal Structure of Arg184Gln mutant of Human Prolidase with Mn ions and Cacodylate ligand | -| [6H5T](https://www.rcsb.org/structure/6H5T) | IRRMC [10.18430/m36h5t](https://doi.org/10.18430/m36h5t) | BESSY 14.3 | 1.69 | I 4 2 2 | 86.8 86.8 141.8 90.0 90.0 90.0 | marCCD, 225 mm plate | Intersectin SH3A short isoform | -| [6I3J](https://www.rcsb.org/structure/6I3J) | IRRMC [10.18430/m36i3j](https://doi.org/10.18430/m36i3j) | BESSY 14.1 | 2.59 | F 2 2 2 | 134.4 203.8 226.7 90.0 90.0 90.0 | marCCD, 225 mm plate | Bilirubin oxidase from Myrothecium verrucaria in complex with ferricyanide | -| [6IU5](https://www.rcsb.org/structure/6IU5) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.25 | P 31 | 84.9 84.9 98.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with zinc ions | -| [6IU6](https://www.rcsb.org/structure/6IU6) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.90 | P 31 | 84.7 84.7 97.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with nickel ions | -| [6IU9](https://www.rcsb.org/structure/6IU9) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 3.00 | P 31 | 85.3 85.3 97.6 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with iron ions | -| [6JGI](https://www.rcsb.org/structure/6JGI) | IRRMC [10.18430/m36jgi](https://doi.org/10.18430/m36jgi) | SPring-8 BL44XU | 0.85 | P 21 21 21 | 50.9 62.4 69.2 90.0 90.0 90.0 | marCCD, 300 mm plate | Crystal structure of the S65T/F99S/M153T/V163A variant of GFP at 0.85 A | -| [6MOJ](https://www.rcsb.org/structure/6MOJ) | SBGrid [10.15785/sbgrid/620](https://doi.org/10.15785/sbgrid/620) | ALS 5.0.1 | 2.43 | I 41 2 2 | 130.4 130.4 293.5 90.0 90.0 90.0 | PILATUS3 6M | Dimeric DARPin A_angle_R5 complex with EpoR | -| [6OEL](https://www.rcsb.org/structure/6OEL) | SBGrid [10.15785/sbgrid/652](https://doi.org/10.15785/sbgrid/652) | ALS 8.2.1 | 3.10 | F 41 3 2 | 328.1 328.1 328.1 90.0 90.0 90.0 | SMV, S/N 905 | Engineered Fab bound to IL-4 receptor | -| [6PXB](https://www.rcsb.org/structure/6PXB) | SBGrid [10.15785/sbgrid/698](https://doi.org/10.15785/sbgrid/698) | APS 24-ID-E | 1.75 | P 32 | 64.0 64.0 119.4 90.0 90.0 120.0 | PILATUS 6M-F | N-Terminal SH2 domain of the p120RasGAP | -| [6PXC](https://www.rcsb.org/structure/6PXC) | SBGrid [10.15785/sbgrid/699](https://doi.org/10.15785/sbgrid/699) | APS 24-ID-E | 1.60 | I 2 2 2 | 44.2 64.8 87.2 90.0 90.0 90.0 | PILATUS 6M-F | N-Terminal SH2 domain of the p120RasGAP bound to a p190RhoGAP phosphotyrosine peptide | -| [6TOC](https://www.rcsb.org/structure/6TOC) | Zenodo [10.5281/zenodo.3571040](https://doi.org/10.5281/zenodo.3571040) | SLS X06DA | 1.85 | P 42 | 31.5 31.5 81.6 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of the oligomerisation domain of the transcription factor PHOSPHATE STARVATION RESPONSE 1 from Arabidopsis (crystal form 3). | -| [6U7G](https://www.rcsb.org/structure/6U7G) | IRRMC [10.18430/m36u7g](https://doi.org/10.18430/m36u7g) | APS 23-ID-B | 2.35 | P 1 21 1 | 99.6 98.7 147.5 90.0 104.6 90.0 | Dectris Eiger 16M | HCoV-229E RBD Class V in complex with human APN | -| [6VWW](https://www.rcsb.org/structure/6VWW) | IRRMC [10.18430/m36vww](https://doi.org/10.18430/m36vww) | APS 19-ID | 2.20 | P 63 | 150.5 150.5 111.3 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2. | -| [6W4H](https://www.rcsb.org/structure/6W4H) | IRRMC [10.18430/m36w4h](https://doi.org/10.18430/m36w4h) | APS 21-ID-F | 1.80 | P 31 2 1 | 167.7 167.7 51.9 90.0 90.0 120.0 | Rayonix MX-300 | 1.80 Angstrom Resolution Crystal Structure of NSP16 - NSP10 Complex from SARS-CoV-2 | -| [6Z8O](https://www.rcsb.org/structure/6Z8O) | Zenodo [10.5281/zenodo.3873216](https://doi.org/10.5281/zenodo.3873216) | ESRF ID30B | 2.20 | P 1 21 1 | 63.7 97.0 121.3 90.0 104.7 90.0 | Dectris Eiger 4M | Structure of [NiFeSe] hydrogenase G491A variant from Desulfovibrio vulgaris Hildenborough pressurized with Krypton gas - structure G491A-Kr | -| [7BGT](https://www.rcsb.org/structure/7BGT) | MXRDR [10.18150/1HQGWO](https://doi.org/10.18150/1HQGWO) | BESSY 14.2 | 1.93 | P 1 | 29.3 67.6 69.7 76.8 83.9 83.6 | marCCD, 225 mm plate | Mason-Pfizer Monkey Virus Protease mutant C7A/D26N/C106A in complex with peptidomimetic inhibitor | -| [7L6J](https://www.rcsb.org/structure/7L6J) | IRRMC [10.18430/m37l6j](https://doi.org/10.18430/m37l6j) | APS 21-ID-F | 1.78 | I 41 3 2 | 171.7 171.7 171.7 90.0 90.0 90.0 | Rayonix MX-300 | Crystal Structure of the Putative Hydrolase from Stenotrophomonas maltophilia | -| [7N0I](https://www.rcsb.org/structure/7N0I) | SBGrid [10.15785/sbgrid/835](https://doi.org/10.15785/sbgrid/835) | ALS 5.0.2 | 2.20 | P 21 21 21 | 75.8 131.6 140.0 90.0 90.0 90.0 | PILATUS3 6M | Structure of the SARS-CoV-2 N protein C-terminal domain bound to single-domain antibody E2 | -| [7N2S](https://www.rcsb.org/structure/7N2S) | SBGrid [10.15785/sbgrid/916](https://doi.org/10.15785/sbgrid/916) | SSRL BL12-1 | 2.37 | P 1 21 1 | 83.2 52.8 106.3 90.0 98.3 90.0 | PILATUS 6M | AS3.1-PRPF3-HLA*B27 | -| [7T5T](https://www.rcsb.org/structure/7T5T) | SBGrid [10.15785/sbgrid/864](https://doi.org/10.15785/sbgrid/864) | SSRL BL9-2 | 1.35 | P 42 21 2 | 95.3 95.3 104.9 90.0 90.0 90.0 | PILATUS 6M | Structure of Thauera sp. K11 CapP | -| [8DQB](https://www.rcsb.org/structure/8DQB) | IRRMC [10.18430/m38dqb](https://doi.org/10.18430/m38dqb) | NSLS-II 19-ID | 2.50 | I 2 3 | 164.1 164.1 164.1 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of 3-dehydroquinate dehydratase I from Klebsiella oxytoca (I23 Form) | -| [8QAW](https://www.rcsb.org/structure/8QAW) | MXRDR [10.18150/INUP4Q](https://doi.org/10.18150/INUP4Q) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.55 | H 3 | 137.7 137.7 265.9 90.0 90.0 120.0 | Dectris Eiger 16M | Medicago truncatula HISN5 (IGPD) in complex with MN, IMD, EDO, FMT, GOL and TRS | -| [8QJ5](https://www.rcsb.org/structure/8QJ5) | IRRMC [10.18430/m38qj5](https://doi.org/10.18430/m38qj5) | ELETTRA 11.2C | 1.63 | P 1 21 1 | 57.6 100.6 77.9 90.0 96.1 90.0 | PILATUS 6M | Crystal structure of the Levansucrase beta from Pseudomonas syringae pv. actinidiae | -| [8RUD](https://www.rcsb.org/structure/8RUD) | MXRDR [10.18150/RBG2F9](https://doi.org/10.18150/RBG2F9) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.10 | P 1 21 1 | 78.1 91.4 114.5 90.0 96.9 90.0 | Dectris Eiger 16M | Crystal structure of Rhizobium etli L-asparaginase ReAV K138A mutant | -| [8S38](https://www.rcsb.org/structure/8S38) | MXRDR [10.18150/CGLBVH](https://doi.org/10.18150/CGLBVH) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.89 | I 21 21 21 | 95.4 163.1 219.0 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Medicago truncatula glutamate dehydrogenase 2 in complex with citrate and NAD | -| [8SQO](https://www.rcsb.org/structure/8SQO) | IRRMC [10.18430/m38sqo](https://doi.org/10.18430/m38sqo) | NSLS-II 19-ID | 1.55 | P 4 3 2 | 112.9 112.9 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (magnesium bound, F16L mutant) | -| [8Y74](https://www.rcsb.org/structure/8Y74) | XRDa [10.51093/xrd-00227](https://doi.org/10.51093/xrd-00227) | SSRF BL02U1 | 1.90 | C 1 2 1 | 125.8 76.6 87.1 90.0 92.4 90.0 | Dectris EIGER2 Si 9M | Crystal structure of 9-mer peptide from H9N2 avian influenza virus in complex with BF2*0201 | -| [9CHW](https://www.rcsb.org/structure/9CHW) | SBGrid [10.15785/sbgrid/1124](https://doi.org/10.15785/sbgrid/1124) | APS 21-ID-F | 2.16 | P 61 | 98.7 98.7 82.1 90.0 90.0 120.0 | Rayonix MX-300 | Crystal structure of human polymerase eta with incoming dAMPnPP nucleotide opposite threofuranosyl thymidine in DNA template | -| [9EA5](https://www.rcsb.org/structure/9EA5) | SBGrid [10.15785/sbgrid/1142](https://doi.org/10.15785/sbgrid/1142) | SSRL BL9-2 | 2.00 | P 1 21 1 | 65.9 73.1 98.4 90.0 108.7 90.0 | PILATUS 6M | Structure of Citrobacter BubCD D104A mutant | -| [9FCG](https://www.rcsb.org/structure/9FCG) | MXRDR [10.18150/LDLSBT](https://doi.org/10.18150/LDLSBT) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.54 | P 4 | 87.8 87.8 35.6 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with PrFAR | -| [9FHC](https://www.rcsb.org/structure/9FHC) | Zenodo [10.5281/zenodo.11472085](https://doi.org/10.5281/zenodo.11472085) | SLS X06SA | 2.20 | I 2 3 | 227.5 227.5 227.5 90.0 90.0 90.0 | marCCD, 225 mm plate | Crystallographic structure of AcrB V612F with bound minocycline | -| [9GDJ](https://www.rcsb.org/structure/9GDJ) | ESRF [10.15151/ESRF-DC-1848199439](https://doi.org/10.15151/ESRF-DC-1848199439) | ESRF ID23-1 | 1.47 | P 41 21 2 | 123.9 123.9 126.4 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | C-Methyltransferase SgMT from Streptomyces griseoviridis | -| [9GQG](https://www.rcsb.org/structure/9GQG) | ESRF [10.15151/ESRF-DC-1900353437](https://doi.org/10.15151/ESRF-DC-1900353437) | ESRF ID30B | 2.00 | P 32 2 1 | 48.2 48.2 188.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | The FK1 domain of FKBP51 in complex with the macrocyclic SAFit analog m5(10,7)-(E)-OH | -| [9I80](https://www.rcsb.org/structure/9I80) | Zenodo [10.5281/zenodo.14844040](https://doi.org/10.5281/zenodo.14844040) | SOLEIL PROXIMA 1 | 1.95 | P 41 | 81.2 81.2 165.0 90.0 90.0 90.0 | Dectris Eiger 16M | LecA in complex with a tolcapone derivative glycomimetic | -| [9KHR](https://www.rcsb.org/structure/9KHR) | Zenodo [10.5281/zenodo.14070468](https://doi.org/10.5281/zenodo.14070468) | RRCAT INDUS-2 PX-BL21 | 2.00 | P 21 21 21 | 48.7 50.3 78.0 90.0 90.0 90.0 | marCCD, 225 mm plate | Crystal structure of Plasmoredoxin, a disulfide oxidoreductase from Plasmodium falciparum crystallized in the presence of Dithiothreitol (DTT) | -| [9Q41](https://www.rcsb.org/structure/9Q41) | SBGrid [10.15785/sbgrid/1194](https://doi.org/10.15785/sbgrid/1194) | CHESS 7B2 | 1.95 | C 2 2 21 | 118.6 133.7 82.4 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | Crystal Structure of Human Apo Spermidine Synthase | -| [9Q66](https://www.rcsb.org/structure/9Q66) | SBGrid [10.15785/sbgrid/1208](https://doi.org/10.15785/sbgrid/1208) | NSLS-II 17-ID-1 | 2.01 | P 1 21 1 | 105.9 67.3 158.0 90.0 99.1 90.0 | Dectris EIGER1 Si 9M | Human prolyl endopeptidase (PREP) - complex with JP-4-1-7 | -| [9RCS](https://www.rcsb.org/structure/9RCS) | XRDa [10.51093/xrd-00383](https://doi.org/10.51093/xrd-00383) | Diamond I24 | 3.01 | P 1 21 1 | 70.0 78.8 82.3 90.0 88.6 90.0 | Eiger 9M | Cardioderma bat coronavirus KY43 receptor binding domain in complex with human CEACAM6 | -| [9T6S](https://www.rcsb.org/structure/9T6S) | SBGrid [10.15785/sbgrid/1260](https://doi.org/10.15785/sbgrid/1260) | ESRF ID30B | 2.00 | P 21 21 21 | 63.0 64.6 102.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of the Listeria monocytogenes CadC with Cadmium | -| [9UPT](https://www.rcsb.org/structure/9UPT) | XRDa [10.51093/xrd-00191](https://doi.org/10.51093/xrd-00191) | NSRRC TPS 05A | 2.37 | P 6 | 158.3 158.3 54.0 90.0 90.0 120.0 | SMV, S/N 930 | Structure of AtBgl1A, a GH1 beta-Glucosidase from Acetivibrio thermocellus | -| [9YL4](https://www.rcsb.org/structure/9YL4) | Zenodo [10.5281/zenodo.17298261](https://doi.org/10.5281/zenodo.17298261) | APS 17-ID | 3.70 | P 21 21 21 | 95.8 111.3 403.0 90.0 90.0 90.0 | PILATUS 6M | Crystal structure of PprA S-F filament from Deinococcus radiodurans | -| [9Z72](https://www.rcsb.org/structure/9Z72) | SBGrid [10.15785/sbgrid/1239](https://doi.org/10.15785/sbgrid/1239) | SSRL BL9-2 | 2.38 | P 31 2 1 | 59.2 59.2 426.2 90.0 90.0 120.0 | Dectris EIGER2 Si 16M | Structure of V. cholerae CapS (form 1) | -| — | Zenodo [10.5281/zenodo.1036416](https://doi.org/10.5281/zenodo.1036416) | Diamond Light Source I19-1 | | | | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 | -| — | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | | | | | Dectris Eiger 9M | Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation | -| — | Zenodo [10.5281/zenodo.20041091](https://doi.org/10.5281/zenodo.20041091) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | -| — | Zenodo [10.5281/zenodo.20135265](https://doi.org/10.5281/zenodo.20135265) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | -| — | Zenodo [10.5281/zenodo.6347466](https://doi.org/10.5281/zenodo.6347466) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source | -| — | Zenodo [10.5281/zenodo.33555](https://doi.org/10.5281/zenodo.33555) | Diamond Light Source I19-1 | | | | PILATUS 2M | Example Cytidine data set from I19-1 at Diamond Light Source | -| — | Zenodo [10.5281/zenodo.11946282](https://doi.org/10.5281/zenodo.11946282) | Diamond Light Source I19 | | | | PILATUS 2M | RODIN X-ray Diffraction Data 2360282 (L-alanine) | +| PDB | Source | Facility / beamline | dmin (Å) | Space group | Unit cell a b c α β γ (Å, °) | Detector (from file) | Title | Round | +|---|---|---|---|---|---|---|---|---| +| [11IF](https://www.rcsb.org/structure/11IF) | IRRMC [10.18430/M311IF](https://doi.org/10.18430/M311IF) | NSLS-II 19-ID | 1.51 | P 43 | 51.1 51.1 71.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2 | 1 | +| [36GK](https://www.rcsb.org/structure/36GK) | IRRMC [10.18430/M336GK](https://doi.org/10.18430/M336GK) | CLSI 08ID-1 | 2.28 | I 2 2 2 | 120.6 189.5 199.7 90.0 90.0 90.0 | Dectris Eiger 9M | D-GlcNAc-bound structure of Vibrio vulnificus putative carbohydrate binding module and split domain | 1 | +| [3INP](https://www.rcsb.org/structure/3INP) | IRRMC [10.18430/m33inp](https://doi.org/10.18430/m33inp) | APS 21-ID-F | 2.05 | F 41 3 2 | 224.1 224.1 224.1 90.0 90.0 90.0 | marCCD, 225 mm plate | 2.05 Angstrom Resolution Crystal Structure of D-ribulose-phosphate 3-epimerase from Francisella tularensis. | 2 | +| [3KY7](https://www.rcsb.org/structure/3KY7) | IRRMC [10.18430/m33ky7](https://doi.org/10.18430/m33ky7) | APS 21-ID-G | 2.35 | P 43 3 2 | 125.2 125.2 125.2 90.0 90.0 90.0 | marCCD, 300 mm plate | 2.35 Angstrom resolution crystal structure of a putative tRNA (guanine-7-)-methyltransferase (trmD) from Staphylococcus aureus subsp. aureus MRSA252 | 2 | +| [5EBI](https://www.rcsb.org/structure/5EBI) | MXRDR [10.18150/9887707](https://doi.org/10.18150/9887707) | BESSY 14.2 | 1.09 | P 1 21 1 | 35.7 44.1 35.7 90.0 120.0 90.0 | marCCD, 225 mm plate | Crystal structure of a DNA-RNA chimera in complex with Ba2+ ions: a case of unusual multi-domain twinning | 2 | +| [5EPE](https://www.rcsb.org/structure/5EPE) | IRRMC [10.18430/m3159c](https://doi.org/10.18430/m3159c) | APS 21-ID-G | 1.90 | F 2 3 | 157.5 157.5 157.5 90.0 90.0 90.0 | Rayonix MX-300 | Crystal structure of SAM-dependent methyltransferase from Thiobacillus denitrificans in complex with S-Adenosyl-L-homocysteine | 2 | +| [5F6M](https://www.rcsb.org/structure/5F6M) | SBGrid [10.15785/sbgrid/201](https://doi.org/10.15785/sbgrid/201) | SSRL BL11-1 | 1.10 | P 21 21 21 | 54.8 58.5 67.4 90.0 90.0 90.0 | PILATUS 6M | Isotropic Trypsin Model for Comparison of Diffuse Scattering | 1 | +| [5J23](https://www.rcsb.org/structure/5J23) | IRRMC [10.18430/M35J23](https://doi.org/10.18430/M35J23) | APS 21-ID-G | 2.30 | H 3 | 175.8 175.8 136.8 90.0 90.0 120.0 | Rayonix MX-300 | Crystal structure of NADPH-dependent glyoxylate/hydroxypyruvate reductase SMc04462 (SmGhrB) from Sinorhizobium meliloti in complex with 2'-phospho-ADP-ribose | 2 | +| [5JVN](https://www.rcsb.org/structure/5JVN) | IRRMC [10.18430/m35jvn](https://doi.org/10.18430/m35jvn) | ESRF ID29 | 2.90 | P 6 2 2 | 249.4 249.4 84.1 90.0 90.0 120.0 | PILATUS3 6M | C3-type pyruvate phosphate dikinase: intermediate state of the swiveling-domain mechanism | 1 | +| [5KY6](https://www.rcsb.org/structure/5KY6) | MXRDR [10.18150/repod.1494374](https://doi.org/10.18150/repod.1494374) | BESSY 14.2 | 1.94 | P 1 21 1 | 84.5 57.3 164.0 90.0 102.6 90.0 | marCCD, 225 mm plate | Human muscle fructose-1,6-bisphosphate aldolase | 3 | +| [5LZL](https://www.rcsb.org/structure/5LZL) | Zenodo [10.5281/zenodo.54757](https://doi.org/10.5281/zenodo.54757) | Diamond I02 | 3.47 | P 31 2 1 | 205.6 205.6 199.2 90.0 90.0 120.0 | PILATUS 6M-F | Pyrobaculum calidifontis 5-aminolaevulinic acid dehydratase | 2 | +| [5M17](https://www.rcsb.org/structure/5M17) | Zenodo [10.5281/zenodo.4300323](https://doi.org/10.5281/zenodo.4300323) | Diamond I02 | 1.03 | I 4 | 108.6 108.6 67.7 90.0 90.0 90.0 | PILATUS 6M-F | Structure of the GH99 endo-alpha-mannanase from Bacteroides xylanisolvens | 1 | +| [5MLN](https://www.rcsb.org/structure/5MLN) | IRRMC [10.18430/m35mln](https://doi.org/10.18430/m35mln) | ESRF ID23-2 | 1.60 | P 21 2 21 | 74.2 80.4 80.5 90.0 90.0 90.0 | PILATUS3 2M | The crystal structure of alcohol dehydrogenase 10 from Candida magnoliae | 3 | +| [5NW5](https://www.rcsb.org/structure/5NW5) | SBGrid [10.15785/sbgrid/446](https://doi.org/10.15785/sbgrid/446) | SLS X06DA | 6.50 | P 21 21 21 | 92.1 169.8 390.2 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of the Rif1 N-terminal domain (RIF1-NTD) from Saccharomyces cerevisiae in complex with DNA | 2 | +| [5REO](https://www.rcsb.org/structure/5REO) | Zenodo [10.5281/zenodo.3730956](https://doi.org/10.5281/zenodo.3730956) | Diamond I04-1 | 1.88 | C 1 2 1 | 112.4 52.6 44.4 90.0 103.0 90.0 | PILATUS 6M-F | PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 main protease in complex with PCM-0102578 | 1 | +| [5SRC](https://www.rcsb.org/structure/5SRC) | IRRMC [10.18430/M35SRC](https://doi.org/10.18430/M35SRC) | ALS 8.3.1 | 1.05 | P 43 | 88.7 88.7 39.2 90.0 90.0 90.0 | PILATUS3 6M | PanDDA analysis group deposition -- Crystal structure of SARS-CoV-2 NSP3 macrodomain in complex with Z5198562500 - (R,R) and (R,S) isomers | 1 | +| [5T39](https://www.rcsb.org/structure/5T39) | SBGrid [10.15785/sbgrid/356](https://doi.org/10.15785/sbgrid/356) | APS 21-ID-F | 1.10 | P 1 21 1 | 50.2 41.3 58.5 90.0 98.6 90.0 | Rayonix MX-300 | Crystal Structure of the N-terminal domain of EvdMO1 in the presence of SAH and D-fucose | 3 | +| [6CDL](https://www.rcsb.org/structure/6CDL) | IRRMC [10.18430/m36cdl](https://doi.org/10.18430/m36cdl) | APS 22-ID | 1.25 | P 21 21 2 | 58.3 85.9 46.1 90.0 90.0 90.0 | marCCD, 300 mm plate | HIV-1 wild type protease with GRL-03214A, 6-5-5-ring fused umbrella-like tetrahydropyranofuran as the P2-ligand, a cyclopropylaminobenzothiazole as the P2'-ligand and 3,5-difluorophenylmethyl as the P1-ligand | 3 | +| [6F3P](https://www.rcsb.org/structure/6F3P) | IRRMC [10.18430/M36F3P](https://doi.org/10.18430/M36F3P) | APS 22-ID | 1.35 | C 1 2 1 | 142.9 85.7 112.0 90.0 122.2 90.0 | marCCD, 300 mm plate | Crystal structure of S-adenosyl-L-homocysteine hydrolase from Pseudomonas aeruginosa in complex with 3'-deoxyadenosine and K+ cation | 3 | +| [6FID](https://www.rcsb.org/structure/6FID) | SBGrid [10.15785/sbgrid/541](https://doi.org/10.15785/sbgrid/541) | ESRF ID30B | 2.20 | P 21 21 21 | 59.9 64.1 69.7 90.0 90.0 90.0 | PILATUS3 6M | Bovine trypsin solved by S-SAD on ID30B | 1 | +| [6FVZ](https://www.rcsb.org/structure/6FVZ) | IRRMC [10.18430/m36fvz](https://doi.org/10.18430/m36fvz) | ESRF ID23-2 | 1.80 | C 2 2 2 | 131.2 222.8 86.5 90.0 90.0 90.0 | PILATUS3 X 2M | Crystal structure of human monoamine oxidase B (MAO B) in complex with an inhibitor | 1 | +| [6FWC](https://www.rcsb.org/structure/6FWC) | IRRMC [10.18430/m36fwc](https://doi.org/10.18430/m36fwc) | ESRF MASSIF-3 | 1.70 | C 2 2 2 | 131.7 222.1 86.3 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of human monoamine oxidase B (MAO B) in complex with fluorophenyl-chromone-carboxamide | 2 | +| [6G1F](https://www.rcsb.org/structure/6G1F) | Zenodo [10.5281/zenodo.1059413](https://doi.org/10.5281/zenodo.1059413) | Diamond I03 | 2.25 | C 1 2 1 | 329.3 83.9 133.4 90.0 111.6 90.0 | PILATUS3 6M | Crystal structure of D-phenylglycine aninotransferase (D-PhgAT) from Pseudomonas stutzeri with PLP internal aldimine | 3 | +| [6H2P](https://www.rcsb.org/structure/6H2P) | IRRMC [10.18430/m36h2p](https://doi.org/10.18430/m36h2p) | BESSY 14.1 | 1.48 | C 2 2 21 | 103.5 107.1 216.5 90.0 90.0 90.0 | PILATUS 6M | Crystal Structure of Arg184Gln mutant of Human Prolidase with Mn ions and Cacodylate ligand | 2 | +| [6H5T](https://www.rcsb.org/structure/6H5T) | IRRMC [10.18430/m36h5t](https://doi.org/10.18430/m36h5t) | BESSY 14.3 | 1.69 | I 4 2 2 | 86.8 86.8 141.8 90.0 90.0 90.0 | marCCD, 225 mm plate | Intersectin SH3A short isoform | 2 | +| [6HV2](https://www.rcsb.org/structure/6HV2) | IRRMC [10.18430/m36hv2](https://doi.org/10.18430/m36hv2) | SLS X06SA | 1.71 | P 61 2 2 | 68.9 68.9 133.6 90.0 90.0 120.0 | Dectris Eiger 16M | MMP-13 in complex with the peptide IMISF | 1 | +| [6HWJ](https://www.rcsb.org/structure/6HWJ) | SBGrid [10.15785/sbgrid/614](https://doi.org/10.15785/sbgrid/614) | ALBA XALOC | 1.98 | P 1 21 1 | 59.8 96.1 80.3 90.0 106.7 90.0 | PILATUS 6M | Glucosamine kinase (crystal form A) | 1 | +| [6I3J](https://www.rcsb.org/structure/6I3J) | IRRMC [10.18430/m36i3j](https://doi.org/10.18430/m36i3j) | BESSY 14.1 | 2.59 | F 2 2 2 | 134.4 203.8 226.7 90.0 90.0 90.0 | marCCD, 225 mm plate | Bilirubin oxidase from Myrothecium verrucaria in complex with ferricyanide | 2 | +| [6IU5](https://www.rcsb.org/structure/6IU5) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.25 | P 31 | 84.9 84.9 98.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with zinc ions | 2 | +| [6IU6](https://www.rcsb.org/structure/6IU6) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.90 | P 31 | 84.7 84.7 97.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with nickel ions | 2 | +| [6IU8](https://www.rcsb.org/structure/6IU8) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 2.70 | P 31 | 85.5 85.5 98.4 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with cobalt | 1 | +| [6IU9](https://www.rcsb.org/structure/6IU9) | Zenodo [10.5281/zenodo.2532134](https://doi.org/10.5281/zenodo.2532134) | SPring-8 BL41XU | 3.00 | P 31 | 85.3 85.3 97.6 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of cytoplasmic metal binding domain with iron ions | 2 | +| [6JGH](https://www.rcsb.org/structure/6JGH) | IRRMC [10.18430/m36jgh](https://doi.org/10.18430/m36jgh) | SPring-8 BL44XU | 0.94 | P 21 21 21 | 50.6 62.5 68.2 90.0 90.0 90.0 | marCCD, 300 mm plate | Crystal structure of the F99S/M153T/V163A/T203I variant of GFP at 0.94 A | 3 | +| [6JGI](https://www.rcsb.org/structure/6JGI) | IRRMC [10.18430/m36jgi](https://doi.org/10.18430/m36jgi) | SPring-8 BL44XU | 0.85 | P 21 21 21 | 50.9 62.4 69.2 90.0 90.0 90.0 | marCCD, 300 mm plate | Crystal structure of the S65T/F99S/M153T/V163A variant of GFP at 0.85 A | 2 | +| [6JGJ](https://www.rcsb.org/structure/6JGJ) | IRRMC [10.18430/m36jgj](https://doi.org/10.18430/m36jgj) | SPring-8 BL41XU | 0.77 | P 21 21 21 | 50.9 62.3 68.8 90.0 90.0 90.0 | PILATUS3 300K | Crystal structure of the F99S/M153T/V163A/E222Q variant of GFP at 0.78 A | 1 | +| [6MOJ](https://www.rcsb.org/structure/6MOJ) | SBGrid [10.15785/sbgrid/620](https://doi.org/10.15785/sbgrid/620) | ALS 5.0.1 | 2.43 | I 41 2 2 | 130.4 130.4 293.5 90.0 90.0 90.0 | PILATUS3 6M | Dimeric DARPin A_angle_R5 complex with EpoR | 2 | +| [6NEN](https://www.rcsb.org/structure/6NEN) | UQ eSpace [10.14264/uql.2018.843](https://doi.org/10.14264/uql.2018.843) | Australian Synchrotron MX2 | 2.15 | P 3 1 2 | 105.5 105.5 35.1 90.0 90.0 120.0 | SMV, S/N 928 | Catalytic domain of Proteus mirabilis ScsC | 3 | +| [6O2H](https://www.rcsb.org/structure/6O2H) | SBGrid [10.15785/sbgrid/747](https://doi.org/10.15785/sbgrid/747) | CHESS F1 | 1.21 | P 1 | 27.4 32.1 34.5 88.7 108.5 111.9 | PILATUS3 6M | Hen lysozyme in triclinic space group at ambient temperature - diffuse scattering dataset | 1 | +| [6OEL](https://www.rcsb.org/structure/6OEL) | SBGrid [10.15785/sbgrid/652](https://doi.org/10.15785/sbgrid/652) | ALS 8.2.1 | 3.10 | F 41 3 2 | 328.1 328.1 328.1 90.0 90.0 90.0 | SMV, S/N 905 | Engineered Fab bound to IL-4 receptor | 2 | +| [6P8P](https://www.rcsb.org/structure/6P8P) | SBGrid [10.15785/sbgrid/673](https://doi.org/10.15785/sbgrid/673) | APS 24-ID-C | 1.64 | P 4 | 97.5 97.5 60.1 90.0 90.0 90.0 | PILATUS 6M-F | Structure of P. aeruginosa ATCC27853 HORMA1 | 1 | +| [6PB3](https://www.rcsb.org/structure/6PB3) | SBGrid [10.15785/sbgrid/681](https://doi.org/10.15785/sbgrid/681) | APS 24-ID-E | 2.05 | P 6 | 100.4 100.4 48.9 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of Rhizobiales Trip13 | 1 | +| [6PXB](https://www.rcsb.org/structure/6PXB) | SBGrid [10.15785/sbgrid/698](https://doi.org/10.15785/sbgrid/698) | APS 24-ID-E | 1.75 | P 32 | 64.0 64.0 119.4 90.0 90.0 120.0 | PILATUS 6M-F | N-Terminal SH2 domain of the p120RasGAP | 2 | +| [6PXC](https://www.rcsb.org/structure/6PXC) | SBGrid [10.15785/sbgrid/699](https://doi.org/10.15785/sbgrid/699) | APS 24-ID-E | 1.60 | I 2 2 2 | 44.2 64.8 87.2 90.0 90.0 90.0 | PILATUS 6M-F | N-Terminal SH2 domain of the p120RasGAP bound to a p190RhoGAP phosphotyrosine peptide | 2 | +| [6QAJ](https://www.rcsb.org/structure/6QAJ) | SBGrid [10.15785/sbgrid/637](https://doi.org/10.15785/sbgrid/637) | Diamond I03 | 2.90 | C 2 2 21 | 59.8 169.3 374.5 90.0 90.0 90.0 | PILATUS3 6M | Structure of the tripartite motif of KAP1/TRIM28 | 3 | +| [6R72](https://www.rcsb.org/structure/6R72) | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | SOLEIL PROXIMA 2 | 3.95 | P 1 21 1 | 117.8 110.8 155.6 90.0 93.2 90.0 | Dectris Eiger 9M | Crystal structure of BmrA-E504A in an outward-facing conformation | 1 | +| [6RLR](https://www.rcsb.org/structure/6RLR) | Zenodo [10.5281/zenodo.5886687](https://doi.org/10.5281/zenodo.5886687) | Diamond I04 | 2.00 | P 1 | 40.0 40.0 63.6 80.4 76.3 68.2 | Eiger 16M | Crystal structure of CD9 large extracellular loop | 1 | +| [6S1U](https://www.rcsb.org/structure/6S1U) | MXRDR [10.18150/repod.0005795](https://doi.org/10.18150/repod.0005795) | BESSY 14.2 | 1.90 | P 1 21 1 | 51.6 29.4 85.5 90.0 103.8 90.0 | marCCD, 225 mm plate | Crystal structure of dimeric M-PMV protease C7A/D26N/C106A mutant in complex with inhibitor | 3 | +| [6TOC](https://www.rcsb.org/structure/6TOC) | Zenodo [10.5281/zenodo.3571040](https://doi.org/10.5281/zenodo.3571040) | SLS X06DA | 1.85 | P 42 | 31.5 31.5 81.6 90.0 90.0 90.0 | PILATUS 2MF | Crystal structure of the oligomerisation domain of the transcription factor PHOSPHATE STARVATION RESPONSE 1 from Arabidopsis (crystal form 3). | 2 | +| [6TTN](https://www.rcsb.org/structure/6TTN) | IRRMC [10.18430/m36ttn](https://doi.org/10.18430/m36ttn) | BESSY 14.1 | 1.12 | P 21 21 21 | 39.9 79.8 104.7 90.0 90.0 90.0 | PILATUS 6M | N-terminally truncated hyoscyamine 6-hydroxylase (tH6H) in complex with N-oxalylglycine and hyoscyamine | 1 | +| [6U7G](https://www.rcsb.org/structure/6U7G) | IRRMC [10.18430/m36u7g](https://doi.org/10.18430/m36u7g) | APS 23-ID-B | 2.35 | P 1 21 1 | 99.6 98.7 147.5 90.0 104.6 90.0 | Dectris Eiger 16M | HCoV-229E RBD Class V in complex with human APN | 2 | +| [6UKF](https://www.rcsb.org/structure/6UKF) | IRRMC [10.18430/m36ukf](https://doi.org/10.18430/m36ukf) | APS 22-ID | 1.00 | P 1 21 1 | 61.0 37.3 69.0 90.0 109.8 90.0 | Dectris Eiger 16M | HhaI endonuclease in Complex with DNA at 1 Angstrom Resolution | 1 | +| [6VWW](https://www.rcsb.org/structure/6VWW) | IRRMC [10.18430/m36vww](https://doi.org/10.18430/m36vww) | APS 19-ID | 2.20 | P 63 | 150.5 150.5 111.3 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2. | 2 | +| [6W4H](https://www.rcsb.org/structure/6W4H) | IRRMC [10.18430/m36w4h](https://doi.org/10.18430/m36w4h) | APS 21-ID-F | 1.80 | P 31 2 1 | 167.7 167.7 51.9 90.0 90.0 120.0 | Rayonix MX-300 | 1.80 Angstrom Resolution Crystal Structure of NSP16 - NSP10 Complex from SARS-CoV-2 | 2 | +| [6W75](https://www.rcsb.org/structure/6W75) | IRRMC [10.18430/m36w75](https://doi.org/10.18430/m36w75) | APS 21-ID-F | 1.95 | P 32 2 1 | 166.2 166.2 98.3 90.0 90.0 120.0 | Rayonix MX-300 | 1.95 Angstrom Resolution Crystal Structure of NSP10 - NSP16 Complex from SARS-CoV-2 | 3 | +| [6WZO](https://www.rcsb.org/structure/6WZO) | SBGrid [10.15785/sbgrid/785](https://doi.org/10.15785/sbgrid/785) | APS 24-ID-E | 1.42 | P 1 | 43.7 50.1 69.3 106.5 90.1 97.1 | Dectris Eiger 16M | Structure of SARS-CoV-2 Nucleocapsid dimerization domain, P1 form | 1 | +| [6YQF](https://www.rcsb.org/structure/6YQF) | IRRMC [10.18430/m36yqf](https://doi.org/10.18430/m36yqf) | Diamond I24 | 3.33 | P 21 21 2 | 42.7 59.7 156.5 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of the SYCE2-TEX12 delta-Ctip complex in a 4:4 assembly | 1 | +| [6Z8O](https://www.rcsb.org/structure/6Z8O) | Zenodo [10.5281/zenodo.3873216](https://doi.org/10.5281/zenodo.3873216) | ESRF ID30B | 2.20 | P 1 21 1 | 63.7 97.0 121.3 90.0 104.7 90.0 | Dectris Eiger 4M | Structure of [NiFeSe] hydrogenase G491A variant from Desulfovibrio vulgaris Hildenborough pressurized with Krypton gas - structure G491A-Kr | 2 | +| [6ZE4](https://www.rcsb.org/structure/6ZE4) | SBGrid [10.15785/sbgrid/806](https://doi.org/10.15785/sbgrid/806) | BESSY 14.1 | 1.60 | P 21 21 21 | 93.6 109.9 116.1 90.0 90.0 90.0 | PILATUS 6M | FAD-dependent oxidoreductase from Chaetomium thermophilum in complex with fragment 4-oxo-N-[(1S)-1-(pyridin-3-yl)ethyl]-4-(thiophen-2-yl)butanamide | 1 | +| [6ZQR](https://www.rcsb.org/structure/6ZQR) | Keele University [10.21252/r2nx-0425](https://doi.org/10.21252/r2nx-0425) | Diamond I02 | 1.93 | P 4 | 113.6 113.6 44.1 90.0 90.0 90.0 | SMV, S/N 922 | Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with GlcNAc ligand bound | 3 | +| [6ZQY](https://www.rcsb.org/structure/6ZQY) | Keele University [10.21252/hx7e-rd04](https://doi.org/10.21252/hx7e-rd04) | Diamond I04 | 1.85 | P 4 | 119.3 119.3 44.2 90.0 90.0 90.0 | SMV, S/N 921 | Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with Neu5Ac ligand bound | 3 | +| [6ZR0](https://www.rcsb.org/structure/6ZR0) | Keele University [10.21252/zcfy-cw20](https://doi.org/10.21252/zcfy-cw20) | Diamond I04 | 1.94 | P 4 | 119.2 119.2 44.2 90.0 90.0 90.0 | PILATUS 6M Prosport+ | Crystal structure of tetrameric fibrinogen-like recognition domain of FIBCD1 with N-acetylalanine ligand bound | 3 | +| [7ARR](https://www.rcsb.org/structure/7ARR) | MXRDR [10.18150/EM87YL](https://doi.org/10.18150/EM87YL) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.10 | P 1 | 30.9 32.1 43.1 114.2 91.9 109.9 | PILATUS 6M-F | The de novo designed hybrid alpha/beta-miniprotein | 1 | +| [7ATG](https://www.rcsb.org/structure/7ATG) | IRRMC [10.18430/m37atg](https://doi.org/10.18430/m37atg) | PETRA III, EMBL c/o DESY P13 (MX1) | 0.60 | P 21 21 21 | 18.0 31.0 43.9 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Z-DNA in complex with putrescinium and potassium cations at ultrahigh-resolution | 1 | +| [7BGT](https://www.rcsb.org/structure/7BGT) | MXRDR [10.18150/1HQGWO](https://doi.org/10.18150/1HQGWO) | BESSY 14.2 | 1.93 | P 1 | 29.3 67.6 69.7 76.8 83.9 83.6 | marCCD, 225 mm plate | Mason-Pfizer Monkey Virus Protease mutant C7A/D26N/C106A in complex with peptidomimetic inhibitor | 2 | +| [7D1M](https://www.rcsb.org/structure/7D1M) | IRRMC [10.18430/m37brr](https://doi.org/10.18430/m37brr) | SSRF BL17U1 | 1.35 | P 1 21 1 | 55.5 99.0 59.6 90.0 108.5 90.0 | Dectris Eiger 16M | CRYSTAL STRUCTURE OF THE SARS-CoV-2 MAIN PROTEASE COMPLEXED WITH GC376 | 1 | +| [7DKP](https://www.rcsb.org/structure/7DKP) | IRRMC [10.18430/M37DKP](https://doi.org/10.18430/M37DKP) | ESRF MASSIF-3 | 1.45 | P 1 21 1 | 49.8 169.5 49.8 90.0 93.5 90.0 | Dectris Eiger 4M | Crystal structure of E. coli Grx2 in complex with GSH at 1.45 A resolution | 1 | +| [7K1L](https://www.rcsb.org/structure/7K1L) | IRRMC [10.18430/m37k1l](https://doi.org/10.18430/m37k1l) | APS 19-ID | 2.25 | P 63 | 150.8 150.8 110.7 90.0 90.0 120.0 | PILATUS3 6M | Crystal Structure of NSP15 Endoribonuclease from SARS CoV-2 in the Complex with Uridine-2',3'-Vanadate | 1 | +| [7KCN](https://www.rcsb.org/structure/7KCN) | IRRMC [10.18430/m37kcn](https://doi.org/10.18430/m37kcn) | LNLS W01B-MX2 | 1.46 | P 41 2 2 | 67.0 67.0 116.9 90.0 90.0 90.0 | PILATUS 2M | Reconstructed ancestor of HIUases and Transthyretins | 1 | +| [7L6J](https://www.rcsb.org/structure/7L6J) | IRRMC [10.18430/m37l6j](https://doi.org/10.18430/m37l6j) | APS 21-ID-F | 1.78 | I 41 3 2 | 171.7 171.7 171.7 90.0 90.0 90.0 | Rayonix MX-300 | Crystal Structure of the Putative Hydrolase from Stenotrophomonas maltophilia | 2 | +| [7L84](https://www.rcsb.org/structure/7L84) | SBGrid [10.15785/sbgrid/816](https://doi.org/10.15785/sbgrid/816) | APS 24-ID-C | 1.60 | P 43 21 2 | 79.3 79.3 37.8 90.0 90.0 90.0 | PILATUS 6M-F | Hen Egg White Lysozyme by Native S-SAD at Room Temperature | 1 | +| [7MZT](https://www.rcsb.org/structure/7MZT) | IRRMC [10.18430/m37mzt](https://doi.org/10.18430/m37mzt) | APS 22-ID | 4.07 | P 21 21 2 | 113.6 97.0 108.3 90.0 90.0 90.0 | Dectris Eiger 16M | Borrelia burgdorferi BBK32-C in complex with an autolytic fragment of human C1r at 4.1A | 1 | +| [7N0I](https://www.rcsb.org/structure/7N0I) | SBGrid [10.15785/sbgrid/835](https://doi.org/10.15785/sbgrid/835) | ALS 5.0.2 | 2.20 | P 21 21 21 | 75.8 131.6 140.0 90.0 90.0 90.0 | PILATUS3 6M | Structure of the SARS-CoV-2 N protein C-terminal domain bound to single-domain antibody E2 | 2 | +| [7N2S](https://www.rcsb.org/structure/7N2S) | SBGrid [10.15785/sbgrid/916](https://doi.org/10.15785/sbgrid/916) | SSRL BL12-1 | 2.37 | P 1 21 1 | 83.2 52.8 106.3 90.0 98.3 90.0 | PILATUS 6M | AS3.1-PRPF3-HLA*B27 | 2 | +| [7ORR](https://www.rcsb.org/structure/7ORR) | IRRMC [10.18430/M37ORR](https://doi.org/10.18430/M37ORR) | MAX IV BioMAX | 1.79 | I 21 3 | 105.9 105.9 105.9 90.0 90.0 90.0 | Dectris Eiger 16M | Non-structural protein 10 (nsp10) from SARS CoV-2 in complex with fragment VT00022 | 1 | +| [7OS3](https://www.rcsb.org/structure/7OS3) | MXRDR [10.18150/74YTYQ](https://doi.org/10.18150/74YTYQ) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.18 | P 21 21 21 | 78.2 91.0 105.8 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Rhizobium etli inducible L-asparaginase | 1 | +| [7OU1](https://www.rcsb.org/structure/7OU1) | MXRDR [10.18150/VQQIHQ](https://doi.org/10.18150/VQQIHQ) | BESSY 14.3 | 1.65 | P 1 21 1 | 77.9 91.3 114.2 90.0 97.1 90.0 | marCCD, 225 mm plate | Crystal structure of Rhizobium etli inducible L-asparaginase ReAV (monoclinic form MP2) | 3 | +| [7PH1](https://www.rcsb.org/structure/7PH1) | IRRMC [10.18430/M37PH1](https://doi.org/10.18430/M37PH1) | BESSY 14.2 | 1.18 | I 2 2 2 | 75.0 81.3 124.2 90.0 90.0 90.0 | PILATUS3 2M | Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid | 1 | +| [7PQ7](https://www.rcsb.org/structure/7PQ7) | IRRMC [10.18430/M3.IRRMC.6072](https://doi.org/10.18430/M3.IRRMC.6072) | ELETTRA 11.2C | 1.55 | C 1 2 1 | 120.9 51.7 75.5 90.0 125.1 90.0 | PILATUS 6M | Crystal structure of Campylobacter jejuni DsbA1 | 1 | +| [7QIJ](https://www.rcsb.org/structure/7QIJ) | SBGrid [10.15785/sbgrid/907](https://doi.org/10.15785/sbgrid/907) | PETRA III, EMBL c/o DESY P13 (MX1) | 4.10 | P 21 21 21 | 143.5 324.9 369.4 90.0 90.0 90.0 | PILATUS 6M-F | Complex of the Yersinia enterocolitica Type III secretion export gate YscV with substrate:chaperone complex YscX:YscY | 1 | +| [7QIS](https://www.rcsb.org/structure/7QIS) | IRRMC [10.18430/M37QIS](https://doi.org/10.18430/M37QIS) | BESSY 14.2 | 1.83 | P 61 | 100.3 100.3 206.2 90.0 90.0 120.0 | PILATUS3 2M | CRYSTAL STRUCTURE OF THE P1 difluoroethylglycine (DfeGly) BPTI MUTANT- BOVINE CHYMOTRYPSIN COMPLEX | 1 | +| [7RAA](https://www.rcsb.org/structure/7RAA) | SBGrid [10.15785/sbgrid/881](https://doi.org/10.15785/sbgrid/881) | SSRL BL12-2 | 2.69 | P 43 21 2 | 66.4 66.4 298.3 90.0 90.0 90.0 | PILATUS 6M | Designed StabIL-2 seq15 | 3 | +| [7RIS](https://www.rcsb.org/structure/7RIS) | IRRMC [10.18430/M37RIS](https://doi.org/10.18430/M37RIS) | APS 21-ID-D | 1.72 | P 32 2 1 | 44.5 44.5 189.9 90.0 90.0 120.0 | Dectris Eiger 9M | Crystal structure of RPA3624, a beta-propeller lactonase from Rhodopseudomonas palustris, with active-site bound phosphate | 1 | +| [7RJI](https://www.rcsb.org/structure/7RJI) | IRRMC [10.18430/M37RJI](https://doi.org/10.18430/M37RJI) | LNLS W01B-MX2 | 1.71 | H 3 2 | 83.0 83.0 124.8 90.0 90.0 120.0 | PILATUS 2M | BthTX-II variant b, from Bothrops jararacussu venom, complexed with stearic acid | 1 | +| [7T5T](https://www.rcsb.org/structure/7T5T) | SBGrid [10.15785/sbgrid/864](https://doi.org/10.15785/sbgrid/864) | SSRL BL9-2 | 1.35 | P 42 21 2 | 95.3 95.3 104.9 90.0 90.0 90.0 | PILATUS 6M | Structure of Thauera sp. K11 CapP | 2 | +| [7TCD](https://www.rcsb.org/structure/7TCD) | IRRMC [10.18430/m37tcd](https://doi.org/10.18430/m37tcd) | SLS X06SA | 1.70 | C 1 2 1 | 138.5 47.9 78.1 90.0 107.6 90.0 | Dectris Eiger 16M | LOV2-DARPIN fusion: D13 | 1 | +| [7YZX](https://www.rcsb.org/structure/7YZX) | IRRMC [10.18430/M37YZX](https://doi.org/10.18430/M37YZX) | Diamond I24 | 1.90 | P 63 2 2 | 169.4 169.4 141.8 90.0 90.0 120.0 | PILATUS3 6M | ScpA from Streptococcus pyogenes, D783A mutant. | 1 | +| [8A1A](https://www.rcsb.org/structure/8A1A) | IRRMC [10.18430/M38A1A](https://doi.org/10.18430/M38A1A) | SLS X06SA | 2.05 | P 65 | 191.9 191.9 122.4 90.0 90.0 120.0 | Dectris Eiger 16M | Structure of a leucinostatin derivative determined by host lattice display : L1F11V1 construct | 1 | +| [8AGQ](https://www.rcsb.org/structure/8AGQ) | IRRMC [10.18430/M38AGQ](https://doi.org/10.18430/M38AGQ) | SLS X06DA | 1.09 | C 1 2 1 | 89.9 55.4 54.8 90.0 113.5 90.0 | PILATUS 2MF | Crystal structure of anthocyanin-related GSTF8 from Populus trichocarpa in complex with (-)-catechin and glutathione | 1 | +| [8DQB](https://www.rcsb.org/structure/8DQB) | IRRMC [10.18430/m38dqb](https://doi.org/10.18430/m38dqb) | NSLS-II 19-ID | 2.50 | I 2 3 | 164.1 164.1 164.1 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of 3-dehydroquinate dehydratase I from Klebsiella oxytoca (I23 Form) | 2 | +| [8DYZ](https://www.rcsb.org/structure/8DYZ) | SBGrid [10.15785/sbgrid/957](https://doi.org/10.15785/sbgrid/957) | CHESS F1 | 1.27 | P 43 21 2 | 79.6 79.6 38.3 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in tetragonal space group at ambient temperature - diffuse scattering dataset | 1 | +| [8DZ7](https://www.rcsb.org/structure/8DZ7) | SBGrid [10.15785/sbgrid/958](https://doi.org/10.15785/sbgrid/958) | CHESS F1 | 1.34 | P 21 21 21 | 30.5 56.4 73.9 90.0 90.0 90.0 | PILATUS3 6M | Hen lysozyme in orthorhombic space group at ambient temperature - diffuse scattering dataset | 1 | +| [8EGN](https://www.rcsb.org/structure/8EGN) | IRRMC [10.18430/M38EGN](https://doi.org/10.18430/M38EGN) | CLSI 08B1-1 | 1.95 | P 21 21 21 | 71.7 75.2 109.8 90.0 90.0 90.0 | PILATUS3 6M | Crystal Structure of UDP-N-acetylmuramate-L-alanine ligase (UDP-N-acetylmuramoyl-L-alanine synthetase, MurC) Pseudomonas aeruginosa in complex with ligand AZ-13643701 | 1 | +| [8IYA](https://www.rcsb.org/structure/8IYA) | IRRMC [10.18430/m38iya](https://doi.org/10.18430/m38iya) | SSRF BL02U1 | 2.43 | C 1 2 1 | 102.7 50.1 109.2 90.0 91.8 90.0 | Dectris EIGER2 Si 9M | Complex of SETDB1-derived peptide bound to UBE2E1 | 1 | +| [8K1G](https://www.rcsb.org/structure/8K1G) | IRRMC [10.18430/M38K1G](https://doi.org/10.18430/M38K1G) | PAL/PLS 11C | 2.09 | I 4 2 2 | 182.0 182.0 80.7 90.0 90.0 90.0 | PILATUS3 6M | Crystal structure of ethylene glycol-bound glycerol dehydrogenase from Klebsiella pneumoniae | 1 | +| [8OIC](https://www.rcsb.org/structure/8OIC) | IRRMC [10.18430/m38oic](https://doi.org/10.18430/m38oic) | Diamond I04 | 2.80 | P 1 | 73.1 94.7 120.6 105.1 90.0 93.8 | Eiger 16M | Trichomonas vaginalis riboside hydrolase (His-tagged) | 1 | +| [8OWM](https://www.rcsb.org/structure/8OWM) | MXRDR [10.18150/II5MT4](https://doi.org/10.18150/II5MT4) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.70 | P 1 | 95.5 95.6 95.8 90.4 93.6 117.8 | Dectris Eiger 16M | Crystal structure of glutamate dehydrogenase 2 from Arabidopsis thaliana binding Ca, NAD and 2,2-dihydroxyglutarate | 1 | +| [8PQD](https://www.rcsb.org/structure/8PQD) | IRRMC [10.18430/m38pqd](https://doi.org/10.18430/m38pqd) | ESRF MASSIF-3 | 1.50 | P 21 21 21 | 59.4 59.4 192.9 90.0 90.0 90.0 | Dectris Eiger 4M | c-KIT kinase domain in complex with avapritinib derivative 10 | 1 | +| [8QAW](https://www.rcsb.org/structure/8QAW) | MXRDR [10.18150/INUP4Q](https://doi.org/10.18150/INUP4Q) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.55 | H 3 | 137.7 137.7 265.9 90.0 90.0 120.0 | Dectris Eiger 16M | Medicago truncatula HISN5 (IGPD) in complex with MN, IMD, EDO, FMT, GOL and TRS | 2 | +| [8QJ5](https://www.rcsb.org/structure/8QJ5) | IRRMC [10.18430/m38qj5](https://doi.org/10.18430/m38qj5) | ELETTRA 11.2C | 1.63 | P 1 21 1 | 57.6 100.6 77.9 90.0 96.1 90.0 | PILATUS 6M | Crystal structure of the Levansucrase beta from Pseudomonas syringae pv. actinidiae | 2 | +| [8QQ7](https://www.rcsb.org/structure/8QQ7) | Zenodo [10.5281/zenodo.14901515](https://doi.org/10.5281/zenodo.14901515) | ESRF MASSIF-1 | 3.62 | P 64 2 2 | 146.0 146.0 153.6 90.0 90.0 120.0 | PILATUS3 2M | Structure of SpNOX: a Bacterial NADPH oxidase | 1 | +| [8R5R](https://www.rcsb.org/structure/8R5R) | IRRMC [10.18430/m38r5r](https://doi.org/10.18430/m38r5r) | ESRF ID23-1 | 3.08 | P 21 21 21 | 91.7 132.9 137.5 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | Structure of apo TDO with a bound inhibitor | 1 | +| [8RUD](https://www.rcsb.org/structure/8RUD) | MXRDR [10.18150/RBG2F9](https://doi.org/10.18150/RBG2F9) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.10 | P 1 21 1 | 78.1 91.4 114.5 90.0 96.9 90.0 | Dectris Eiger 16M | Crystal structure of Rhizobium etli L-asparaginase ReAV K138A mutant | 2 | +| [8S38](https://www.rcsb.org/structure/8S38) | MXRDR [10.18150/CGLBVH](https://doi.org/10.18150/CGLBVH) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.89 | I 21 21 21 | 95.4 163.1 219.0 90.0 90.0 90.0 | PILATUS 6M-F | Crystal structure of Medicago truncatula glutamate dehydrogenase 2 in complex with citrate and NAD | 2 | +| [8SA8](https://www.rcsb.org/structure/8SA8) | IRRMC [10.18430/M38SA8](https://doi.org/10.18430/M38SA8) | NSLS-II 19-ID | 1.30 | I 1 2 1 | 87.9 131.5 165.4 90.0 104.5 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Cystathionine beta lyase from Klebsiella aerogenes, Covalently bound and free PLP (I2 form) | 1 | +| [8SQO](https://www.rcsb.org/structure/8SQO) | IRRMC [10.18430/m38sqo](https://doi.org/10.18430/m38sqo) | NSLS-II 19-ID | 1.55 | P 4 3 2 | 112.9 112.9 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (magnesium bound, F16L mutant) | 2 | +| [8SQQ](https://www.rcsb.org/structure/8SQQ) | IRRMC [10.18430/M38SQQ](https://doi.org/10.18430/M38SQQ) | NSLS-II 19-ID | 2.25 | F 4 3 2 | 171.5 171.5 171.5 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (Apo Cubic Form 2, F16L mutant) | 1 | +| [8SQT](https://www.rcsb.org/structure/8SQT) | IRRMC [10.18430/M38SQT](https://doi.org/10.18430/M38SQT) | NSLS-II 19-ID | 2.20 | F 4 3 2 | 170.7 170.7 170.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bacterioferritin (Bfr) from Brucella abortus (iron bound, cubic form 2, F16L mutant) | 1 | +| [8T7R](https://www.rcsb.org/structure/8T7R) | IRRMC [10.18430/M38T7R](https://doi.org/10.18430/M38T7R) | APS 22-ID | 3.84 | C 1 2 1 | 357.1 259.6 255.4 90.0 133.1 90.0 | Dectris Eiger 16M | Crystal structure of human leukocyte antigen A*0101 in complex with the Fab of alloreactive antibody E07 | 1 | +| [8THA](https://www.rcsb.org/structure/8THA) | IRRMC [10.18430/m38tha](https://doi.org/10.18430/m38tha) | SSRL BL9-2 | 1.68 | P 64 | 69.2 69.2 29.1 90.0 90.0 120.0 | PILATUS 6M | 1TEL, non-compressed, double-helical crystal form | 1 | +| [8TYY](https://www.rcsb.org/structure/8TYY) | SBGrid [10.15785/sbgrid/1040](https://doi.org/10.15785/sbgrid/1040) | APS 24-ID-E | 1.68 | F 4 3 2 | 214.9 214.9 214.9 90.0 90.0 90.0 | Dectris Eiger 16M | Structure of a bacterial Ubl-deubiquitinase complex (form 2) | 1 | +| [8U0I](https://www.rcsb.org/structure/8U0I) | IRRMC [10.18430/m38u0i](https://doi.org/10.18430/m38u0i) | ALS 8.2.1 | 1.54 | P 43 21 2 | 50.3 50.3 90.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of PA0012 complexed with cyclic-di-GMP from Pseudomonas aeruginosa | 1 | +| [8V4O](https://www.rcsb.org/structure/8V4O) | IRRMC [10.18430/m38v4o](https://doi.org/10.18430/m38v4o) | NSLS-II 19-ID | 2.70 | P 61 2 2 | 139.5 139.5 545.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of Acetyl-CoA synthetase 2 in complex with AMP from Candida albicans | 1 | +| [8XBP](https://www.rcsb.org/structure/8XBP) | IRRMC [10.18430/M38XBP](https://doi.org/10.18430/M38XBP) | SOLEIL PROXIMA 1 | 1.99 | C 1 2 1 | 148.3 50.8 60.2 90.0 92.3 90.0 | Dectris Eiger 16M | Crystal structure of AtNATA1 bound to Acetyl CoA | 1 | +| [8XTE](https://www.rcsb.org/structure/8XTE) | SBGrid [10.15785/sbgrid/1101](https://doi.org/10.15785/sbgrid/1101) | SSRF BL19U1 | 1.99 | P 32 | 208.8 208.8 67.2 90.0 90.0 120.0 | PILATUS3 6M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP | 1 | +| [8XTF](https://www.rcsb.org/structure/8XTF) | SBGrid [10.15785/sbgrid/1102](https://doi.org/10.15785/sbgrid/1102) | SSRF BL02U1 | 2.13 | H 3 2 | 211.8 211.8 67.4 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of methyltransferase MpaG' in complex with SAH and FDHMP-3C | 1 | +| [8XTG](https://www.rcsb.org/structure/8XTG) | SBGrid [10.15785/sbgrid/1100](https://doi.org/10.15785/sbgrid/1100) | SSRF BL19U1 | 2.00 | P 32 | 199.5 199.5 67.2 90.0 90.0 120.0 | | Crystal structure of methyltransferase MpaG' in complex with SAH and DMMPA | 1 | +| [8Y74](https://www.rcsb.org/structure/8Y74) | XRDa [10.51093/xrd-00227](https://doi.org/10.51093/xrd-00227) | SSRF BL02U1 | 1.90 | C 1 2 1 | 125.8 76.6 87.1 90.0 92.4 90.0 | Dectris EIGER2 Si 9M | Crystal structure of 9-mer peptide from H9N2 avian influenza virus in complex with BF2*0201 | 2 | +| [8YS9](https://www.rcsb.org/structure/8YS9) | IRRMC [10.18430/M38YS9](https://doi.org/10.18430/M38YS9) | PAL/PLS 5C (4A) | 1.46 | P 21 21 21 | 71.0 77.7 83.2 90.0 90.0 90.0 | Dectris Eiger 9M | Crystal structure of Phosphatidylethanolamine N-methyltransferase from R. thermophilum complexed with DMPE and SAH | 1 | +| [9B22](https://www.rcsb.org/structure/9B22) | IRRMC [10.18430/m39b22](https://doi.org/10.18430/m39b22) | NSLS-II 19-ID | 1.30 | P 1 21 1 | 39.8 92.7 57.7 90.0 91.7 90.0 | Dectris EIGER2 Si 9M | Crystal structure of ADP-ribose diphosphatase from Klebsiella pneumoniae (ADP Ribose and AMP bound) | 1 | +| [9BN8](https://www.rcsb.org/structure/9BN8) | IRRMC [10.18430/m39bn8](https://doi.org/10.18430/m39bn8) | NSLS-II 19-ID | 1.35 | P 41 | 65.5 65.5 134.8 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of UDP-N-acetylmuramoylalanine--D-glutamate ligase (MurD) from E. coli in complex with UMA and inhibitor A19 | 1 | +| [9C18](https://www.rcsb.org/structure/9C18) | Zenodo [10.5281/zenodo.11405662](https://doi.org/10.5281/zenodo.11405662) | NSLS-II 17-ID-1 | 1.90 | P 1 | 41.9 42.0 60.2 84.1 87.2 63.7 | Dectris EIGER1 Si 9M | Human biliverdin IX beta reductase in complex with NADP | 1 | +| [9CHW](https://www.rcsb.org/structure/9CHW) | SBGrid [10.15785/sbgrid/1124](https://doi.org/10.15785/sbgrid/1124) | APS 21-ID-F | 2.16 | P 61 | 98.7 98.7 82.1 90.0 90.0 120.0 | Rayonix MX-300 | Crystal structure of human polymerase eta with incoming dAMPnPP nucleotide opposite threofuranosyl thymidine in DNA template | 2 | +| [9CRW](https://www.rcsb.org/structure/9CRW) | IRRMC [10.18430/m39crw](https://doi.org/10.18430/m39crw) | CLSI 08ID-1 | 2.49 | P 1 21 1 | 84.0 104.6 118.8 90.0 93.4 90.0 | Dectris Eiger 9M | Crystal structure of the Candida albicans kinesin-8 proximal tail domain | 1 | +| [9E2T](https://www.rcsb.org/structure/9E2T) | SBGrid [10.15785/sbgrid/1148](https://doi.org/10.15785/sbgrid/1148) | SSRL BL12-1 | 2.28 | P 1 | 75.5 78.1 101.2 94.6 103.4 114.5 | Dectris EIGER2 Si 16M | Structure of a de novo designed interleukin-21 mimetic complex | 1 | +| [9EA5](https://www.rcsb.org/structure/9EA5) | SBGrid [10.15785/sbgrid/1142](https://doi.org/10.15785/sbgrid/1142) | SSRL BL9-2 | 2.00 | P 1 21 1 | 65.9 73.1 98.4 90.0 108.7 90.0 | PILATUS 6M | Structure of Citrobacter BubCD D104A mutant | 2 | +| [9FCF](https://www.rcsb.org/structure/9FCF) | MXRDR [10.18150/DGZKW3](https://doi.org/10.18150/DGZKW3) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.36 | P 4 | 91.3 91.3 35.8 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with ProFAR | 3 | +| [9FCG](https://www.rcsb.org/structure/9FCG) | MXRDR [10.18150/LDLSBT](https://doi.org/10.18150/LDLSBT) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.54 | P 4 | 87.8 87.8 35.6 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Medicago truncatula 5'-ProFAR isomerase (HISN3) D57N mutant in complex with PrFAR | 2 | +| [9FHC](https://www.rcsb.org/structure/9FHC) | Zenodo [10.5281/zenodo.11472085](https://doi.org/10.5281/zenodo.11472085) | SLS X06SA | 2.20 | I 2 3 | 227.5 227.5 227.5 90.0 90.0 90.0 | marCCD, 225 mm plate | Crystallographic structure of AcrB V612F with bound minocycline | 2 | +| [9GDJ](https://www.rcsb.org/structure/9GDJ) | ESRF [10.15151/ESRF-DC-1848199439](https://doi.org/10.15151/ESRF-DC-1848199439) | ESRF ID23-1 | 1.47 | P 41 21 2 | 123.9 123.9 126.4 90.0 90.0 90.0 | Dectris EIGER2 CdTe 16M | C-Methyltransferase SgMT from Streptomyces griseoviridis | 2 | +| [9GJX](https://www.rcsb.org/structure/9GJX) | IRRMC [10.18430/M39GJX](https://doi.org/10.18430/M39GJX) | Diamond I04 | 2.40 | P 1 21 1 | 76.8 115.8 103.8 90.0 110.3 90.0 | Eiger 16M | Bacillus licheniformis nitroreductase | 1 | +| [9GQG](https://www.rcsb.org/structure/9GQG) | ESRF [10.15151/ESRF-DC-1900353437](https://doi.org/10.15151/ESRF-DC-1900353437) | ESRF ID30B | 2.00 | P 32 2 1 | 48.2 48.2 188.0 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | The FK1 domain of FKBP51 in complex with the macrocyclic SAFit analog m5(10,7)-(E)-OH | 2 | +| [9H0Q](https://www.rcsb.org/structure/9H0Q) | Zenodo [10.5281/zenodo.13912326](https://doi.org/10.5281/zenodo.13912326) | SOLEIL PROXIMA 2 | 2.55 | H 3 2 | 169.5 169.5 344.0 90.0 90.0 120.0 | Dectris EIGER1 Si 9M | N terminal domain of BC2L-C lectin in complex with N-(beta-L-Fucopyranosyl)-biphenyl-3-carboxamide | 3 | +| [9HNC](https://www.rcsb.org/structure/9HNC) | MXRDR [10.60884/0K7B68](https://doi.org/10.60884/0K7B68) | PETRA III, EMBL c/o DESY P13 (MX1) | 1.88 | P 1 2 1 | 123.8 123.6 187.7 90.0 90.1 90.0 | PILATUS 6M-F | Crystal structure of potassium-independent L-asparaginase | 1 | +| [9HS7](https://www.rcsb.org/structure/9HS7) | IRRMC [10.18430/M39HS7](https://doi.org/10.18430/M39HS7) | ALBA XALOC | 1.70 | P 65 | 65.4 65.4 88.8 90.0 90.0 120.0 | PILATUS3 X 6M | Anti-HIV-1 chimeric miniprotein mimicking the N-terminal half of gp41 NHR with an extended region targeting the MPER | 1 | +| [9I0A](https://www.rcsb.org/structure/9I0A) | IRRMC [10.18430/M39I0A](https://doi.org/10.18430/M39I0A) | SOLEIL PROXIMA 1 | 2.22 | P 21 21 2 | 75.2 98.7 208.6 90.0 90.0 90.0 | Dectris Eiger 16M | CARM1 in complex with arg-aDMA analog | 1 | +| [9I80](https://www.rcsb.org/structure/9I80) | Zenodo [10.5281/zenodo.14844040](https://doi.org/10.5281/zenodo.14844040) | SOLEIL PROXIMA 1 | 1.95 | P 41 | 81.2 81.2 165.0 90.0 90.0 90.0 | Dectris Eiger 16M | LecA in complex with a tolcapone derivative glycomimetic | 2 | +| [9IG7](https://www.rcsb.org/structure/9IG7) | IRRMC [10.18430/M39IG7](https://doi.org/10.18430/M39IG7) | PETRA III, EMBL c/o DESY P13 (MX1) | 2.60 | P 21 21 2 | 111.5 153.5 69.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides | 1 | +| [9IH9](https://www.rcsb.org/structure/9IH9) | IRRMC [10.18430/M39IH9](https://doi.org/10.18430/M39IH9) | ESRF MASSIF-3 | 1.70 | C 1 2 1 | 78.8 133.9 82.3 90.0 101.4 90.0 | Dectris EIGER1 Si 4M | KEAP1 complexed to linear peptide 6 | 1 | +| [9JZO](https://www.rcsb.org/structure/9JZO) | IRRMC [10.18430/m39jzo](https://doi.org/10.18430/m39jzo) | PAL/PLS 11C | 1.40 | P 1 | 41.6 43.1 54.2 113.0 90.1 118.2 | PILATUS3 6M | Crystal structure of PHICD111_20024_EAD. | 1 | +| [9KHR](https://www.rcsb.org/structure/9KHR) | Zenodo [10.5281/zenodo.14070468](https://doi.org/10.5281/zenodo.14070468) | RRCAT INDUS-2 PX-BL21 | 2.00 | P 21 21 21 | 48.7 50.3 78.0 90.0 90.0 90.0 | marCCD, 225 mm plate | Crystal structure of Plasmoredoxin, a disulfide oxidoreductase from Plasmodium falciparum crystallized in the presence of Dithiothreitol (DTT) | 2 | +| [9MH4](https://www.rcsb.org/structure/9MH4) | IRRMC [10.18430/M39MH4](https://doi.org/10.18430/M39MH4) | NSLS-II 19-ID | 3.05 | P 21 3 | 138.7 138.7 138.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of Bifunctional protein GlmU from Klebsiella aerogenes | 1 | +| [9MIN](https://www.rcsb.org/structure/9MIN) | SBGrid [10.15785/sbgrid/1151](https://doi.org/10.15785/sbgrid/1151) | ALS 8.2.1 | 2.05 | P 21 21 21 | 95.5 98.5 155.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Structure of a designed minibinder to NYESO1-A*02:01 | 1 | +| [9O0H](https://www.rcsb.org/structure/9O0H) | IRRMC [10.18430/M39O0H](https://doi.org/10.18430/M39O0H) | SSRL BL12-2 | 2.24 | P 21 21 21 | 55.2 65.5 112.9 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | The ubiquitin-associated domain of human thirty-eight negative kinase 1, fused to the 3TEL crystallization chaperone via a 2-glycine linker | 1 | +| [9P7Q](https://www.rcsb.org/structure/9P7Q) | IRRMC [10.18430/M39P7Q](https://doi.org/10.18430/M39P7Q) | SSRL BL12-1 | 2.21 | C 1 2 1 | 97.0 45.0 72.1 90.0 105.1 90.0 | Dectris EIGER2 Si 16M | 273K human S-adenosylmethionine decarboxylase | 1 | +| [9PBB](https://www.rcsb.org/structure/9PBB) | IRRMC [10.18430/M39PBB](https://doi.org/10.18430/M39PBB) | SSRL BL12-1 | 2.17 | C 1 2 1 | 97.4 45.9 72.2 90.0 105.0 90.0 | Dectris EIGER2 Si 16M | 293K human S-adenosylmethionine decarboxylase | 1 | +| [9Q41](https://www.rcsb.org/structure/9Q41) | SBGrid [10.15785/sbgrid/1194](https://doi.org/10.15785/sbgrid/1194) | CHESS 7B2 | 1.95 | C 2 2 21 | 118.6 133.7 82.4 90.0 90.0 90.0 | Dectris EIGER2 Si 16M | Crystal Structure of Human Apo Spermidine Synthase | 2 | +| [9Q66](https://www.rcsb.org/structure/9Q66) | SBGrid [10.15785/sbgrid/1208](https://doi.org/10.15785/sbgrid/1208) | NSLS-II 17-ID-1 | 2.01 | P 1 21 1 | 105.9 67.3 158.0 90.0 99.1 90.0 | Dectris EIGER1 Si 9M | Human prolyl endopeptidase (PREP) - complex with JP-4-1-7 | 2 | +| [9QW8](https://www.rcsb.org/structure/9QW8) | ESRF [10.15151/ESRF-DC-2127908021](https://doi.org/10.15151/ESRF-DC-2127908021) | ESRF ID23-1 | 1.80 | P 1 | 35.6 35.6 100.9 86.5 84.2 72.5 | Dectris EIGER2 CdTe 16M | FKBP12 in complex with bifunctional ligand 1ad | 1 | +| [9RCI](https://www.rcsb.org/structure/9RCI) | Zenodo [10.5281/zenodo.15615368](https://doi.org/10.5281/zenodo.15615368) | SOLEIL PROXIMA 2 | 1.66 | P 1 | 35.9 39.3 100.9 98.3 90.3 90.1 | Dectris Eiger 9M | Crystal Structure of Flap Endonuclease FEN1 with Compound 28 | 1 | +| [9RCS](https://www.rcsb.org/structure/9RCS) | XRDa [10.51093/xrd-00383](https://doi.org/10.51093/xrd-00383) | Diamond I24 | 3.01 | P 1 21 1 | 70.0 78.8 82.3 90.0 88.6 90.0 | Eiger 9M | Cardioderma bat coronavirus KY43 receptor binding domain in complex with human CEACAM6 | 2 | +| [9RP9](https://www.rcsb.org/structure/9RP9) | IRRMC [10.18430/M39RP9](https://doi.org/10.18430/M39RP9) | SOLEIL PROXIMA 1 | 2.10 | C 1 2 1 | 73.5 59.8 91.7 90.0 100.8 90.0 | Dectris Eiger 16M | Crystal structure of mouse pVHL-ElonginB-ElonginC complex | 1 | +| [9SL0](https://www.rcsb.org/structure/9SL0) | IRRMC [10.18430/M39SL0](https://doi.org/10.18430/M39SL0) | ESRF MASSIF-1 | 1.60 | P 21 21 21 | 60.2 80.2 111.6 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal structure of HLA-A0201 in complex with peptide LLWNGPMAV | 1 | +| [9T6S](https://www.rcsb.org/structure/9T6S) | SBGrid [10.15785/sbgrid/1260](https://doi.org/10.15785/sbgrid/1260) | ESRF ID30B | 2.00 | P 21 21 21 | 63.0 64.6 102.7 90.0 90.0 90.0 | Dectris EIGER2 Si 9M | Crystal Structure of the Listeria monocytogenes CadC with Cadmium | 2 | +| [9UPT](https://www.rcsb.org/structure/9UPT) | XRDa [10.51093/xrd-00191](https://doi.org/10.51093/xrd-00191) | NSRRC TPS 05A | 2.37 | P 6 | 158.3 158.3 54.0 90.0 90.0 120.0 | SMV, S/N 930 | Structure of AtBgl1A, a GH1 beta-Glucosidase from Acetivibrio thermocellus | 2 | +| [9VX7](https://www.rcsb.org/structure/9VX7) | IRRMC [10.18430/M39VX7](https://doi.org/10.18430/M39VX7) | PAL/PLS 5C (4A) | 4.85 | P 64 | 122.5 122.5 118.9 90.0 90.0 120.0 | PILATUS3 6M | Transcription factor | 1 | +| [9VYB](https://www.rcsb.org/structure/9VYB) | IRRMC [10.18430/M39VYB](https://doi.org/10.18430/M39VYB) | PAL/PLS 5C (4A) | 2.12 | P 21 21 21 | 44.4 47.8 48.4 90.0 90.0 90.0 | Dectris Eiger 9M | Antitoxin Phd | 1 | +| [9W3Y](https://www.rcsb.org/structure/9W3Y) | IRRMC [10.18430/M39W3Y](https://doi.org/10.18430/M39W3Y) | Photon Factory BL-1A | 1.50 | P 21 21 21 | 60.7 70.0 94.2 90.0 90.0 90.0 | Dectris EIGER1 Si 4M | X-ray Crystal Structure of Pseudoazurin Met16Gly variant (Tris-HCl pH 7.6) | 1 | +| [9YL4](https://www.rcsb.org/structure/9YL4) | Zenodo [10.5281/zenodo.17298261](https://doi.org/10.5281/zenodo.17298261) | APS 17-ID | 3.70 | P 21 21 21 | 95.8 111.3 403.0 90.0 90.0 90.0 | PILATUS 6M | Crystal structure of PprA S-F filament from Deinococcus radiodurans | 2 | +| [9YZK](https://www.rcsb.org/structure/9YZK) | IRRMC [10.18430/M39YZK](https://doi.org/10.18430/M39YZK) | ALS 8.2.2 | 4.44 | I 1 2 1 | 75.8 163.0 192.3 90.0 98.6 90.0 | PILATUS3 S 2M | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | 1 | +| [9Z44](https://www.rcsb.org/structure/9Z44) | IRRMC [10.18430/M39Z44](https://doi.org/10.18430/M39Z44) | ALS 8.2.1 | 7.20 | I 1 2 1 | 73.5 127.7 141.2 90.0 92.0 90.0 | Dectris EIGER2 Si 9M | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain | 1 | +| [9Z72](https://www.rcsb.org/structure/9Z72) | SBGrid [10.15785/sbgrid/1239](https://doi.org/10.15785/sbgrid/1239) | SSRL BL9-2 | 2.38 | P 31 2 1 | 59.2 59.2 426.2 90.0 90.0 120.0 | Dectris EIGER2 Si 16M | Structure of V. cholerae CapS (form 1) | 2 | +| [9ZLO](https://www.rcsb.org/structure/9ZLO) | Zenodo [10.5281/zenodo.18652652](https://doi.org/10.5281/zenodo.18652652) | Australian Synchrotron MX2 | 2.00 | P 21 21 21 | 38.4 90.0 107.0 90.0 90.0 90.0 | Dectris EIGER1 Si 16M | Crystal structure of Proteus mirabilis UreE | 1 | +| [9ZM0](https://www.rcsb.org/structure/9ZM0) | IRRMC [10.18430/M39ZM0](https://doi.org/10.18430/M39ZM0) | NSLS-II 17-ID-1 | 2.10 | P 1 21 1 | 50.4 30.1 91.2 90.0 97.1 90.0 | Dectris EIGER1 Si 9M | Crystal structure of monomeric Atg23 | 1 | +| [9ZMU](https://www.rcsb.org/structure/9ZMU) | IRRMC [10.18430/M39ZMU](https://doi.org/10.18430/M39ZMU) | NSLS-II 19-ID | 1.98 | P 65 2 2 | 47.8 47.8 492.6 90.0 90.0 120.0 | Dectris EIGER2 Si 9M | Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form) | 1 | +| — | Zenodo [10.5281/zenodo.1036416](https://doi.org/10.5281/zenodo.1036416) | Diamond Light Source I19-1 | | | | PILATUS 2M | 0.48 Angstrom 3,5-dinitrobenzoic acid (3,5-DNBA) C2/c polymorph single crystal X-ray diffraction data set recorded at Diamond Light Source I19-1 | 1 | +| — | Zenodo [10.5281/zenodo.14894181](https://doi.org/10.5281/zenodo.14894181) | | | | | Dectris Eiger 9M | Dataset for PDB 6r72 Crystal structure of BmrA-E504A in an outward-facing conformation | 1 | +| — | Zenodo [10.5281/zenodo.20041091](https://doi.org/10.5281/zenodo.20041091) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of Ni(dppe)Cl₂ collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | 1 | +| — | Zenodo [10.5281/zenodo.20135265](https://doi.org/10.5281/zenodo.20135265) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of metformin collected on beamline I19-2 at Diamond Light Source with an Eiger 2X 4M with CdTe sensor | 1 | +| — | Zenodo [10.5281/zenodo.6347466](https://doi.org/10.5281/zenodo.6347466) | Diamond Light Source I19-2 | | | | Eiger 2X 4M (CdTe) | Single-crystal X-ray diffractometry data for a sample of [Cu(HF₂)(pyrazine)₂]PF₆ collected on beamline I19-2 at Diamond Light Source | 1 | +| — | Zenodo [10.5281/zenodo.33555](https://doi.org/10.5281/zenodo.33555) | Diamond Light Source I19-1 | | | | PILATUS 2M | Example Cytidine data set from I19-1 at Diamond Light Source | 1 | +| — | Zenodo [10.5281/zenodo.11946282](https://doi.org/10.5281/zenodo.11946282) | Diamond Light Source I19 | | | | PILATUS 2M | RODIN X-ray Diffraction Data 2360282 (L-alanine) | 1 | Seven rows have no PDB code. Six are small-molecule / chemical-crystallography datasets, kept because they exercise short wavelengths, CdTe sensors, fine slicing and non-zero detector @@ -191,13 +212,18 @@ because they exercise short wavelengths, CdTe sensors, fine slicing and non-zero no deposited macromolecular values, so those columns are blank, and their titles are the repository record titles verbatim. +Five of the third-round datasets are in primitive space groups with no screw axis - 6ZQR, 6ZQY, +6ZR0 and 9FCF in P 4, and 6NEN in P 3 1 2. They are in the battery as negative controls for +screw-axis detection: the correct answer for each has no systematic absences. + ## Archives that are not a single sweep -Most rows above are a single continuous rotation. Among the first 102 datasets twenty-one +Most rows above are a single continuous rotation. Among the 102 first-round datasets twenty-one archives are not; their layout is read from the image files themselves, from the repository file listings and from the depositors' own description of the record. (The 51 datasets of the second -scouting round, described at the end of this page, have not had their archive layouts audited to -this depth.) Where an archive held more than one collection, only one is kept - +scouting round, described at the end of this page, and the 18 of the third have not had their +archive layouts audited to this depth; the third-round archives that needed special handling are +described at the end of this section.) Where an archive held more than one collection, only one is kept - the repository's project page is not a reliable guide to this, because it describes the project rather than the tarball (7TCD's page lists a 900-frame miniCBF sweep the archive does not contain). @@ -251,6 +277,18 @@ noted. | 9E2T | one continuous sweep plus screening images | the 2700-frame sweep | | 8OWM | three MXRDR zips covering one 1800-frame sweep, plus a processed-data zip | the three sweep zips (proc zip skipped) | +**Three third-round archives needed special handling to obtain the images.** + +- **5KY6** is served by MXRDR as 11 separate RAR archives, one folder of frames per archive, 50 + frames per archive except the last, 564 frames in all. Reading them needs a RAR reader with + RAR3 filter support: the official 7-Zip `7zz` reads them, while the unrar-free and p7zip builds + of Enterprise Linux 8 cannot. +- **6ZR0**'s zip, as the Keele University repository serves it, is damaged: it has no central + directory. Frames 1-1059 of the 1060 were recovered from the zip's local file headers; the last + frame is lost. +- **6NEN**'s University of Queensland eSpace record blocks scripted download, so its archive was + downloaded by hand in a browser. + ## Datasets published as Raw Data Letters Three of the datasets - 6R72, 8QQ7 and 6RLR - were published as IUCrData Raw Data Letters, a @@ -274,7 +312,7 @@ The authors of the second letter also published their own reciprocal-space recon ## Detector: image file vs PDB entry -For 94 of the first 95 PDB-coded rows both the image file and the PDB entry name a detector. (For +For 94 of the 95 first-round PDB-coded rows both the image file and the PDB entry name a detector. (For 8XTG neither can be compared - the header reads `PILATUS XXX, S/N XX-XXX`.) The table above uses the file value in every case, because the entry's label is often approximate. @@ -334,16 +372,28 @@ The other 44 of the 51 agree with their entry, up to how much each side states: `Rayonix MX-300` (the same detector under its later brand), a serial number or an `-F` suffix the entry leaves off. +**Two of the 18 third-round datasets conflict with their PDB entry:** + +| PDB | PDB entry says | Image file says | Conflict | +|---|---|---|---| +| 5MLN | MARMOSAIC 225 mm CCD | PILATUS3 2M, S/N 24-0118, ESRF ID23 | model / size | +| 9H0Q | DECTRIS EIGER X 16M | Dectris EIGER1 Si 9M, E-18-0102 | model / size | + +The other 16 agree with their entry up to how much each side states. The three ADSC entries +(`ADSC QUANTUM 315`, `ADSC QUANTUM 315r`) have SMV files of 3072 x 3072 pixels of 0.1026 mm (0.102592 mm for +6NEN), a 315 mm detector; the marCCD files are 225 mm plates where the entry names a 225 mm detector and +300 mm plates where it names a 300 mm one. + ## Deposited models and structure factors -146 of the 153 datasets have a released PDB entry (the 51 of the second round all do), and RCSB +164 of the 171 datasets have a released PDB entry (those of the second and third rounds all do), and RCSB reports released structure factors (`status_code_sf = REL`) for every one of them. A merged result from this pipeline can therefore be checked against the deposited model or against the deposited intensities. ## Rows where our reduction and the deposition disagree -Six of the 153 rows are ones where `rugnux` does not reproduce the deposited space group or +Six of the 171 rows are ones where `rugnux` does not reproduce the deposited space group or cell, and where we have looked at the disagreement closely enough to change how the row is scored. They are collected here because a scoring row that silently disagrees with a published entry is not something a reader should have to discover from the code. @@ -505,7 +555,7 @@ numeric cell was located, so a run on it can be scored on the space group and no ## The second-round additions in numbers -The last 51 PDB-coded rows of the table were added together, in a second scouting round chosen +The 51 rows marked round 2 in the table were added together, in a second scouting round chosen to widen the spread of file formats, detectors, facilities and symmetries rather than to be easy to process. They hold 519 GB of images. The counts below describe where that collection comes from; like everything else on this page, they are metadata about the depositions and their @@ -526,6 +576,17 @@ The format spread is the point of the round: these datasets are the reason rugnu SMV and gzip-compressed miniCBF natively, and accepts the `.img` and numeric-suffix (`.001`) file names those formats arrive with. +## The third-round additions in numbers + +The 18 rows marked round 3 were added to widen the symmetry coverage: five are the screw-free +negative controls named below the table, and three have a cell axis longer than 320 Å (6G1F, +9H0Q and 6QAJ). + +- **Repository:** IRRMC 5, MXRDR 4, SBGrid 3, Keele University 3, Zenodo 2, University of + Queensland eSpace 1. +- **File format, as the images are on disk after extraction:** marCCD 8, miniCBF 6 (one + gzip-compressed), SMV 3, NXmx HDF5 1. + ## Licences Each dataset carries the licence of its own deposition, stated on the record page linked